changeset 34:a6619171428e draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hyphy/ commit 821e0f3e4546bc55e093ab63bd9f9b57f2bf772d
author iuc
date Thu, 18 Aug 2022 14:05:48 +0000
parents 212c958f6cee
children
files test-data/relax-in1.fa test-data/relax-in1.nhx test-data/relax-in2.nex test-data/relax-in2.nhx test-data/relax-out2-1.json
diffstat 5 files changed, 142 insertions(+), 214 deletions(-) [+]
line wrap: on
line diff
--- a/test-data/relax-in1.fa	Wed Mar 30 00:15:54 2022 +0000
+++ b/test-data/relax-in1.fa	Thu Aug 18 14:05:48 2022 +0000
@@ -1,20 +1,8 @@
->Human
-AAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
->Chimp
-GAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
 >Baboon
 AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAAATGGGAGAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAATTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
->RhMonkey
-AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAGATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAAYTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGRCCCCGAATTAAACCTGTATCAAGATGGGAAACATGTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
 >Cow
 ------------GAAAGCATTGTCGTCTGGGGTGCCCTGGATCATGACCTCAACCTGGACATTCCTGGTTTTCCAAGAAGTGATATAGTGGCAGATATAAAATGGAACAGA------AACAAAAACAAGATTGCACGAATAAAGAAAGATATGCCACTTCACAATGAAATGGACAAATATGATATGTTTACAAATGGAACTCTGAAAATTAAAACT---CTGATGAGAAACGATAGTGGTCTCTATGAGGTAGAGGTTTATGATTCAAATGGAGTAAACCTACTGAGCAAAAAATTTGATTTGAAGATTCAAGAGATGCTCTCAGGACCTGAAATTAACTGGATCTGTACCAACAGAACTGTGAGCTGCAAGGTAGAAAATGGAAGTAATCCTAAATTACAACTGTTTTTAAATACGACCCGTGTCAAACAAGATCATGGGAAGCTCATCACCTACACGTGGAACACCAGATGGAATAAAACATTCAAGTGCGTGGCGAGTAACCATGTCGATAGCAAAGTCAGCATAGAGATCGCCGTGTGTCCAGATGAAGGTCTGGAT
 >Pig
 ---------------ACTGAGGTTGTCTGGGGCATCGTGGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATATACGATGGCAGAAG------AATGAAAACAAGATCGCAGAATTTAAAAAAAACAAAGAAACTCACCCTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGAT---CTGAAGAGAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGGAGAGAAAATTTGATTTGCCGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCTGTGCCGACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGTATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACACCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCATGGTGACCATCAGTTGTACGGGGCAAGGTCTGGAT
->Horse
-------------AAGAATATCACCATCTTGGGTGCCCTGGAACGTGATATCAACCTGGACATTCCTGCTTTTCAAATGAGTGAGCATGTAGAAGATATACAATGGAGCAAA------GGAAAAACCAAGATTGCAAAATTCAAAAATGGCAGTATGACTTTCCAGAAAGATAAAACATACGAGGTATTAAAAAATGGAACTCTGAAAATTAAACAT---CTGGAGAGAATTCATGAAGGTACCTACAAGGTAGACGCATATGATAGTGATGGAAAAAATGTGTTGGAGGAAACATTTCATTTGAGCCTTCTAGAGATGGTCTCAAAACCTAATATCTCCTGGAGCTGCACCAACACCACCCTGACCTGCGAGGTGACAAAAGGAACTGACTTTGAGTTAAAACTCTATCTAAATGGGAGAATGATCCAAAAAAGTCCTCGCAAAGTCATCGTATACAAGCGGGCCAGCAACCAAATTGCGTCCTTCAAGTGCACAGCCAATAACACAGTCAGCGAGGAAAGCAGCTCTGTGGTCATCAGGTGTACAGAGAAAGGTCTGGAT
->Cat
----------GCAAATGATGATATCGTCTGGGGTACCCTGGGTCAGGACATCAACCTGGACATTCCTGATTCTCAA---GGGATTAATATAGATGATATACACTGGGAAAAA------GGCAAGAAGAAGGTGGCGAGGTTCCAAATTAGCAACAAGCCTAAGAATCCAGATGAAAAATATAATGTGTCAATGAATGGAACTCTGAAAATTAAACAT---CTGATGCTAGAAGACTGCGATACCTACAAGGTTGTTATATACGATAAGGATGGAAAGAATGTGTTGGATAAAACATTTCAGCTGAAGATTCAAGAGAAGGTCTCAACGCCTAACATCGACTGGAATTGTATCAACAAAACCCTGGTCTGTAAGGTATCAAATGGAACAGACCCTGAATTAAAACTGTACGTAAATGGGACCAGTATCAAGCCCGTTTCTTCGAAGTTCAGCACATACAGGTTTATAAACAAGCAGAAGATATTAGTCAACTGCACGGCAGAAAACAAAGTCAGCAAGGAAAGCGACGTGAAGATGATCACTTGTTCAGAGAAGGGTCTGGAC
->Mouse
----------AGAGACAATGAGACCATCTGGGGTGTCTTGGGTCATGGCATCACCCTGAACATCCCCAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGTAAGG------AGGGGCACCCTGGTCGCAGAGTTTAAAAGGAAGAAGCCACCTTTTTTGATATCAGAAACGTATGAGGTCTTAGCAAACGGATCCCTGAAGATAAAGAAGCCGATGATGAGAAACGACAGTGGCACCTATAATGTAATGGTGTATGGCACAAATGGGATGACTAGGCTGGAGAAGGACCTGGACGTGAGGATTCTGGAGAGGGTCTCAAAGCCCATGATCCACTGGGAATGCCCCAACACAACCCTGACCTGTGCGGTCTTGCAAGGGACAGATTTTGAACTGAAGCTGTATCAAGGGGAAACACTACTCAATAGTCTCCCCCAGAAGAACATGAGTTACCAGTGG---ACCAACCTGAACGCACCATTCAAGTGTGAGGCGATAAACCCGGTCAGCAAGGAGTCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCC
 >Rat
 ---------AGAGACAGTGGGACCGTCTGGGGTGCCCTGGGTCATGGCATCAACCTGAACATCCCTAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGAGAGG------GGGAGCACCCTGGTTGCCGAGTTTAAAAGGAAGATGAAGCCTTTTTTGAAATCGGGAGCATTTGAGATCTTAGCAAATGGAGACTTGAAGATAAAGAAT---CTGACAAGAGATGACAGTGGCACCTATAATGTAACGGTATACAGCACAAATGGGACACGTATCCTGGACAAGGCACTGGACTTGAGGATTCTAGAGATGGTCTCAAAGCCGATGATCTACTGGGAGTGCAGCAACGCAACCCTGACCTGTGAGGTCTTGGAAGGAACAGATGTTGAACTAAAGCTGTACCAAGGAAAGGAGCATCTCAGGAGCCTCCGTCAGAAGACCATGAGTTACCAGTGG---ACCAACCTGAGAGCACCGTTTAAGTGCAAGGCGGTAAACAGGGTCAGCCAGGAGTCTGAGATGGAAGTTGTCAACTGTCCAGAGAAAGGTCTGCCC
--- a/test-data/relax-in1.nhx	Wed Mar 30 00:15:54 2022 +0000
+++ b/test-data/relax-in1.nhx	Thu Aug 18 14:05:48 2022 +0000
@@ -1,1 +1,1 @@
-((((Pig:0.147969,Cow{TEST}:0.21343):0.085099,Horse{TEST}:0.165787,Cat{TEST}:0.264806):0.058611,((RhMonkey:0.002015,Baboon:0.003108):0.022733,(Human:0.004349,Chimp:0.000799):0.011873):0.101856):0.340802,Rat:0.050958,Mouse:0.09795)
\ No newline at end of file
+(((Pig:0.147969,Cow{TEST}:0.21343):0.085099,Baboon:0.011873):0.340802,Rat:0.050958)
--- a/test-data/relax-in2.nex	Wed Mar 30 00:15:54 2022 +0000
+++ b/test-data/relax-in2.nex	Thu Aug 18 14:05:48 2022 +0000
@@ -8,7 +8,7 @@
 BEGIN TAXA;
 	DIMENSIONS NTAX = 10;
 	TAXLABELS
