changeset 33:212c958f6cee draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hyphy/ commit 4bb2092ac089e709bdc0ec3c3680f47e17be509a"
author iuc
date Wed, 30 Mar 2022 00:15:54 +0000
parents 3f59ebfbfe3d
children
files hyphy_absrel.xml macros.xml test-data/absrel-out2.json test-data/relax-out1.json test-data/relax-out2-1.json test-data/relax-out2-2.json
diffstat 6 files changed, 918 insertions(+), 3789 deletions(-) [+]
line wrap: on
line diff
--- a/hyphy_absrel.xml	Sat Nov 27 11:25:19 2021 +0000
+++ b/hyphy_absrel.xml	Wed Mar 30 00:15:54 2022 +0000
@@ -1,10 +1,10 @@
 <?xml version="1.0"?>
 <tool id="hyphy_absrel" name="HyPhy-aBSREL" version="@TOOL_VERSION@+galaxy2" profile="19.09">
     <description>adaptive Branch Site Random Effects Likelihood</description>
-    <expand macro="bio_tools"/>
     <macros>
         <import>macros.xml</import>
     </macros>
+    <expand macro="bio_tools"/>
     <expand macro="requirements"/>
     <command detect_errors="exit_code"><![CDATA[
         @SYMLINK_FILES@
@@ -16,6 +16,7 @@
             @branch_options@
             --output '$absrel_output'
             --multiple-hits $multiple_hits
+            $srv
         @ERRORS@
         ]]></command>
     <inputs>
@@ -26,6 +27,7 @@
             <option value="Double">Include branch-specific rates for double nucleotide substitutions</option>
             <option value="Double+Triple">Include branch-specific rates for double and triple nucleotide substitutions</option>
         </param>
+        <param argument="--srv" type="boolean" truevalue="--srv Yes" falsevalue="" label="Include synonymous rate variation" />
         <expand macro="branches"/>
     </inputs>
     <outputs>
@@ -44,6 +46,13 @@
             <param name="multiple_hits" value="Double" />
             <output name="absrel_output" file="absrel-out1.json" compare="sim_size"/>
         </test>
+        <test>
+            <param name="input_file" ftype="fasta" value="absrel-in1.fa"/>
+            <param name="input_nhx" ftype="nhx" value="absrel-in1.nhx"/>
+            <param name="multiple_hits" value="Double" />
+            <param name="srv" value="--srv Yes" />
+            <output name="absrel_output" file="absrel-out2.json" compare="sim_size"/>
+        </test>
     </tests>
     <help><![CDATA[
 
--- a/macros.xml	Sat Nov 27 11:25:19 2021 +0000
+++ b/macros.xml	Wed Mar 30 00:15:54 2022 +0000
@@ -1,5 +1,6 @@
 <?xml version="1.0"?>
 <macros>
+    <token name="@TOOL_VERSION@">2.5.36</token>
     <xml name="inputs">
 	    <param name="input_file" type="data" format="fasta,fasta.gz,nex" label="Input FASTA or NEXUS file" help="If the input file type is NEXUS and it includes a valid newick tree, that tree will override an uploaded newick tree" />
         <param name="input_nhx" type="data" format="nhx,newick" optional="true" label="Input newick file"/>
@@ -144,7 +145,6 @@
             <yield/>
         </citations>
     </xml>
-    <token name="@TOOL_VERSION@">2.5.31</token>
     <xml name="requirements">
         <requirements>
             <requirement type="package" version="@TOOL_VERSION@">hyphy</requirement>
@@ -156,6 +156,16 @@
             <filter>advanced['save_alternative_model']</filter>
         </data>
     </xml>
+    <xml name="resample">
+        <param argument="--resample" type="integer" value="0" min="0" optional="true" label="Perform parametric bootstrap resampling to derive site-level null LRT distributions" help="Warning: This will result in a significantly slower analysis. This parameter specifies the maximum number of replicates per site." />
+    </xml>
+    <token name="@resample@"><![CDATA[
+            #if $resample:
+                --resample $resample
+            #end if
+        ]]>
+    </token>
+
     <token name="@INPUT_TREE@"><![CDATA[
             #if $input_nhx:
                 --tree input.nhx
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/absrel-out2.json	Wed Mar 30 00:15:54 2022 +0000
@@ -0,0 +1,535 @@
+{
+ "Synonymous site-posteriors":  [
+[0.2237313836650769, 0.07034985497742986, 0.07145045464678079, 0.162904629542773, 0.08696014489632299, 0.4973049561752621, 0.9385366945295869, 0.07695133428552869, 0.001997373788362212, 0.000990883865044414, 1.597366276160643e-05, 0.001639173387605954, 0.0006726936008082838, 0.0005936260958686961, 0.01218331055979857, 6.818341915747173e-05, 3.10538784980663e-05, 0.0003850280284965983, 1.706749658825067e-05, 1.954717668341298e-05, 5.757139486184149e-05, 5.547696233589325e-07, 0.1027014607202221, 0.0005061229953062066, 0.0002713590976491243, 0.01071054750911007, 0.01058998805403938, 0.001824707456373813, 0.1040310240977791, 0.007394679956619656, 0.01548570716335477, 0.0008559908124777675, 0.0001902341284497764, 0.04379131907975038, 0.0001602246750758031, 0.872186620749095, 0.007390732327759301, 0.06674897008912457, 0.06972624550033353, 0.09402374412106476, 0.1105108657459435, 0.01328650075574577, 0.0004656132149530012, 0.02510551997724948, 2.726156324850206e-05, 0.218781542689419, 0.006387422790697847, 0.007440221639665756, 0.05243297879242407, 0.1290026685674839, 0.6362466982390221, 0.8443663408237136, 0.0008463748207276134, 0.07321341035497612, 0.7855063534903601, 0.3150726276771443, 0.8508489144151971, 0.02756928287263707, 0.01299322935453241, 0.01615676639466097, 0.1381872019916541, 0.06580359020038734, 0.007948607169236543, 0.03623393203353259, 0.001127119071510586, 2.510588082439908e-07, 0.001198735279712407, 1.499028692444743e-05, 0.0007376828878749214, 0.0001439329508670455, 0.0003622577009774282, 0.02916632660997443, 0.09212248703639002, 7.45231360132705e-06, 0.2140082858090768, 0.009508570249567472, 0.5162459275326868, 0.001293919095115566, 0.8726414064830788, 0.0001302201041918639, 0.003094500709258363, 0.002116963683292442, 0.001652532423559578, 2.885330472177516e-05, 0.8679630109050446, 0.06064786452319544, 0.01926710656265205, 0.003438784053820811, 0.04592043108186669, 0.009356125116963642, 1.39030344053496e-06, 0.1492915058063837, 0.07707061704057379, 0.07475315743864808, 0.000302419021163877, 0.144336435993247, 0.003223470679335452, 0.03037745915910377, 0.0003011350589031628, 0.006808005110601785, 0.0008232735328502056, 