view test-data/relax-in2.nex @ 34:a6619171428e draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hyphy/ commit 821e0f3e4546bc55e093ab63bd9f9b57f2bf772d
author iuc
date Thu, 18 Aug 2022 14:05:48 +0000
parents 5f2ca10db92a
children
line wrap: on
line source

#NEXUS

[
Generated by HYPHY 0.9920070619beta(MP) for MacOS(Carbon) on Thu Jun 21 16:59:04 2007

]

BEGIN TAXA;
	DIMENSIONS NTAX = 10;
	TAXLABELS
		'Baboon' 'Cow' 'Pig' 'Rat' ;
END;

BEGIN CHARACTERS;
	DIMENSIONS NCHAR = 561;
	FORMAT
		DATATYPE = DNA

		GAP=-
		MISSING=?
	;

MATRIX
	'Baboon'    AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAAATGGGAGAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAATTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
	'Cow'       ------------GAAAGCATTGTCGTCTGGGGTGCCCTGGATCATGACCTCAACCTGGACATTCCTGGTTTTCCAAGAAGTGATATAGTGGCAGATATAAAATGGAACAGA------AACAAAAACAAGATTGCACGAATAAAGAAAGATATGCCACTTCACAATGAAATGGACAAATATGATATGTTTACAAATGGAACTCTGAAAATTAAAACT---CTGATGAGAAACGATAGTGGTCTCTATGAGGTAGAGGTTTATGATTCAAATGGAGTAAACCTACTGAGCAAAAAATTTGATTTGAAGATTCAAGAGATGCTCTCAGGACCTGAAATTAACTGGATCTGTACCAACAGAACTGTGAGCTGCAAGGTAGAAAATGGAAGTAATCCTAAATTACAACTGTTTTTAAATACGACCCGTGTCAAACAAGATCATGGGAAGCTCATCACCTACACGTGGAACACCAGATGGAATAAAACATTCAAGTGCGTGGCGAGTAACCATGTCGATAGCAAAGTCAGCATAGAGATCGCCGTGTGTCCAGATGAAGGTCTGGAT
	'Pig'       ---------------ACTGAGGTTGTCTGGGGCATCGTGGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATATACGATGGCAGAAG------AATGAAAACAAGATCGCAGAATTTAAAAAAAACAAAGAAACTCACCCTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGAT---CTGAAGAGAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGGAGAGAAAATTTGATTTGCCGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCTGTGCCGACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGTATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACACCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCATGGTGACCATCAGTTGTACGGGGCAAGGTCTGGAT
	'Rat'       ---------AGAGACAGTGGGACCGTCTGGGGTGCCCTGGGTCATGGCATCAACCTGAACATCCCTAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGAGAGG------GGGAGCACCCTGGTTGCCGAGTTTAAAAGGAAGATGAAGCCTTTTTTGAAATCGGGAGCATTTGAGATCTTAGCAAATGGAGACTTGAAGATAAAGAAT---CTGACAAGAGATGACAGTGGCACCTATAATGTAACGGTATACAGCACAAATGGGACACGTATCCTGGACAAGGCACTGGACTTGAGGATTCTAGAGATGGTCTCAAAGCCGATGATCTACTGGGAGTGCAGCAACGCAACCCTGACCTGTGAGGTCTTGGAAGGAACAGATGTTGAACTAAAGCTGTACCAAGGAAAGGAGCATCTCAGGAGCCTCCGTCAGAAGACCATGAGTTACCAGTGG---ACCAACCTGAGAGCACCGTTTAAGTGCAAGGCGGTAAACAGGGTCAGCCAGGAGTCTGAGATGGAAGTTGTCAACTGTCCAGAGAAAGGTCTGCCC;
END;

BEGIN TREES;
	TREE tree = (((Pig:0.147969,Cow:0.213430):0.085099,Baboon{PR}:0.003108){PR}:0.340802,Rat:0.050958);
END;

BEGIN HYPHY;

DATA_PANEL_SOURCE_PATH="";
DataSet CD2 = ReadDataFile (USE_NEXUS_FILE_DATA);
DataSetFilter CD2_part = CreateFilter (CD2,3,"0-560","(null)","TAA,TAG,TGA");
Tree CD2_tree=(((Pig,Cow)Node2,Baboon)Node1,Rat);
OpenDataPanel(CD2,"(null)","0,0,0,0,2,0,10","MG94xREV_3x4,6,0,14443523,CD2_tree",CD2_LF);

global CD2_part_Shared_AC=0.5710714109234631;
global CD2_part_Shared_AT=0.2756961373814887;
global CD2_part_Shared_CG=0.4456308760366715;
global CD2_part_Shared_CT=0.9454291760502562;
global CD2_part_Shared_GT=0.3224080259059006;
CD2_tree.Baboon.nonSynRate=0;
CD2_tree.Baboon.synRate=0.01716650886630832;
CD2_tree.Rat.synRate=0.1533251749656354;
CD2_tree.Rat.nonSynRate=0.1585006932449144;
CD2_tree.Node1.nonSynRate=0.5097883291072822;
CD2_tree.Node1.synRate=1.227004762734591;
CD2_tree.Pig.nonSynRate=0.4826366809736332;
CD2_tree.Cow.nonSynRate=0.681831503936737;
CD2_tree.Pig.synRate=0.3721230153643161;
CD2_tree.Node2.synRate=0.2137858662796737;
CD2_tree.Node2.nonSynRate=0.1379570235930709;
CD2_tree.Cow.synRate=0.3646221318370894;

END;