-		'Human' 'Chimp' 'Baboon' 'RhMonkey' 'Cow' 'Pig' 'Horse' 'Cat' 'Mouse' 'Rat' ;
+		'Baboon' 'Cow' 'Pig' 'Rat' ;
 END;
 
 BEGIN CHARACTERS;
@@ -21,20 +21,14 @@
 	;
 
 MATRIX
-	'Human'     AAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
-	'Chimp'     GAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
 	'Baboon'    AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAAATGGGAGAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAATTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
-	'RhMonkey'  AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAGATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAAYTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGRCCCCGAATTAAACCTGTATCAAGATGGGAAACATGTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
 	'Cow'       ------------GAAAGCATTGTCGTCTGGGGTGCCCTGGATCATGACCTCAACCTGGACATTCCTGGTTTTCCAAGAAGTGATATAGTGGCAGATATAAAATGGAACAGA------AACAAAAACAAGATTGCACGAATAAAGAAAGATATGCCACTTCACAATGAAATGGACAAATATGATATGTTTACAAATGGAACTCTGAAAATTAAAACT---CTGATGAGAAACGATAGTGGTCTCTATGAGGTAGAGGTTTATGATTCAAATGGAGTAAACCTACTGAGCAAAAAATTTGATTTGAAGATTCAAGAGATGCTCTCAGGACCTGAAATTAACTGGATCTGTACCAACAGAACTGTGAGCTGCAAGGTAGAAAATGGAAGTAATCCTAAATTACAACTGTTTTTAAATACGACCCGTGTCAAACAAGATCATGGGAAGCTCATCACCTACACGTGGAACACCAGATGGAATAAAACATTCAAGTGCGTGGCGAGTAACCATGTCGATAGCAAAGTCAGCATAGAGATCGCCGTGTGTCCAGATGAAGGTCTGGAT
 	'Pig'       ---------------ACTGAGGTTGTCTGGGGCATCGTGGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATATACGATGGCAGAAG------AATGAAAACAAGATCGCAGAATTTAAAAAAAACAAAGAAACTCACCCTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGAT---CTGAAGAGAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGGAGAGAAAATTTGATTTGCCGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCTGTGCCGACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGTATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACACCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCATGGTGACCATCAGTTGTACGGGGCAAGGTCTGGAT
-	'Horse'     ------------AAGAATATCACCATCTTGGGTGCCCTGGAACGTGATATCAACCTGGACATTCCTGCTTTTCAAATGAGTGAGCATGTAGAAGATATACAATGGAGCAAA------GGAAAAACCAAGATTGCAAAATTCAAAAATGGCAGTATGACTTTCCAGAAAGATAAAACATACGAGGTATTAAAAAATGGAACTCTGAAAATTAAACAT---CTGGAGAGAATTCATGAAGGTACCTACAAGGTAGACGCATATGATAGTGATGGAAAAAATGTGTTGGAGGAAACATTTCATTTGAGCCTTCTAGAGATGGTCTCAAAACCTAATATCTCCTGGAGCTGCACCAACACCACCCTGACCTGCGAGGTGACAAAAGGAACTGACTTTGAGTTAAAACTCTATCTAAATGGGAGAATGATCCAAAAAAGTCCTCGCAAAGTCATCGTATACAAGCGGGCCAGCAACCAAATTGCGTCCTTCAAGTGCACAGCCAATAACACAGTCAGCGAGGAAAGCAGCTCTGTGGTCATCAGGTGTACAGAGAAAGGTCTGGAT
-	'Cat'       ---------GCAAATGATGATATCGTCTGGGGTACCCTGGGTCAGGACATCAACCTGGACATTCCTGATTCTCAA---GGGATTAATATAGATGATATACACTGGGAAAAA------GGCAAGAAGAAGGTGGCGAGGTTCCAAATTAGCAACAAGCCTAAGAATCCAGATGAAAAATATAATGTGTCAATGAATGGAACTCTGAAAATTAAACAT---CTGATGCTAGAAGACTGCGATACCTACAAGGTTGTTATATACGATAAGGATGGAAAGAATGTGTTGGATAAAACATTTCAGCTGAAGATTCAAGAGAAGGTCTCAACGCCTAACATCGACTGGAATTGTATCAACAAAACCCTGGTCTGTAAGGTATCAAATGGAACAGACCCTGAATTAAAACTGTACGTAAATGGGACCAGTATCAAGCCCGTTTCTTCGAAGTTCAGCACATACAGGTTTATAAACAAGCAGAAGATATTAGTCAACTGCACGGCAGAAAACAAAGTCAGCAAGGAAAGCGACGTGAAGATGATCACTTGTTCAGAGAAGGGTCTGGAC
-	'Mouse'     ---------AGAGACAATGAGACCATCTGGGGTGTCTTGGGTCATGGCATCACCCTGAACATCCCCAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGTAAGG------AGGGGCACCCTGGTCGCAGAGTTTAAAAGGAAGAAGCCACCTTTTTTGATATCAGAAACGTATGAGGTCTTAGCAAACGGATCCCTGAAGATAAAGAAGCCGATGATGAGAAACGACAGTGGCACCTATAATGTAATGGTGTATGGCACAAATGGGATGACTAGGCTGGAGAAGGACCTGGACGTGAGGATTCTGGAGAGGGTCTCAAAGCCCATGATCCACTGGGAATGCCCCAACACAACCCTGACCTGTGCGGTCTTGCAAGGGACAGATTTTGAACTGAAGCTGTATCAAGGGGAAACACTACTCAATAGTCTCCCCCAGAAGAACATGAGTTACCAGTGG---ACCAACCTGAACGCACCATTCAAGTGTGAGGCGATAAACCCGGTCAGCAAGGAGTCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCC
 	'Rat'       ---------AGAGACAGTGGGACCGTCTGGGGTGCCCTGGGTCATGGCATCAACCTGAACATCCCTAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGAGAGG------GGGAGCACCCTGGTTGCCGAGTTTAAAAGGAAGATGAAGCCTTTTTTGAAATCGGGAGCATTTGAGATCTTAGCAAATGGAGACTTGAAGATAAAGAAT---CTGACAAGAGATGACAGTGGCACCTATAATGTAACGGTATACAGCACAAATGGGACACGTATCCTGGACAAGGCACTGGACTTGAGGATTCTAGAGATGGTCTCAAAGCCGATGATCTACTGGGAGTGCAGCAACGCAACCCTGACCTGTGAGGTCTTGGAAGGAACAGATGTTGAACTAAAGCTGTACCAAGGAAAGGAGCATCTCAGGAGCCTCCGTCAGAAGACCATGAGTTACCAGTGG---ACCAACCTGAGAGCACCGTTTAAGTGCAAGGCGGTAAACAGGGTCAGCCAGGAGTCTGAGATGGAAGTTGTCAACTGTCCAGAGAAAGGTCTGCCC;
 END;
 
 BEGIN TREES;
-	TREE tree = ((((Pig:0.147969,Cow:0.213430):0.085099,Horse:0.165787,Cat:0.264806):0.058611,((RhMonkey{PR}:0.002015,Baboon{PR}:0.003108){PR}:0.022733,(Human{PR}:0.004349,Chimp{PR}:0.000799){PR}:0.011873){PR}:0.101856){PR}:0.340802,Rat:0.050958,Mouse:0.097950);
+	TREE tree = (((Pig:0.147969,Cow:0.213430):0.085099,Baboon{PR}:0.003108){PR}:0.340802,Rat:0.050958);
 END;
 
 BEGIN HYPHY;
@@ -42,7 +36,7 @@
 DATA_PANEL_SOURCE_PATH="";
 DataSet CD2 = ReadDataFile (USE_NEXUS_FILE_DATA);
 DataSetFilter CD2_part = CreateFilter (CD2,3,"0-560","(null)","TAA,TAG,TGA");
-Tree CD2_tree=((((Pig,Cow)Node3,Horse,Cat)Node2,((RhMonkey,Baboon)Node9,(Human,Chimp)Node12)Node8)Node1,Rat,Mouse);
+Tree CD2_tree=(((Pig,Cow)Node2,Baboon)Node1,Rat);
 OpenDataPanel(CD2,"(null)","0,0,0,0,2,0,10","MG94xREV_3x4,6,0,14443523,CD2_tree",CD2_LF);
 
 global CD2_part_Shared_AC=0.5710714109234631;
@@ -50,36 +44,16 @@
 global CD2_part_Shared_CG=0.4456308760366715;
 global CD2_part_Shared_CT=0.9454291760502562;