0.03833979319278999, 9.698364220287434e-05, 0.004939487216502053, 6.693653877999158e-05, 0.02813691694081084, 9.485847293237623e-06, 9.213850857247055e-06, 0.0653963700817919, 3.36098340810195e-05, 0.3256932672291724, 4.035388925446032e-05, 0.04374256630355731, 0.0001602246750758031, 0.4014805201846622, 7.992404162601145e-05, 0.01019186788933821, 5.157202070064211e-05, 0.01632615592433439, 2.711206299164022e-05, 1.39112911627399e-05, 0.0001144909315662084, 0.0001470176943661007, 0.008065109594132992, 0.0001053551543690356, 0.09762185907634006, 0.2690693395574275, 2.306365194486018e-06, 0.001629982970373876, 0.0005166683932434172, 0.008811904607316576, 0.004707366984528872, 0.0005329112697905272, 0.004709232000043501, 5.309771784866412e-06, 0.02081799460860159, 0.01482206699240225, 0.02247987076174615, 0.03334725806979871, 0.5823700494422802, 0.6236724985801352, 0.0185646271114748, 0.1682321476102055, 0.5117950109841621, 0.02454309603098215, 0.01143016187387928, 0.03611174379314762, 0.001160042508580727, 0.008675955890656782, 0.0006207030249667641, 0.3189329652004703, 0.009022200481586255, 0.00453169826721376, 0.01175652549884987, 0.03798598471232684, 3.415462094795308e-05, 0.02071616557444895, 0.01314271860208286, 0.2919550074913849, 0.01463675769845591, 0.3808264251791824, 0.0005743039294857045, 0.0001968101730522108, 8.98952537201286e-05, 0.07242504371764499, 0.0003645543853153564, 0.3778182412645538, 6.623577458551056e-06, 0.423433584889663, 6.299717466720515e-06, 0.0002383566395190999, 0.05603244198717539, 0.001549983450584894, 0.002286903228642564, 0.05910553215170956, 0.1696354264894034, 0.008408717444453151, 0.1784153043909985, 0.005750339228228735, 0.1911339411346325, 2.211643409474936e-06, 0.0005399645955134869, 0.0003799502425700674, 0.004668756602094451, 2.190685351762358e-07, 5.683025969646086e-07, 0.01323453573875461],
+  [0.6320870943734679, 0.5484712730611401, 0.5492257737792517, 0.7952445720795884, 0.8651083577332821, 0.5012607949278384, 0.06144835316060489, 0.8953478489268649, 0.623511170207127, 0.3670783290548096, 0.143715002584682, 0.7928204662593729, 0.4832974011618938, 0.5108274907294891, 0.8496550739855554, 0.1893133517110343, 0.1160904368949082, 0.3041937538859427, 0.09444324951555778, 0.09278630856972603, 0.147799788069098, 0.0426634152212833, 0.8785420602235626, 0.4026216782174114, 0.3120378375465396, 0.6543826771662207, 0.8699751769230144, 0.5405380877449835, 0.8693138487984133, 0.686482305253213, 0.7995530565164707, 0.392507997890833, 0.2231942180522403, 0.9333257970032062, 0.1612696179503383, 0.1277791995684988, 0.7777433918064461, 0.5463572711587603, 0.5480962010042225, 0.8902638199188652, 0.8669735693752803, 0.7974305061187666, 0.2449833880092592, 0.9026667690426456, 0.1731651572496988, 0.7766066974692208, 0.8144687030467177, 0.6829640865396805, 0.8729487308364554, 0.8537005360465642, 0.3627933728109908, 0.1555038175261705, 0.6583450331245952, 0.8788374394531219, 0.2142062666186621, 0.6801217034144075, 0.148980651912056, 0.8325752695995462, 0.9024635868351975, 0.7859709097834526, 0.8440126658980578, 0.9055485087777924, 0.7266604429496804, 0.9142663134448874, 0.4138236193712395, 0.01681188022163363, 0.63100018260094, 0.1055161286723332, 0.383439352662872, 0.1982222543750108, 0.2122380372744654, 0.9088833716402204, 0.5579704535685104, 0.07824287873247676, 0.7765279882064482, 0.7682749018879583, 0.4824398541301007, 0.5656352949297849, 0.1273184754304406, 0.3460012685362001, 0.7456605486078066, 0.5233273460187057, 0.4574834694119095, 0.1096418113243125, 0.1319979986864812, 0.9152866949614997, 0.8292917896413513, 0.7234146246969066, 0.9186033593958274, 0.7743249492775025, 0.04770954600992579, 0.8340198218291699, 0.8800999147500712, 0.9021103340009859, 0.3266964459030328, 0.8387973035647739, 0.6458004434313497, 0.8995157766345938, 0.3164866933478583, 0.7779428013707937, 0.4139291394074732, 0.9153718986576534, 0.166535167606684, 0.8044666187136424, 0.1325915468633664, 0.8978671136076242, 0.07979180288034458, 0.06046114687905377, 0.9011813959740612, 0.2949241689393901, 0.6637437560093771, 0.120407670240963, 0.918270154770137, 0.1612696179503383, 0.5953658535509754, 0.2602728295882192, 0.8702215267891145, 0.1267412652275653, 0.9014532903300455, 0.1525180785015703, 0.08833001653827227, 0.2848167216177988, 0.291155693583513, 0.8113681846357962, 0.2481831128877511, 0.8724664599391461, 0.7202683204806987, 0.05345993729671442, 0.5885975575268036, 0.4071786982046535, 0.9237010870137025, 0.6789996143902787, 0.3971013733694621, 0.6667869392290988, 0.07200982497834454, 0.835758859195466, 0.7643535130458815, 0.8644922226864726, 0.9257535746390509, 0.4162981896072208, 0.3748449940749795, 0.9201241749978445, 0.8204110478144335, 0.4862321306527319, 0.8939053225933403, 0.9413039841031908, 0.9238276408307763, 0.3811901386042497, 0.8413935258971738, 0.3846554177087071, 0.6786566853222139, 0.7659643097311739, 0.6629073556777441, 0.7719799010732383, 0.8456463280149575, 0.1642572024254464, 0.8548564514878499, 0.8291552737793674, 0.7053785201185664, 0.932408896468953, 0.6175601494775651, 0.4370814543380974, 0.1790429662743835, 0.256801155005565, 0.8996095443144376, 0.5810041299939207, 0.6191792524328547, 0.04387294749997344, 0.5744116794134839, 0.07008831029467927, 0.3754614887720323, 0.8919015678285099, 0.5872033478817522, 0.720505147827899, 0.9169498862392255, 0.818556681647986, 0.8238276917578375, 0.8149370690440446, 0.8715230063041174, 0.8015022176076705, 0.03940049883343797, 0.6138952750391458, 0.313875602812957, 0.6646831198439501, 0.01708980265774814, 0.02377222152471277, 0.8539739651764133],