 global CD2_part_Shared_GT=0.3224080259059006;
-CD2_tree.Node12.synRate=0.08168540352543764;
-CD2_tree.Node8.nonSynRate=0.2938890030949185;
-CD2_tree.Human.synRate=1e-30;
 CD2_tree.Baboon.nonSynRate=0;
 CD2_tree.Baboon.synRate=0.01716650886630832;
-CD2_tree.Node12.nonSynRate=0.02962786133931161;
-CD2_tree.Chimp.synRate=1e-30;
-CD2_tree.Chimp.nonSynRate=0.005834136861061837;
-CD2_tree.Node9.nonSynRate=0.0433794394076959;
-CD2_tree.Human.nonSynRate=0;
-CD2_tree.Node9.synRate=0.1139808847086709;
-CD2_tree.Node8.synRate=0.1586154947684889;
 CD2_tree.Rat.synRate=0.1533251749656354;
-CD2_tree.Mouse.nonSynRate=0.2332402459120736;
-CD2_tree.Mouse.synRate=0.4604267094040578;
 CD2_tree.Rat.nonSynRate=0.1585006932449144;
 CD2_tree.Node1.nonSynRate=0.5097883291072822;
 CD2_tree.Node1.synRate=1.227004762734591;
-CD2_tree.RhMonkey.synRate=0;
-CD2_tree.Node3.synRate=0.1877287558837553;
 CD2_tree.Pig.nonSynRate=0.4826366809736332;
-CD2_tree.Horse.nonSynRate=0.518627673056701;
 CD2_tree.Cow.nonSynRate=0.681831503936737;
-CD2_tree.Cat.synRate=0.4672127128189641;
-CD2_tree.Node3.nonSynRate=0.2648957141533021;
-CD2_tree.Horse.synRate=0.430860769501357;
 CD2_tree.Pig.synRate=0.3721230153643161;
 CD2_tree.Node2.synRate=0.2137858662796737;
-CD2_tree.RhMonkey.nonSynRate=0.01161863878954486;
-CD2_tree.Cat.nonSynRate=0.7203773170684773;
 CD2_tree.Node2.nonSynRate=0.1379570235930709;
 CD2_tree.Cow.synRate=0.3646221318370894;
 
--- a/test-data/relax-in2.nhx	Wed Mar 30 00:15:54 2022 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-((((Pig{TEST}:0.147969,Cow{TEST}:0.21343){TEST}:0.085099,Horse:0.165787,Cat:0.264806){TEST}:0.058611,((RhMonkey{REFERENCE}:0.002015,Baboon{REFERENCE}:0.003108){REFERENCE}:0.022733,(Human{REFERENCE}:0.004349,Chimp{REFERENCE}:0.000799):0.011873){REFERENCE}:0.101856){REFERENCE}:0.340802,Rat{REFERENCE}:0.050958,Mouse{REFERENCE}:0.09795)
--- a/test-data/relax-out2-1.json	Wed Mar 30 00:15:54 2022 +0000
+++ b/test-data/relax-out2-1.json	Thu Aug 18 14:05:48 2022 +0000
@@ -1,60 +1,55 @@
 {
- "Synonymous site-posteriors":  [
-[0.6636913410863983, 0.4162861463391083, 0.4207669648198341, 0.5266957556553843, 0.7895328001950979, 0.9272590205679656, 0.6152945530195142, 0.7578515907144813, 0.1238947876214084, 0.3018037085532145, 0.2282864078469784, 0.7937331893941735, 0.5320234040808555, 0.4706871966418729, 0.5439405260809865, 0.1517881809649885, 0.09043162428247122, 0.08685065723885507, 0.03885767834229433, 0.05375215759679093, 0.1268225432845697, 0.07577668231270167, 0.6052751007842404, 0.2502160552371602, 0.2736708121460947, 0.7706988555442902, 0.748841088623575, 0.5723843790763415, 0.8949826459565234, 0.6384606763319275, 0.8239292808797724, 0.1664437117300734, 0.06847586601224155, 0.8824121911043322, 0.1271766673209644, 0.1148021398435604, 0.4117122840037579, 0.406499277480147, 0.4008888256405372, 0.8646423634969567, 0.8190691829853963, 0.500042208706628, 0.06797606990283254, 0.8587865476515109, 0.2593957205794197, 0.9238491908671513, 0.8512119846143551, 0.3063762561200102, 0.6669337037749883, 0.8301646821437867, 0.636853262388444, 0.2905505446517289, 0.241935494101366, 0.8128255914518664, 0.8694325465217606, 0.848675874090462, 0.7267309584033903, 0.6911098971620047, 0.583052312866751, 0.7867301296752277, 0.8804662810822645, 0.809644890871663, 0.3376753254168838, 0.8283707254597538, 0.4508845830660299, 0.0216331593168105, 0.3776212213040052, 0.07931015513156162, 0.2950308574589764, 0.1222844084424193, 0.2323128587705404, 0.8289275512891175, 0.631178544197552, 0.05325361766368054, 0.8662251485184755, 0.3212301783117932, 0.861017744903573, 0.5761459249816555, 0.7343170662946317, 0.09741215372980042, 0.1807849329793456, 0.4569927206185401, 0.1643327673634512, 0.1185284443150185, 0.7324030664891016, 0.8472376168908595, 0.8234507825433042, 0.3173650640633187, 0.9292941067446137, 0.2735709551124761, 0.06276324502006964, 0.8863623602779909, 0.8489458938246637, 0.9130985854899469, 0.2797994574222102, 0.9075929417789967, 0.5150137541063844, 0.6723801037322925, 0.06367665954274145, 0.7320704660828672, 0.3527697452184735, 0.8461914351678148, 0.1351211810935134, 0.4613328492603073, 0.124276342334713, 0.8475110259360163, 0.06206865929630392, 0.04122997041189784, 0.8672530362064098, 0.4581644690927911, 0.8415744872053624, 0.1236376392825715, 0.9203127839835408, 0.1271766673209644, 0.8695568439105728, 0.3242726536321666, 0.6064715811235907, 0.1165318836810881, 0.8722046458122451, 0.2149812075751182, 0.0665951965283386, 0.2742588346922531, 0.3653273246144033, 0.721568903142608, 0.2413820620693605, 0.588103471777193, 0.8686043286753734, 0.08010632672074527, 0.5761580378346324, 0.523544810651528, 0.7668186650136124, 0.731052877850959, 0.329467117190821, 0.3208367729701002, 0.06144214634573335, 0.8062919404136638, 0.6220061302015701, 0.2090699504697991, 0.9185889308419551, 0.7767477941019779, 0.5356868588016898, 0.8031407570629746, 0.9042937966352298, 0.7393000429370805, 0.5400823150565389, 0.7357099400943075, 0.9523857813416914, 0.1564516235889077, 0.4882755555291234, 0.1252145971401747, 0.9240797408523314, 0.3440045440887274, 0.2962312024479645, 0.7573666819357475, 0.8253574958581319, 0.1229691454797458, 0.5683960261123714, 0.8313273153092753, 0.8469672878626771, 0.9486952624246412, 0.9172349146810788, 0.3831591722552873, 0.1357178596976572, 0.363473489194153, 0.9082063423261078, 0.7310413241232628, 0.8851632091676694, 0.04945472390779559, 0.7711621490316225, 0.05488172075128287, 0.5228323482367553, 0.9173152634471772, 0.5124114157230398, 0.346256158312588, 0.6630870619405116, 0.9355504393694619, 0.7330631304859381, 0.8707601306551315, 0.7291701265889592, 0.8821257366537769, 0.04095247534309823, 0.557046605833562, 0.2622389511630402, 0.6288683743714585, 0.02357245006214095, 0.01713741578412558, 0.6313826523714624],
-  [0.2743023322221135, 0.5648645480971858, 0.5610960776914764, 0.4621444588317666, 0.1819965032117472, 0.01517197054895779, 0.001285397066934852, 0.237770173435577, 0.8760503299639748, 0.6966768513330499, 0.7712865741432136, 0.2055692959279675, 0.467588869184186, 0.5282957092313009, 0.453437004105985, 0.847639070476195, 0.9095387221217649, 0.9130173283763429, 0.9611371520818773, 0.9461719883146444, 0.873047603689393, 0.9241758773756539, 0.3848527557848621, 0.7496554398915677, 0.7259919964828598, 0.1973397259414319, 0.2447900856732285, 0.4250247107226652, 0.03429018564702653, 0.3539948086571276, 0.1450851756870583, 0.8331853667881707, 0.9314221729539086, 0.1155834134320015, 0.8724048672977598, 1.658149540309682e-05, 0.5857807252539552, 0.5769264752570858, 0.583342930893849, 0.0215334743838001, 0.1647435430160246, 0.4969703115959077, 0.9319523213673911, 0.1120232565307321, 0.7396778054077812, 0.03846059219499338, 0.124741136519381, 0.6918274167480769, 0.3154849659265925, 0.1590682430392637, 0.001836229882631717, 0.0002034017393107424, 0.7579012000277034, 0.01735892166466877, 0.08798304057869616, 0.01146612791194987, 0.008601665367279597, 0.3004065992434943, 0.4151827426052813, 0.1799608029504698, 0.06543181733505059, 0.1714883912428835, 0.6619495195203547, 0.161756213558491, 0.5444269499484111, 0.9783629791905525, 0.6209074641176577, 0.9206735094819766, 0.7041969237894216, 0.8774942699878289, 0.7666042372884002, 0.1529761317593632, 0.2789425737851874, 0.9467419798292375, 0.03638938423500817, 0.678116525125977, 0.005910684102002454, 0.4185581088481673, 0.002443996905814817, 0.902535873911968, 0.8191375545438203, 0.5401040388229511, 0.8353864808422348, 0.8813445820703684, 0.00350938678529145, 0.0992516191193913, 0.1347359809015424, 0.6818172006149786, 0.02044736325813198, 0.7256410623816163, 0.9372121455357204, 0.03088878301519983, 0.07601676939007423, 0.0559749856872087, 0.7198493258127491, 0.03183264044654346, 0.4833204800795115, 0.3221546205405407, 0.9362770435568251, 0.2589952528575054, 0.6466319253669296, 0.1370169244963471, 0.8647809495623066, 0.5375451664705625, 0.8755213924953222, 0.1303446736387168, 0.9379231352051123, 0.9587627304498215, 0.1207709523391801, 0.5386965662114014, 0.04497147293590154, 0.8762357274135854, 0.06921574659346287, 0.8724048672977598, 0.09671624002291995, 0.6739368423457478, 0.3914371458076842, 0.8833557721469369, 0.1179588715226985, 0.7846926977092684, 0.9333956547485719, 0.7256697026859646, 0.6315381343526444, 0.2751879457887698, 0.7581240564366307, 0.4079042867350654, 0.08091801951934784, 0.9198388540255344, 0.4161840803525, 0.4730238129204362, 0.225316614523093, 0.2518726579149618, 0.6700195787372318, 0.6778609099844141, 0.9385484325504536, 0.1751675532775389, 0.3746416429219113, 0.7896088460404121, 0.0574475487335897, 0.00706418528017537, 0.002698835991446662, 0.1942393779079875, 0.02848879063995053, 0.008028003301764043, 0.4539460272089236, 0.2607483569893428, 0.03453846141958155, 0.842711940541689, 0.5111295576759028, 0.8746499560497694, 0.01865198977450388, 0.6545255752387773, 0.7032007243820316, 0.2350520278588946, 0.1553898765268458, 0.8770020555354116, 0.4259201253847322, 0.1583072295940648, 0.004509379685615725, 0.03730764989652958, 0.03036924658056715, 0.6154442548257876, 0.8640685103645906, 0.6333037498350568, 0.04933287455002722, 0.2563285804215318, 0.08132358198234572, 0.9505007239266517, 0.007989028846656622, 0.9451119766086844, 0.4737570872827806, 0.0624233884749149, 0.4853828661457041, 0.6513578185861575, 0.3297174192967562, 0.02787756041241257, 0.2618158305562596, 0.1261438040827525, 0.2686373189356275, 0.02030654222548294, 0.9590203770469019, 0.4424908221974789, 0.7371035763826296, 0.3662894256913484, 0.9764227961257468, 0.9828620417082331, 0.3588696325875525],
-  [0.06200632669148827, 0.0188493055637058, 0.01813695748868956, 0.01115978551284925, 0.02847069659315495, 0.05756900888307675, 0.3834200499135511, 0.004378235849941886, 5.488241461678214e-05, 0.001519440113735824, 0.0004270180098079827, 0.0006975146778590436, 0.0003877267349584992, 0.001017094126826182, 0.002622469813028469, 0.0005727485588164091, 2.965359576402203e-05, 0.0001320143848021717, 5.16957582842479e-06, 7.585408856458547e-05, 0.0001298530260371754, 4.744031164439256e-05, 0.00987214343089759, 0.0001285048712720931, 0.0003371913710453744, 0.03196141851427783, 0.006368825703196368, 0.002590910200993363, 0.07072716839645006, 0.007544515010945032, 0.0309855434331694, 0.0003709214817558358, 0.0001019610338498684, 0.002004395463666237, 0.0004184653812758382, 0.8851812786610365, 0.002506990742287029, 0.01657424726276721, 0.01576824346561369, 0.1138241621192431, 0.0161872739985793, 0.002987479697464419, 7.160872977626964e-05, 0.02919019581775702, 0.0009264740127991631, 0.03769021693785515, 