+  [0.1441815219614553, 0.3811788719614302, 0.3793237715739675, 0.04185079837763855, 0.04793149737039484, 0.001434248896899514, 1.49523098082053e-05, 0.0277008167876063, 0.3744914560045107, 0.6319307870801458, 0.8562690237525564, 0.2055403603530213, 0.5160299052372981, 0.4885788831746422, 0.1381616154546461, 0.8106184648698082, 0.8838785092265937, 0.6954212180855606, 0.9055396829878539, 0.9071941442535907, 0.8521426405360402, 0.9573360300090934, 0.01875647905621522, 0.5968721987872823, 0.6876908033558112, 0.3349067753246693, 0.1194348350229463, 0.4576372047986426, 0.02665512710380765, 0.3061230147901675, 0.1849612363201747, 0.6066360112966892, 0.7766155478193099, 0.02288288391704356, 0.8385701573745858, 3.417968240597176e-05, 0.2148658758657946, 0.3868937587521149, 0.3821775534954441, 0.01571243596007, 0.02251556487877614, 0.1892829931254875, 0.7545509987757878, 0.07222771098010485, 0.8268075811870527, 0.004611759841360215, 0.1791438741625844, 0.3095956918206536, 0.07461829037112036, 0.01729679538595195, 0.0009599289499872507, 0.0001298416501157798, 0.340808592054677, 0.04794915019190218, 0.0002873798909779559, 0.004805668908448148, 0.0001704336727469521, 0.1398554475278166, 0.08454318381027025, 0.1978723238218864, 0.01780013211028798, 0.02864790102182029, 0.2653909498810832, 0.04949975452158001, 0.58504926155725, 0.9831878687195582, 0.3678010821193476, 0.8944688810407423, 0.6158229644492531, 0.8016338126741221, 0.7873997050245573, 0.06195030174980526, 0.3499070593950995, 0.921749668953922, 0.009463725984474914, 0.2222165278624742, 0.001314218337212393, 0.4330707859750995, 4.011808648077104e-05, 0.6538685113596081, 0.2512449506829349, 0.4745556902980019, 0.5408639981645308, 0.8903293353709656, 3.899040847425775e-05, 0.0240654405153047, 0.1514411037959966, 0.2731465912492725, 0.03547620952230578, 0.2163189256055338, 0.9522890636866338, 0.01668867236444656, 0.04282946820935509, 0.02313650856036603, 0.6730011350758033, 0.01686626044197891, 0.3509760858893148, 0.07010676420630228, 0.6832121715932385, 0.2152491935186044, 0.5852475870596766, 0.04628830814955653, 0.833367848751113, 0.1905938940698556, 0.8673415165978536, 0.07399596945156511, 0.9201987112723621, 0.9395296392700889, 0.03342223394414681, 0.7050422212265288, 0.01056297676145055, 0.8795519758697826, 0.03798727892630575, 0.8385701573745858, 0.003153626264362388, 0.7396472463701548, 0.1195866053215473, 0.873207162751734, 0.08222055374562, 0.8474548094354379, 0.911656072170565, 0.715068787450635, 0.7086972887221209, 0.1805667057700708, 0.7517115319578799, 0.02991168098451388, 0.01066233996187374, 0.9465377563380911, 0.4097724595028225, 0.5923046334021032, 0.06748700837898086, 0.3162930186251925, 0.6023657153607472, 0.3285038287708577, 0.9279848652498707, 0.1434231461959324, 0.2208244199617161, 0.1130279065517811, 0.04089916729115029, 0.001331760950498852, 0.001482507344885308, 0.06131119789068074, 0.01135680457536089, 0.001972858363106022, 0.08155158137567768, 0.04726585402292987, 0.04006061537607595, 0.6176498188871696, 0.1499305182121694, 0.6147238792663262, 0.002410349477315677, 0.2250134897872399, 0.3325609460550422, 0.2162635734279119, 0.1163676872727156, 0.8357086429536057, 0.1244273829377012, 0.1577020076185499, 0.002666472390048749, 0.05295434583259118, 0.001613425343252465, 0.5623442417324168, 0.8207602235525642, 0.743108949740715, 0.02796541196791737, 0.4186313156207639, 0.003002506302591648, 0.956120428922568, 0.002154735696853137, 0.929905389987854, 0.6243001545884486, 0.05206599018431463, 0.4112466686676627, 0.2772079489434584, 0.02394458160906492, 0.01180789186261077, 0.1677635907977094, 0.006647626564956893, 0.1227266544676539, 0.007363841257697064, 0.9605972895231527, 0.3855647603653409, 0.6857444469444728, 0.3306481235539554, 0.9829099782737166, 0.9762272101726904, 0.1327914990848322] 
+  ],
+ "analysis":{
+   "authors":"Sergei L Kosakovsky Pond, Ben Murrell, Steven Weaver and Temple iGEM / UCSD viral evolution group",
+   "citation":"Less Is More: An Adaptive Branch-Site Random Effects Model for Efficient Detection of Episodic Diversifying Selection (2015). Mol Biol Evol 32 (5): 1342-1353. v2.2 adds support for multiple-hit models. v2.3 adds support for SRV",
+   "contact":"spond@temple.edu",
+   "info":"aBSREL (Adaptive branch-site random effects likelihood)\n                            uses an adaptive random effects branch-site model framework\n                            to test whether each branch has evolved under positive selection,\n                            using a procedure which infers an optimal number of rate categories per branch.",
+   "requirements":"in-frame codon alignment and a phylogenetic tree",
+   "version":"2.3"
+  },
+ "branch attributes":{
+   "0":{
+     "Baboon":{
+       "Baseline MG94xREV":0.001882994109917251,
+       "Baseline MG94xREV omega ratio":0,
+       "Corrected P-value":1,
+       "Full adaptive model":0.001888788495524889,
+       "Full adaptive model (non-synonymous subs/site)":1e-10,
+       "Full adaptive model (synonymous subs/site)":0.001888788495524889,
+       "LRT":0,
+       "Nucleotide GTR":0.001685167654714891,
+       "Rate Distributions":        [
+[0, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":1,
+       "original name":"Baboon",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0
+      },
+     "Cat":{
+       "Baseline MG94xREV":0.2956038491638456,
+       "Baseline MG94xREV omega ratio":1.387276691142692,
+       "Corrected P-value":1,
+       "Full adaptive model":0.2987657142024844,
+       "Full adaptive model (non-synonymous subs/site)":0.2433925676712428,
+       "Full adaptive model (synonymous subs/site)":0.05537314653124186,
+       "LRT":0.8385257143854687,
+       "Nucleotide GTR":0.2660536011315811,
+       "Rate Distributions":        [
+[1.406509052931997, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":0.2692231522977311,
+       "original name":"Cat",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0.2039176940606485
+      },
+     "Chimp":{
+       "Baseline MG94xREV":0.001849682046955941,
+       "Baseline MG94xREV omega ratio":10000000000,
+       "Corrected P-value":1,
+       "Full adaptive model":0.001852710195778403,
+       "Full adaptive model (non-synonymous subs/site)":0.001852710195778403,
+       "Full adaptive model (synonymous subs/site)":1e-10,
+       "LRT":0.6095489899789754,
+       "Nucleotide GTR":0.001820258053351119,
+       "Rate Distributions":        [
+[10000000000, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":0.3081784202350423,
+       "original name":"Chimp",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0
+      },
+     "Cow":{
+       "Baseline MG94xREV":0.2725380828787176,