0.024046878866264, 0.001796327131912845, 0.01758133029841935, 0.01076707481694939, 0.3613105077289244, 0.7092460536089605, 0.0001633058709305536, 0.1698154868834648, 0.04258441289954325, 0.1398579979975882, 0.2646673762293301, 0.008483503594501085, 0.001764944527967773, 0.03330906737430261, 0.05410190158268501, 0.0188667178854535, 0.0003751550627614564, 0.00987306098175521, 0.00468846698555898, 3.861492637121265e-06, 0.001471314578337083, 1.633538646184149e-05, 0.0007722187516018551, 0.0002213215697517784, 0.001082903941059475, 0.01809631695151915, 0.08987888201726048, 4.402507081878654e-06, 0.09738546724651619, 0.0006532965622299613, 0.1330715709944246, 0.00529596617017732, 0.2632389367995536, 5.197235823149346e-05, 7.751247683417043e-05, 0.002903240558508806, 0.0002807517943139329, 0.0001269736146131525, 0.2640875467256069, 0.0535107639897493, 0.04181323655515343, 0.0008177353217027728, 0.05025852999725455, 0.0007879825059076829, 2.460944420999514e-05, 0.08274885670680922, 0.07503733678526217, 0.03092642882284448, 0.0003512167650406857, 0.06057441777445976, 0.001665765814104195, 0.005465275727166909, 4.629690043346711e-05, 0.008934281059627363, 0.0005983294145967669, 0.01679164033583811, 9.786934418001151e-05, 0.001121984269130162, 0.0002022651699647995, 0.02214430042526674, 8.205498583727208e-06, 7.299138280612693e-06, 0.01197601145441014, 0.003138964695807494, 0.1134540398587359, 0.0001266333038430186, 0.01047146942299623, 0.0004184653812758382, 0.03372691606650723, 0.001790504022085792, 0.002091273068725143, 0.0001123441719750002, 0.009836482665056569, 0.0003260947156132632, 9.14872308955314e-06, 7.146262178219897e-05, 0.003134541032952301, 0.003243151068622122, 0.0004938814940087337, 0.003992241487741484, 0.05047765180527879, 5.48192537202422e-05, 0.007657881812867755, 0.003431376428035763, 0.007864720463294618, 0.01707446423407925, 0.0005133040719471362, 0.001302317045485735, 9.421103812965013e-06, 0.01854050630879726, 0.003352226876518583, 0.001321203489788831, 0.02396352042445499, 0.2161880206178467, 0.4616143052068635, 0.002619865029037861, 0.06721741272481974, 0.2526719537611555, 0.005971657734537447, 0.003541702916349505, 0.01307575723872694, 0.000836435869403401, 0.0005948867949737228, 0.000135446810055918, 0.0572682693731649, 0.001469880672495321, 0.0005680731700038486, 0.007581290205357887, 0.01925262761502234, 2.879898484263142e-05, 0.005683848502896345, 0.01036545509665985, 0.1485233324517072, 0.01399708767882932, 0.05239583873835423, 0.001396572918925218, 0.0002136299377520914, 0.003222760970790264, 0.04246078312386508, 0.01263009545520527, 0.03351320884998494, 4.455216555274879e-05, 0.220848822121721, 6.302640032649731e-06, 0.003410564480463807, 0.02026134807790796, 0.002205718131256128, 0.002386023101254252, 0.007195518762732099, 0.03657200021812555, 0.005121038957802429, 0.003096065262115961, 0.002192554475413347, 0.09756772112074018, 2.714760999993297e-05, 0.0004625719689592339, 0.0006574724543301372, 0.004842199937193064, 4.753812112263883e-06, 5.425076412366099e-07, 0.009747715040984947] 
-  ],
  "analysis":0,
  "branch attributes":{
    "0":{
      "BABOON":{
-       "General descriptive":0.001859562666773025,
+       "General descriptive":0.001858528201768933,
        "MG94xREV with separate rates for branch sets":0.001729040005725717,
        "Nucleotide GTR":0.001685167654714891,
-       "RELAX alternative":0.001434762988174167,
-       "RELAX null":0.001618077326700096,
-       "RELAX partitioned descriptive":0.001426437398554912,
-       "k (general descriptive)":0.09975760133237818,
+       "RELAX alternative":0.001823573976182991,
+       "RELAX null":0.001855504238020734,
+       "RELAX partitioned descriptive":0.001856473113608415,
+       "k (general descriptive)":0.09974837182960776,
        "original name":"BABOON"
       },
      "CAT":{
-       "General descriptive":0.3649705108927348,
+       "General descriptive":0.3649687317465272,
        "MG94xREV with separate rates for branch sets":0.2761191158060541,
        "Nucleotide GTR":0.2660536011315811,
-       "RELAX alternative":0.3757111787573828,
-       "RELAX null":0.360767755751942,
-       "RELAX partitioned descriptive":0.3768226672635935,
-       "k (general descriptive)":2.322824217601444,
+       "RELAX alternative":0.3317928646169214,
+       "RELAX null":0.3252639231399129,
+       "RELAX partitioned descriptive":0.3330192884009499,
+       "k (general descriptive)":2.321295373553348,
        "original name":"CAT"
       },
      "CHIMP":{
-       "General descriptive":0.001848544328521468,
+       "General descriptive":0.00184909269599246,
        "MG94xREV with separate rates for branch sets":0.001822551054713939,
        "Nucleotide GTR":0.001820258053351119,
-       "RELAX alternative":0.001854643673065862,
-       "RELAX null":0.00185572990722179,
-       "RELAX partitioned descriptive":0.001854201499317722,
-       "k (general descriptive)":5.263917013225917,
+       "RELAX alternative":0.00182628703877269,
+       "RELAX null":0.001834608540291232,
+       "RELAX partitioned descriptive":0.001827445389436029,
+       "k (general descriptive)":5.301733626197528,
        "original name":"CHIMP"
       },
      "COW":{
-       "General descriptive":0.3734992963367884,
+       "General descriptive":0.3735020294731436,
        "MG94xREV with separate rates for branch sets":0.248802707042435,
        "Nucleotide GTR":0.2480198736772598,
-       "RELAX alternative":0.3379561449590825,
-       "RELAX null":0.3268684624461423,
-       "RELAX partitioned descriptive":0.336296078659758,
-       "k (general descriptive)":2.847745204182733,
+       "RELAX alternative":0.3080684096213485,
+       "RELAX null":0.2951198100127046,
+       "RELAX partitioned descriptive":0.3113651933641743,
+       "k (general descriptive)":2.848124116654745,
        "original name":"COW"
       },
      "HORSE":{
-       "General descriptive":0.2805104186424681,
+       "General descriptive":0.2803565521817367,
        "MG94xREV with separate rates for branch sets":0.2114983058912022,
        "Nucleotide GTR":0.2090998951755368,
-       "RELAX alternative":0.2639982922145814,
-       "RELAX null":0.2570519477156736,
-       "RELAX partitioned descriptive":0.26200095593742,
-       "k (general descriptive)":1.930891329212253,
+       "RELAX alternative":0.2669775401023034,
+       "RELAX null":0.2560153217844985,
+       "RELAX partitioned descriptive":0.2711533659241344,
+       "k (general descriptive)":1.929084551844662,
        "original name":"HORSE"
       },
      "HUMAN":{
@@ -64,101 +59,101 @@
        "RELAX alternative":0,
        "RELAX null":0,
        "RELAX partitioned descriptive":0,
-       "k (general descriptive)":1.416548546052124,
+       "k (general descriptive)":1.417418953564817,
        "original name":"HUMAN"
       },
      "MOUSE":{
-       "General descriptive":0.1308803878257961,
+       "General descriptive":0.1308909653091745,
        "MG94xREV with separate rates for branch sets":0.1192893635530923,
        "Nucleotide GTR":0.1181058300538561,
-       "RELAX alternative":0.1516183081271659,
-       "RELAX null":0.1483567973872321,
-       "RELAX partitioned descriptive":0.1488950288407203,
-       "k (general descriptive)":0.4621316779775653,
+       "RELAX alternative":0.15085996133762,
+       "RELAX null":0.1469017908982058,
+       "RELAX partitioned descriptive":0.1491287772297175,
+       "k (general descriptive)":0.4628338932722805,
        "original name":"MOUSE"
       },
      "Node1":{
-       "General descriptive":0.3501143091462658,
+       "General descriptive":0.3501950875747647,
        "MG94xREV with separate rates for branch sets":0.2891531817656844,
        "Nucleotide GTR":0.2767105173979571,
-       "RELAX alternative":0.420525835142383,
-       "RELAX null":0.4545405634998693,
-       "RELAX partitioned descriptive":0.4297776151561553,
-       "k (general descriptive)":0.4575702395890889
+       "RELAX alternative":0.3644026907015058,
+       "RELAX null":0.4527247199492397,
+       "RELAX partitioned descriptive":0.4226204412177209,
+       "k (general descriptive)":0.4559088158670693
       },
      "Node12":{
-       "General descriptive":0.01766178787800134,
+       "General descriptive":0.01767952779767795,
        "MG94xREV with separate rates for branch sets":0.0175770110347634,
        "Nucleotide GTR":0.01784222107494562,
-       "RELAX alternative":0.01626048141633729,
-       "RELAX null":0.01716868534229337,
-       "RELAX partitioned descriptive":0.01647240042293572,
-       "k (general descriptive)":0.124120594408151
+       "RELAX alternative":0.0176558660351027,
+       "RELAX null":0.01825591179366154,
+       "RELAX partitioned descriptive":0.01814639835827904,
+       "k (general descriptive)":0.1240838029653794
       },
      "Node2":{
-       "General descriptive":0.05770266360624338,
+       "General descriptive":0.05770620828101171,
        "MG94xREV with separate rates for branch sets":0.06229443926236622,
        "Nucleotide GTR":0.06614755778044307,
-       "RELAX alternative":0.06487498265124983,
-       "RELAX null":0.06743647945583151,
-       "RELAX partitioned descriptive":0.06330449773182804,
-       "k (general descriptive)":0.5360768532731082
+       "RELAX alternative":0.05866256113025137,
+       "RELAX null":0.06147496751530821,
+       "RELAX partitioned descriptive":0.05724188758009503,
+       "k (general descriptive)":0.5371848217199983
       },
      "Node3":{
-       "General descriptive":0.1330256319960288,
+       "General descriptive":0.1330354609631224,
        "MG94xREV with separate rates for branch sets":0.1003154990002797,
        "Nucleotide GTR":0.09883748387954429,
-       "RELAX alternative":0.1378173139909468,
-       "RELAX null":0.1387701954254672,
-       "RELAX partitioned descriptive":0.136719474302551,
-       "k (general descriptive)":1.981625732305646
+       "RELAX alternative":0.1265135269643693,
+       "RELAX null":0.1276253046950155,
+       "RELAX partitioned descriptive":0.1271876163104063,
+       "k (general descriptive)":1.981364628056296
       },
      "Node8":{
-       "General descriptive":0.1404338383825282,
+       "General descriptive":0.140369727816558,
        "MG94xREV with separate rates for branch sets":0.1127066220459272,
        "Nucleotide GTR":0.1062201244057951,
-       "RELAX alternative":0.1439313895033506,
-       "RELAX null":0.14318831284655,
-       "RELAX partitioned descriptive":0.1481785335086442,
-       "k (general descriptive)":2.211998835217187
+       "RELAX alternative":0.1280322211601967,