+       "Baseline MG94xREV omega ratio":1.996288552263199,
+       "Corrected P-value":1,
+       "Full adaptive model":0.2767543531983568,
+       "Full adaptive model (non-synonymous subs/site)":0.2381665266426745,
+       "Full adaptive model (synonymous subs/site)":0.03858782655568219,
+       "LRT":3.11056227267909,
+       "Nucleotide GTR":0.2480198736772598,
+       "Rate Distributions":        [
+[2.042233367641365, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":0.07889622593515888,
+       "original name":"Cow",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0.1380461206420348
+      },
+     "Horse":{
+       "Baseline MG94xREV":0.2306806115249962,
+       "Baseline MG94xREV omega ratio":1.164040491954013,
+       "Corrected P-value":1,
+       "Full adaptive model":0.2320795562671627,
+       "Full adaptive model (non-synonymous subs/site)":0.1780556222700155,
+       "Full adaptive model (synonymous subs/site)":0.05402393399714727,
+       "LRT":0.2293786685804662,
+       "Nucleotide GTR":0.2090998951755368,
+       "Rate Distributions":        [
+[1.174701177865617, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":0.393889915055757,
+       "original name":"Horse",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0
+      },
+     "Human":{
+       "Baseline MG94xREV":0,
+       "Baseline MG94xREV omega ratio":1,
+       "Corrected P-value":1,
+       "Full adaptive model":0,
+       "Full adaptive model (non-synonymous subs/site)":1e-10,
+       "Full adaptive model (synonymous subs/site)":1e-10,
+       "LRT":0,
+       "Nucleotide GTR":0,
+       "Rate Distributions":        [
+[1, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":1,
+       "original name":"Human",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0.0009494209875164728
+      },
+     "Mouse":{
+       "Baseline MG94xREV":0.130389131191465,
+       "Baseline MG94xREV omega ratio":0.5075430486034895,
+       "Corrected P-value":1,
+       "Full adaptive model":0.1314019024803463,
+       "Full adaptive model (non-synonymous subs/site)":0.07806862630983659,
+       "Full adaptive model (synonymous subs/site)":0.05333327617050967,
+       "LRT":0,
+       "Nucleotide GTR":0.1181058300538561,
+       "Rate Distributions":        [
+[0.5153237391744061, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":1,
+       "original name":"Mouse",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0.02214869577417109
+      },
+     "Node1":{
+       "Baseline MG94xREV":0.3335904378274563,
+       "Baseline MG94xREV omega ratio":0.296025779706705,
+       "Corrected P-value":1,
+       "Full adaptive model":0.3367504162367471,
+       "Full adaptive model (non-synonymous subs/site)":0.1724145968502319,
+       "Full adaptive model (synonymous subs/site)":0.1643358193865155,
+       "LRT":0,
+       "Nucleotide GTR":0.2767105173979571,
+       "Rate Distributions":        [
+[0.3015051917009056, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":1,
+       "rate at which 2 nucleotides are changed instantly within a single codon":0.4322434210228028
+      },
+     "Node12":{
+       "Baseline MG94xREV":0.01392429623408649,
+       "Baseline MG94xREV omega ratio":0.2780699887855826,
+       "Corrected P-value":1,
+       "Full adaptive model":0.01389906280188583,
+       "Full adaptive model (non-synonymous subs/site)":0.006925004412300655,
+       "Full adaptive model (synonymous subs/site)":0.006974058389585205,
+       "LRT":0,
+       "Nucleotide GTR":0.01784222107494562,
+       "Rate Distributions":        [
+[0.2813759516294281, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":1,
+       "rate at which 2 nucleotides are changed instantly within a single codon":0.4640974620285408
+      },
+     "Node2":{
+       "Baseline MG94xREV":0.04571805957848055,
+       "Baseline MG94xREV omega ratio":0.07808093503260165,
+       "Corrected P-value":1,
+       "Full adaptive model":0.0459318071864371,
+       "Full adaptive model (non-synonymous subs/site)":0.02632650948831447,
+       "Full adaptive model (synonymous subs/site)":0.01960529769812262,
+       "LRT":0,
+       "Nucleotide GTR":0.06614755778044307,
+       "Rate Distributions":        [
+[0.07994399997950775, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":1,
+       "rate at which 2 nucleotides are changed instantly within a single codon":10.77888358494443
+      },
+     "Node3":{
+       "Baseline MG94xREV":0.1076878090259787,
+       "Baseline MG94xREV omega ratio":1.418168092305362,
+       "Corrected P-value":1,
+       "Full adaptive model":0.1082923487440297,
+       "Full adaptive model (non-synonymous subs/site)":0.08948990966777266,
+       "Full adaptive model (synonymous subs/site)":0.01880243907625684,
+       "LRT":0.2456529644996408,
+       "Nucleotide GTR":0.09883748387954429,
+       "Rate Distributions":        [
+[1.433858907010162, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":0.389355679288724,
+       "rate at which 2 nucleotides are changed instantly within a single codon":0.3287265444712935
+      },
+     "Node8":{
+       "Baseline MG94xREV":0.1135770124969486,
+       "Baseline MG94xREV omega ratio":2.028136557891868,
+       "Corrected P-value":1,
+       "Full adaptive model":0.1147398059647541,
+       "Full adaptive model (non-synonymous subs/site)":0.0990475665351926,
+       "Full adaptive model (synonymous subs/site)":0.01569223942956148,
+       "LRT":0.7886998749927443,
+       "Nucleotide GTR":0.1062201244057951,
+       "Rate Distributions":        [
+[1.988476719481082, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":0.2771341436242022,
+       "rate at which 2 nucleotides are changed instantly within a single codon":0.2354207827705045
+      },
+     "Node9":{
+       "Baseline MG94xREV":0.03003888198106763,
+       "Baseline MG94xREV omega ratio":0.4077675922423373,
+       "Corrected P-value":1,
+       "Full adaptive model":0.03019973043687331,
+       "Full adaptive model (non-synonymous subs/site)":0.01619043357790366,
+       "Full adaptive model (synonymous subs/site)":0.01400929685896962,
+       "LRT":0,
+       "Nucleotide GTR":0.02567813733543303,