+       "RELAX null":0.1343412714385626,
+       "RELAX partitioned descriptive":0.1406663540457613,
+       "k (general descriptive)":2.211767324109487
       },
      "Node9":{
-       "General descriptive":0.02665501999328081,
+       "General descriptive":0.02663291940160552,
        "MG94xREV with separate rates for branch sets":0.02627402966233569,
        "Nucleotide GTR":0.02567813733543303,
-       "RELAX alternative":0.02985671529404269,
-       "RELAX null":0.02953553824738531,
-       "RELAX partitioned descriptive":0.02996950192160838,
-       "k (general descriptive)":0.07343805012797726
+       "RELAX alternative":0.02720907734174326,
+       "RELAX null":0.02752483699250281,
+       "RELAX partitioned descriptive":0.02810928828288993,
+       "k (general descriptive)":0.07329530197274074
       },
      "PIG":{
-       "General descriptive":0.2105401970679286,
+       "General descriptive":0.2104965149960229,
        "MG94xREV with separate rates for branch sets":0.1921302603267553,
        "Nucleotide GTR":0.1871390433004313,
-       "RELAX alternative":0.2517917117490165,
-       "RELAX null":0.2483169436500481,
-       "RELAX partitioned descriptive":0.2506475053874151,
-       "k (general descriptive)":1.582105640200874,
+       "RELAX alternative":0.2174541263946326,
+       "RELAX null":0.2166570805170097,
+       "RELAX partitioned descriptive":0.2198382730708073,
+       "k (general descriptive)":1.581624239713873,
        "original name":"PIG"
       },
      "RAT":{
-       "General descriptive":0.07158272879959397,
+       "General descriptive":0.07156643194841542,
        "MG94xREV with separate rates for branch sets":0.06831927364558048,
        "Nucleotide GTR":0.06661490534189227,
-       "RELAX alternative":0.07311180317129368,
-       "RELAX null":0.07112698282214641,
-       "RELAX partitioned descriptive":0.07451416024404128,
-       "k (general descriptive)":1.317928928374736,
+       "RELAX alternative":0.07273892007491474,
+       "RELAX null":0.07342001791171293,
+       "RELAX partitioned descriptive":0.07588524426470618,
+       "k (general descriptive)":1.318666444029934,
        "original name":"RAT"
       },
      "RHMONKEY":{
-       "General descriptive":0.003673715052669516,
+       "General descriptive":0.003670942377703963,
        "MG94xREV with separate rates for branch sets":0.003755247927570558,
        "Nucleotide GTR":0.003778804730491441,
-       "RELAX alternative":0.004176749981889291,
-       "RELAX null":0.00397871921631754,
-       "RELAX partitioned descriptive":0.004188079354984015,
-       "k (general descriptive)":5.301456309232226,
+       "RELAX alternative":0.003673289414323487,
+       "RELAX null":0.003666197747079884,
+       "RELAX partitioned descriptive":0.003661285250492945,
+       "k (general descriptive)":5.244027200799457,
        "original name":"RHMONKEY"
       }
     },
@@ -207,21 +202,21 @@
   },
  "fits":{
    "General descriptive":{
-     "AIC-c":6945.886057024934,
-     "Log Likelihood":-3420.484282637879,
+     "AIC-c":6945.887251511141,
+     "Log Likelihood":-3420.484879880983,
      "Rate Distributions":{
        "Shared":{
          "0":{
-           "omega":2.201373594751134e-18,
-           "proportion":0.5258178735075876
+           "omega":2.201644423775106e-18,
+           "proportion":0.1667516969215508
           },
          "1":{
-           "omega":2.201373594751134e-18,
-           "proportion":0.01992025780064184
+           "omega":2.201644423775106e-18,
+           "proportion":0.3790423141178453
           },
          "2":{
-           "omega":2.201373412388544,
-           "proportion":0.4542618686917706
+           "omega":2.201644241390081,
+           "proportion":0.4542059889606039
           }
         }
       },
@@ -326,144 +321,116 @@
      "estimated parameters":24
     },
    "RELAX alternative":{
-     "AIC-c":6909.668413948684,
-     "Log Likelihood":-3408.69933855329,
+     "AIC-c":6938.419285358699,
+     "Log Likelihood":-3432.482965101608,
      "Rate Distributions":{
        "Reference":{
          "0":{
            "omega":0,
-           "proportion":0.3825895192221547
+           "proportion":0.2968543549269862
           },
          "1":{
-           "omega":0.003503464580598538,
-           "proportion":0
+           "omega":0,
+           "proportion":0.2447083724876047
           },
          "2":{
-           "omega":2.417572962231385,
-           "proportion":0.6174104807778453
-          }
-        },
-       "Synonymous site-to-site rates":{
-         "0":{
-           "proportion":0.2789425737851868,
-           "rate":0.2834765074731829
-          },
-         "1":{
-           "proportion":0.6311785441975573,
-           "rate":0.9970973177052372
-          },
-         "2":{
-           "proportion":0.089878882017256,
-           "rate":3.244142488658602
+           "omega":3.910413867333085,
+           "proportion":0.4584372725854091
           }
         },
        "Test":{
          "0":{
            "omega":0,
-           "proportion":0.3825895192221547
+           "proportion":0.2968543549269862
           },
          "1":{
-           "omega":0.9998114377116485,
-           "proportion":0
+           "omega":0,