+       "Rate Distributions":        [
+[0.4119078417573153, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":1,
+       "rate at which 2 nucleotides are changed instantly within a single codon":0
+      },
+     "Pig":{
+       "Baseline MG94xREV":0.217114312357174,
+       "Baseline MG94xREV omega ratio":1.283370430439691,
+       "Corrected P-value":1,
+       "Full adaptive model":0.2181331361104026,
+       "Full adaptive model (non-synonymous subs/site)":0.1712686263446052,
+       "Full adaptive model (synonymous subs/site)":0.04686450976579729,
+       "LRT":0.5406119303397645,
+       "Nucleotide GTR":0.1871390433004313,
+       "Rate Distributions":        [
+[1.302541757406645, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":0.3213796354214938,
+       "original name":"Pig",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0
+      },
+     "Rat":{
+       "Baseline MG94xREV":0.06785652890791004,
+       "Baseline MG94xREV omega ratio":0.9234518387715737,
+       "Corrected P-value":1,
+       "Full adaptive model":0.06783877994658692,
+       "Full adaptive model (non-synonymous subs/site)":0.04934287026354431,
+       "Full adaptive model (synonymous subs/site)":0.01849590968304254,
+       "LRT":0,
+       "Nucleotide GTR":0.06661490534189227,
+       "Rate Distributions":        [
+[0.939079296251313, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":1,
+       "original name":"Rat",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0.02234985038534893
+      },
+     "RhMonkey":{
+       "Baseline MG94xREV":0.0036869629402653,
+       "Baseline MG94xREV omega ratio":10000000000,
+       "Corrected P-value":1,
+       "Full adaptive model":0.003691831254195047,
+       "Full adaptive model (non-synonymous subs/site)":0.003691831254195047,
+       "Full adaptive model (synonymous subs/site)":1e-10,
+       "LRT":1.049935795353122,
+       "Nucleotide GTR":0.003778804730491441,
+       "Rate Distributions":        [
+[10000000000, 1] 
+        ],
+       "Rate classes":1,
+       "Uncorrected P-value":0.2385766813428075,
+       "original name":"RhMonkey",
+       "rate at which 2 nucleotides are changed instantly within a single codon":0
+      }
+    },
+   "attributes":{
+     "Baseline MG94xREV":{
+       "attribute type":"branch length",
+       "display order":1
+      },
+     "Baseline MG94xREV omega ratio":{
+       "attribute type":"branch label",
+       "display order":1
+      },
+     "Corrected P-value":{
+       "attribute type":"branch label",
+       "display order":6
+      },
+     "Full adaptive model":{
+       "attribute type":"branch length",
+       "display order":2
+      },
+     "Full adaptive model (non-synonymous subs/site)":{
+       "attribute type":"branch label",
+       "display order":10
+      },
+     "Full adaptive model (synonymous subs/site)":{
+       "attribute type":"branch label",
+       "display order":9
+      },
+     "LRT":{
+       "attribute type":"branch label",
+       "display order":4
+      },
+     "Nucleotide GTR":{
+       "attribute type":"branch length",
+       "display order":0
+      },
+     "Rate Distributions":{
+       "attribute type":"branch label",
+       "display order":3
+      },
+     "Rate classes":{
+       "attribute type":"branch label",
+       "display order":2
+      },
+     "Uncorrected P-value":{
+       "attribute type":"branch label",
+       "display order":5
+      },
+     "original name":{
+       "attribute type":"node label",
+       "display order":-1
+      },
+     "rate at which 2 nucleotides are changed instantly within a single codon":{
+       "attribute type":"branch label",
+       "display order":7
+      }
+    }
+  },
+ "data partitions":{
+   "0":{
+     "coverage":      [
+[0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186] 
+      ],
+     "name":"absrel.filter.default"
+    }
+  },
+ "fits":{
+   "Baseline MG94xREV":{
+     "AIC-c":6938.369899478594,
+     "Equilibrium frequencies":      [
+[0.04876086397632926],
+      [0.03982224127745371],
+      [0.0494959405650269],
+      [0.04152830682371345],
+      [0.01810345074594235],
+      [0.01478480742075003],
+      [0.01837636270304883],
+      [0.01541821854326533],
+      [0.01892910005547028],
+      [0.01545910240515689],
+      [0.01921445878706794],
+      [0.01612140169177368],
+      [0.02829747763884322],
+      [0.02311011106415996],
+      [0.02872406592369408],
+      [0.02410019507229243],
+      [0.01663805943190806],
+      [0.01358804506433061],
+      [0.01688888041768248],
+      [0.01417018446135155],
+      [0.006177213955434187],
+      [0.005044834822351987],
+      [0.006270336287397383],
+      [0.00526096577332031],
+      [0.006458939937330408],
+      [0.005274916061901906],
+      [0.006556309326397028],
+      [0.005500904159606446],
+      [0.009655594186286731],
+      [0.007885574003572761],
+      [0.009801153568494354],
+      [0.008223407979974132],
+      [0.03327785448210915],
+      [0.02717750758119989],
+      [0.03377952261833742],
+      [0.02834184710178207],
+      [0.01235507229404208],
+      [0.01009019590244688],
+      [0.01254132667213156],
+      [0.01052248035033209],
+      [0.01291855364640413],
+      [0.01055038238273567],
+      [0.01311330258173711],
+      [0.01100238215235291],
+      [0.01931219560697892],
+      [0.0157719705998612],
+      [0.01960332955558842],
+      [0.01644767379420349],
+      [0.01965132601881859],
+      [0.02049322866376102],
+      [0.008933621043463411],
+      [0.007295949736387736],
+      [0.009068296583349953],
+      [0.007608523013862737],
+      [0.007628698224327205],
+      [0.009481877006094248],
+      [0.00795552712159237],
+      [0.01396413011303752],
+      [0.01140428846505027],
+      [0.01417464125436193],
+      [0.01189287130232129] 
+      ],
+     "Log Likelihood":-3399.656647852504,
+     "Rate Distributions":{
+       "Per-branch delta":{
+         "2.5%":0,
+         "97.5%":10.66318587577853,
+         "Mean":1.142287895998736,
+         "Median":0.2080459069952131
+        },
+       "Per-branch omega":{
+         "2.5%":0,
+         "97.5%":2.028136557891868,
+         "Mean":666666667.5178814,
+         "Median":1
+        },
+       "Synonymous site-to-site rates":{
+         "0":{
+           "proportion":0.3499070593950995,
+           "rate":0.3584907731592092
+          },
+         "1":{
+           "proportion":0.5579704535685105,
+           "rate":1.083607309819905
+          },
+         "2":{
+           "proportion":0.09212248703639001,
+           "rate":2.93023662601063
+          }
+        }
+      },
+     "display order":1,
+     "estimated parameters":67
+    },
+   "Full adaptive model":{
+     "AIC-c":6937.867430345418,
+     "Log Likelihood":-3399.405413285916,
+     "Rate Distributions":{
+      },
+     "display order":2,
+     "estimated parameters":67
+    },
+   "Nucleotide GTR":{
+     "AIC-c":7112.857288723968,
+     "Equilibrium frequencies":      [
+[0.3592490842490842],
+      [0.181959706959707],
+      [0.240018315018315],
+      [0.2187728937728937] 
+      ],
+     "Log Likelihood":-3532.321213744258,
+     "Rate Distributions":{
+       "Substitution rate from nucleotide A to nucleotide C":0.5501644800943087,
+       "Substitution rate from nucleotide A to nucleotide G":1,
+       "Substitution rate from nucleotide A to nucleotide T":0.2646800222727828,
+       "Substitution rate from nucleotide C to nucleotide G":0.4918071762416347,
+       "Substitution rate from nucleotide C to nucleotide T":1.028675134787727,
+       "Substitution rate from nucleotide G to nucleotide T":0.3045013055839741
+      },
+     "display order":0,
+     "estimated parameters":24
+    }
+  },
+ "input":{
+   "file name":"/tmp/tmpasswxnks/job_working_directory/000/9/working/./input.fasta",
+   "number of sequences":10,
+   "number of sites":187,
+   "partition count":1,
+   "trees":{
+     "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.08509899999999999,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"
+    }
+  },
+ "runtime":"2.5.36",
+ "test results":{
+   "P-value threshold":0.05,
+   "positive test results":0,
+   "tested":16
+  },
+ "tested":{
+   "0":{
+     "Baboon":"test",
+     "Cat":"test",
+     "Chimp":"test",
+     "Cow":"test",
+     "Horse":"test",
+     "Human":"test",
+     "Mouse":"test",
+     "Node1":"test",
+     "Node12":"test",
+     "Node2":"test",
+     "Node3":"test",
+     "Node8":"test",
+     "Node9":"test",
+     "Pig":"test",
+     "Rat":"test",
+     "RhMonkey":"test"
+    }
+  },
+ "timers":{
+   "Baseline model fitting":{
+     "order":2,
+     "timer":129
+    },
+   "Complexity analysis":{
+     "order":3,
+     "timer":406
+    },
+   "Full adaptive model fitting":{
+     "order":4,
+     "timer":46
+    },
+   "Overall":{
+     "order":0,
+     "timer":1006
+    },
+   "Preliminary model fitting":{
+     "order":1,
+     "timer":0
+    },
+   "Testing for selection":{
+     "order":5,
+     "timer":424
+    }
+  }
+}
\ No newline at end of file
--- a/test-data/relax-out1.json	Sat Nov 27 11:25:19 2021 +0000
+++ b/test-data/relax-out1.json	Wed Mar 30 00:15:54 2022 +0000
@@ -3,53 +3,53 @@
  "branch attributes":{
    "0":{
      "Baboon":{
-       "General descriptive":0.001858767762813579,
-       "MG94xREV with separate rates for branch sets":0.001769472024099301,
-       "Nucleotide GTR":0.001680040630127455,
-       "RELAX alternative":0.001872256662230973,
-       "RELAX null":0.001855569334462731,
-       "RELAX partitioned descriptive":0.001898170574782418,
-       "k (general descriptive)":0.09971581394819819,
+       "General descriptive":0.001859058366368826,
+       "MG94xREV with separate rates for branch sets":0.001769294089885709,
+       "Nucleotide GTR":0.001685167654714891,
+       "RELAX alternative":0.001873708670384941,
+       "RELAX null":0.001859167714920677,
+       "RELAX partitioned descriptive":0.001898817195216417,
+       "k (general descriptive)":0.09969742933359635,
        "original name":"Baboon"
       },
      "Cat":{
-       "General descriptive":0.3644803308678196,
-       "MG94xREV with separate rates for branch sets":0.2796030091674721,
-       "Nucleotide GTR":0.2660909938917123,
-       "RELAX alternative":0.3689219388980864,
-       "RELAX null":0.3256077554105627,
-       "RELAX partitioned descriptive":0.3717219559832593,
-       "k (general descriptive)":2.314507643873676,
+       "General descriptive":0.3650161006190072,
+       "MG94xREV with separate rates for branch sets":0.2796018473093496,
+       "Nucleotide GTR":0.2660536011315811,
+       "RELAX alternative":0.3685874431614762,
+       "RELAX null":0.3167334440346762,
+       "RELAX partitioned descriptive":0.3719472357609613,
+       "k (general descriptive)":2.319877215422834,
        "original name":"Cat"
       },
      "Chimp":{
-       "General descriptive":0.001848680051431209,
-       "MG94xREV with separate rates for branch sets":0.001825434296531533,
-       "Nucleotide GTR":0.001818373670119325,
-       "RELAX alternative":0.001831703934281931,
-       "RELAX null":0.00183525802483954,
-       "RELAX partitioned descriptive":0.001832717232153088,
-       "k (general descriptive)":5.261186652622472,
+       "General descriptive":0.001895983937468787,
+       "MG94xREV with separate rates for branch sets":0.001826027667597702,
+       "Nucleotide GTR":0.001820258053351119,
+       "RELAX alternative":0.001831530791728368,
+       "RELAX null":0.001834052740714585,
+       "RELAX partitioned descriptive":0.001832682515795942,
+       "k (general descriptive)":5.158328270628251,
        "original name":"Chimp"
       },
      "Cow":{
-       "General descriptive":0.3733627618450006,
-       "MG94xREV with separate rates for branch sets":0.2520490246808783,
-       "Nucleotide GTR":0.2481025999892287,
-       "RELAX alternative":0.342739998512865,
-       "RELAX null":0.2948256709356563,
-       "RELAX partitioned descriptive":0.3466331923230422,
-       "k (general descriptive)":2.846155982935764,
+       "General descriptive":0.3737128696500712,
+       "MG94xREV with separate rates for branch sets":0.2521304147607955,
+       "Nucleotide GTR":0.2480198736772598,
+       "RELAX alternative":0.3426997068768813,