+           "proportion":0.2447083724876047
           },
          "2":{
-           "omega":1.000029443594731,
-           "proportion":0.6174104807778453
+           "omega":1.655264242043239,
+           "proportion":0.4584372725854091
           }
         }
       },
      "display order":2,
-     "estimated parameters":45
+     "estimated parameters":36
     },
    "RELAX null":{
-     "AIC-c":6919.152853316747,
-     "Log Likelihood":-3414.491495151524,
+     "AIC-c":6946.046147526199,
+     "Log Likelihood":-3437.336050862336,
      "Rate Distributions":{
        "Reference":{
          "0":{
-           "omega":0,
-           "proportion":0.3885051761591228
+           "omega":0.07516343499603452,
+           "proportion":0.2524283429126023
           },
          "1":{
-           "omega":0.9958737025997172,
-           "proportion":0
+           "omega":0.1730729265669467,
+           "proportion":0.3734402861071174
           },
          "2":{
-           "omega":1.887643080900262,
-           "proportion":0.6114948238408772
-          }
-        },
-       "Synonymous site-to-site rates":{
-         "0":{
-           "proportion":0.2642938080646302,
-           "rate":0.2741590488311177
-          },
-         "1":{
-           "proportion":0.633162055223991,
-           "rate":0.9728788992663913
-          },
-         "2":{
-           "proportion":0.1025441367113787,
-           "rate":3.038218152856258
+           "omega":3.70326279512502,
+           "proportion":0.3741313709802804
           }
         },
        "Test":{
          "0":{
-           "omega":0,
-           "proportion":0.3885051761591228
+           "omega":0.07516343499603452,
+           "proportion":0.2524283429126023
           },
          "1":{
-           "omega":0.9958737025997172,
-           "proportion":0
+           "omega":0.1730729265669467,
+           "proportion":0.3734402861071174
           },
          "2":{
-           "omega":1.887643080900262,
-           "proportion":0.6114948238408772
+           "omega":3.70326279512502,
+           "proportion":0.3741313709802804
           }
         }
       },
      "display order":3,
-     "estimated parameters":44
+     "estimated parameters":35
     },
    "RELAX partitioned descriptive":{
-     "AIC-c":6917.810941882631,
-     "Log Likelihood":-3408.559317095162,
+     "AIC-c":6944.507313452719,
+     "Log Likelihood":-3431.356991882183,
      "Rate Distributions":{
        "Reference":{
          "0":{
-           "omega":0.03550460650841439,
-           "proportion":0.354985198548996
+           "omega":0,
+           "proportion":0.3694476627871225
           },
          "1":{
-           "omega":0.05439939847728128,
-           "proportion":0.02231130867735708
+           "omega":0.03660893085044142,
+           "proportion":0.1726741298596992
           },
          "2":{
-           "omega":2.333762420535514,
-           "proportion":0.6227034927736469
+           "omega":3.988980749944551,
+           "proportion":0.4578782073531784
           }
         },
        "Test":{
          "0":{
-           "omega":0,
-           "proportion":0.3705590531463396
+           "omega":0.224878249826745,
+           "proportion":0.2953732524277409
           },
          "1":{
-           "omega":0,
-           "proportion":0.06265340406614885
+           "omega":0.231175241198686,
+           "proportion":0.5325206774143161
           },
          "2":{
-           "omega":1.08372848194659,
-           "proportion":0.5667875427875115
+           "omega":4.178788461910403,
+           "proportion":0.172106070157943
           }
         }
       },
      "display order":5,
-     "estimated parameters":49
+     "estimated parameters":40
     }
   },
  "input":{
-   "file name":"/tmp/tmpkgsdjj1d/job_working_directory/000/5/working/./input.nex",
+   "file name":"/tmp/tmps1cqwvdh/job_working_directory/000/5/working/./input.nex",
    "number of sequences":10,
    "number of sites":187,
    "partition count":1,
@@ -471,11 +438,11 @@
      "0":"((((PIG:0.147969,COW:0.21343)Node3:0.08509899999999999,HORSE:0.165787,CAT:0.264806)Node2:0.058611,((RHMONKEY:0.002015,BABOON:0.003108)Node9:0.022733,(HUMAN:0.004349,CHIMP:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,RAT:0.050958,MOUSE:0.09795)"
     }
   },
- "runtime":"2.5.32",
+ "runtime":"2.5.36",
  "test results":{
-   "LRT":11.58431319646934,
-   "p-value":0.0006651049394417186,
-   "relaxation or intensification parameter":3.335337302186161e-05
+   "LRT":9.706171521456781,
+   "p-value":0.001836502097725456,
+   "relaxation or intensification parameter":0.3695692925647034
   },
  "tested":{
    "0":{
@@ -500,27 +467,27 @@
  "timers":{
    "General descriptive model fitting":{
      "order":2,
-     "timer":105
+     "timer":159
     },
    "Overall":{
      "order":0,
-     "timer":3013
+     "timer":428
     },
    "Preliminary model fitting":{
      "order":1,
-     "timer":8
+     "timer":13
     },
    "RELAX alternative model fitting":{
      "order":3,
-     "timer":1229
+     "timer":61
     },
    "RELAX null model fitting":{
      "order":4,
-     "timer":690
+     "timer":53
     },
    "RELAX partitioned descriptive":{
      "order":5,
-     "timer":980
+     "timer":141
     }
   }
 }
\ No newline at end of file