+       "RELAX null":0.2931467439343907,
+       "RELAX partitioned descriptive":0.3469082289876269,
+       "k (general descriptive)":2.852150041266453,
        "original name":"Cow"
       },
      "Horse":{
-       "General descriptive":0.2802176313870697,
-       "MG94xREV with separate rates for branch sets":0.2158304510870495,
-       "Nucleotide GTR":0.2090310577070883,
-       "RELAX alternative":0.3058487498567987,
-       "RELAX null":0.2559911331878715,
-       "RELAX partitioned descriptive":0.3034694616209482,
-       "k (general descriptive)":1.926646959057857,
+       "General descriptive":0.2804279827409984,
+       "MG94xREV with separate rates for branch sets":0.2158535884657318,
+       "Nucleotide GTR":0.2090998951755368,
+       "RELAX alternative":0.3058441352816696,
+       "RELAX null":0.2546949756245578,
+       "RELAX partitioned descriptive":0.3035514182923183,
+       "k (general descriptive)":1.929916608813313,
        "original name":"Horse"
       },
      "Human":{
@@ -59,101 +59,101 @@
        "RELAX alternative":0,
        "RELAX null":0,
        "RELAX partitioned descriptive":0,
-       "k (general descriptive)":1.462532487172471,
+       "k (general descriptive)":1.485684693044203,
        "original name":"Human"
       },
      "Mouse":{
-       "General descriptive":0.1307950021191255,
-       "MG94xREV with separate rates for branch sets":0.1197727080219867,
-       "Nucleotide GTR":0.1180171198334285,
-       "RELAX alternative":0.1346501492117481,
-       "RELAX null":0.1468861666244963,
-       "RELAX partitioned descriptive":0.1475623398849678,
-       "k (general descriptive)":0.4639609139295889,
+       "General descriptive":0.1308809509233143,
+       "MG94xREV with separate rates for branch sets":0.1197584101055861,
+       "Nucleotide GTR":0.1181058300538561,
+       "RELAX alternative":0.1346294129227689,
+       "RELAX null":0.1438267359449897,
+       "RELAX partitioned descriptive":0.148454172127534,
+       "k (general descriptive)":0.4625550584398252,
        "original name":"Mouse"
       },
      "Node1":{
-       "General descriptive":0.350050900813081,
-       "MG94xREV with separate rates for branch sets":0.2857356440257563,
-       "Nucleotide GTR":0.2767237570684924,
-       "RELAX alternative":0.3856490868629754,
-       "RELAX null":0.4521046025119397,
-       "RELAX partitioned descriptive":0.4358952685746469,
-       "k (general descriptive)":0.458870761901378
+       "General descriptive":0.3500691487967139,
+       "MG94xREV with separate rates for branch sets":0.2856782993656827,
+       "Nucleotide GTR":0.2767105173979571,
+       "RELAX alternative":0.385503346940632,
+       "RELAX null":0.4352096867868785,
+       "RELAX partitioned descriptive":0.4379872513902164,
+       "k (general descriptive)":0.4572754180074107
       },
      "Node12":{
-       "General descriptive":0.01766384491594095,
-       "MG94xREV with separate rates for branch sets":0.01800001211221997,
-       "Nucleotide GTR":0.01784803874223016,
-       "RELAX alternative":0.01835132674304535,
-       "RELAX null":0.0182458522959868,
-       "RELAX partitioned descriptive":0.01878351896299688,
-       "k (general descriptive)":0.1241597340554799
+       "General descriptive":0.01767932040676307,
+       "MG94xREV with separate rates for branch sets":0.01800350744117403,
+       "Nucleotide GTR":0.01784222107494562,
+       "RELAX alternative":0.01834159481548459,
+       "RELAX null":0.01822563245625142,
+       "RELAX partitioned descriptive":0.01881534539472323,
+       "k (general descriptive)":0.1240073621579099
       },
      "Node2":{
-       "General descriptive":0.05771641706257456,
-       "MG94xREV with separate rates for branch sets":0.06169547093990335,
-       "Nucleotide GTR":0.06613162123865737,
-       "RELAX alternative":0.05450381496370671,
-       "RELAX null":0.06144358908741494,
-       "RELAX partitioned descriptive":0.05974179966710006,
-       "k (general descriptive)":0.5400661932123572
+       "General descriptive":0.05767151047612454,
+       "MG94xREV with separate rates for branch sets":0.06170856993599769,
+       "Nucleotide GTR":0.06614755778044307,
+       "RELAX alternative":0.0544792799094392,
+       "RELAX null":0.06013052353393462,
+       "RELAX partitioned descriptive":0.0601550105387935,
+       "k (general descriptive)":0.5400834620465133
       },
      "Node3":{
-       "General descriptive":0.133048972566238,
-       "MG94xREV with separate rates for branch sets":0.09736816312927643,
-       "Nucleotide GTR":0.09886326330774685,
-       "RELAX alternative":0.1168284793254293,
-       "RELAX null":0.1276889506286756,
-       "RELAX partitioned descriptive":0.1195376339442456,
-       "k (general descriptive)":1.980345386854111
+       "General descriptive":0.1330088052861041,
+       "MG94xREV with separate rates for branch sets":0.09733132151710643,
+       "Nucleotide GTR":0.09883748387954429,
+       "RELAX alternative":0.1169235247351394,
+       "RELAX null":0.1263887172366205,
+       "RELAX partitioned descriptive":0.1196402015693241,
+       "k (general descriptive)":1.977892771876671
       },
      "Node8":{
-       "General descriptive":0.1404364853762839,
-       "MG94xREV with separate rates for branch sets":0.1092041281639667,
-       "Nucleotide GTR":0.106239268140425,
-       "RELAX alternative":0.1283918913740865,
-       "RELAX null":0.1343238120118072,
-       "RELAX partitioned descriptive":0.1363833239244288,
-       "k (general descriptive)":2.210166852936262
+       "General descriptive":0.140412283431793,
+       "MG94xREV with separate rates for branch sets":0.1091939823455765,
+       "Nucleotide GTR":0.1062201244057951,
+       "RELAX alternative":0.1284192265733904,
+       "RELAX null":0.1334227466998376,
+       "RELAX partitioned descriptive":0.1367904558404228,
+       "k (general descriptive)":2.206967022203622
       },
      "Node9":{
-       "General descriptive":0.02665050120918479,
-       "MG94xREV with separate rates for branch sets":0.02578196090462333,
-       "Nucleotide GTR":0.02566573875750134,
-       "RELAX alternative":0.02679622227446188,
-       "RELAX null":0.02754241929890747,
-       "RELAX partitioned descriptive":0.0274479920792393,
-       "k (general descriptive)":0.0733131770696667
+       "General descriptive":0.02664133794298214,
+       "MG94xREV with separate rates for branch sets":0.02578742148415842,
+       "Nucleotide GTR":0.02567813733543303,
+       "RELAX alternative":0.02680940150436639,
+       "RELAX null":0.0273694783141817,
+       "RELAX partitioned descriptive":0.02747376898615263,
+       "k (general descriptive)":0.07343731037788495
       },
      "Pig":{
-       "General descriptive":0.2104601216238473,
-       "MG94xREV with separate rates for branch sets":0.1902977811335351,
-       "Nucleotide GTR":0.1871893456388788,
-       "RELAX alternative":0.19752905148822,
-       "RELAX null":0.2165309177979844,
-       "RELAX partitioned descriptive":0.2074828949843082,
-       "k (general descriptive)":1.577441472516679,
+       "General descriptive":0.210591346560755,
+       "MG94xREV with separate rates for branch sets":0.1903463787974325,
+       "Nucleotide GTR":0.1871390433004313,
+       "RELAX alternative":0.1974790507889271,
+       "RELAX null":0.2130024973755621,
+       "RELAX partitioned descriptive":0.2084407457285946,
+       "k (general descriptive)":1.581210670484469,
        "original name":"Pig"
       },
      "Rat":{
-       "General descriptive":0.07164210204456434,
-       "MG94xREV with separate rates for branch sets":0.06709541225974219,
-       "Nucleotide GTR":0.06661283005976348,
-       "RELAX alternative":0.07247047023746757,
-       "RELAX null":0.07343093575256582,
-       "RELAX partitioned descriptive":0.07560655472076994,
-       "k (general descriptive)":1.318174884032695,
+       "General descriptive":0.07157977734335202,
+       "MG94xREV with separate rates for branch sets":0.06709765698107663,
+       "Nucleotide GTR":0.06661490534189227,
+       "RELAX alternative":0.07252374836036582,
+       "RELAX null":0.0734705682786943,
+       "RELAX partitioned descriptive":0.0757525093290258,
+       "k (general descriptive)":1.316568267879453,
        "original name":"Rat"
       },
      "RhMonkey":{
-       "General descriptive":0.003674505194636419,
-       "MG94xREV with separate rates for branch sets":0.003716165486244973,
-       "Nucleotide GTR":0.003775170135617877,
-       "RELAX alternative":0.003636176595806718,
-       "RELAX null":0.003665938723426083,
-       "RELAX partitioned descriptive":0.003624376345656283,
-       "k (general descriptive)":5.171610533872274,
+       "General descriptive":0.003672848089716511,
+       "MG94xREV with separate rates for branch sets":0.003717350789869306,
+       "Nucleotide GTR":0.003778804730491441,
+       "RELAX alternative":0.003633278464154418,
+       "RELAX null":0.003661271320845124,
+       "RELAX partitioned descriptive":0.003625957794514879,
+       "k (general descriptive)":5.196295069596697,
        "original name":"RhMonkey"
       }
     },
@@ -202,21 +202,21 @@
   },
  "fits":{
    "General descriptive":{
-     "AIC-c":6945.891353881681,
-     "Log Likelihood":-3420.486931066253,
+     "AIC-c":6945.892677835464,
+     "Log Likelihood":-3420.487593043145,
      "Rate Distributions":{
        "Shared":{
          "0":{
-           "omega":2.202835393423959e-18,
-           "proportion":0.4487473029633234
+           "omega":2.201451464048879e-18,
+           "proportion":0.3073650505039141
           },
          "1":{
-           "omega":2.202835393423959e-18,
-           "proportion":0.09729227592412616
+           "omega":2.201451464048879e-18,
+           "proportion":0.2383891488636319
           },
          "2":{
-           "omega":2.202835210940273,
-           "proportion":0.4539604211125504
+           "omega":2.201451281679838,
+           "proportion":0.4542458006324541
           }
         }
       },
@@ -224,7 +224,7 @@
      "estimated parameters":51
     },
    "MG94xREV with separate rates for branch sets":{
-     "AIC-c":6987.565999172035,
+     "AIC-c":6987.566513560764,
      "Equilibrium frequencies":      [
 [0.04876086397632926],
       [0.03982224127745371],
@@ -288,68 +288,68 @@
       [0.01417464125436193],
       [0.01189287130232129] 
       ],
-     "Log Likelihood":-3461.208149286616,
+     "Log Likelihood":-3461.208406480981,
      "Rate Distributions":{
        "non-synonymous/synonymous rate ratio for *Reference*":        [
-[0.7682335289209781, 1] 
+[0.7685912547191639, 1] 
         ],
        "non-synonymous/synonymous rate ratio for *Test*":        [
-[1.605439824256426, 1] 
+[1.603198088111489, 1] 
         ]
       },
      "display order":1,
      "estimated parameters":32
     },
    "Nucleotide GTR":{
-     "AIC-c":7112.857310169033,
+     "AIC-c":7112.857288723968,
      "Equilibrium frequencies":      [
 [0.3592490842490842],
       [0.181959706959707],
       [0.240018315018315],
       [0.2187728937728937] 
       ],
-     "Log Likelihood":-3532.32122446679,
+     "Log Likelihood":-3532.321213744258,
      "Rate Distributions":{
        "Substitution rate from nucleotide A to nucleotide C":0.5501644800943087,
        "Substitution rate from nucleotide A to nucleotide G":1,
-       "Substitution rate from nucleotide A to nucleotide T":0.2647746107611847,
-       "Substitution rate from nucleotide C to nucleotide G":0.4917423221832032,
-       "Substitution rate from nucleotide C to nucleotide T":1.02837595903795,
-       "Substitution rate from nucleotide G to nucleotide T":0.304509117524575
+       "Substitution rate from nucleotide A to nucleotide T":0.2646800222727828,
+       "Substitution rate from nucleotide C to nucleotide G":0.4918071762416347,
+       "Substitution rate from nucleotide C to nucleotide T":1.028675134787727,
+       "Substitution rate from nucleotide G to nucleotide T":0.3045013055839741
       },
      "display order":0,
      "estimated parameters":24
     },
    "RELAX alternative":{
-     "AIC-c":6931.922980697387,
-     "Log Likelihood":-3429.234812770952,
+     "AIC-c":6931.926773483473,
+     "Log Likelihood":-3429.236709163995,
      "Rate Distributions":{
        "Reference":{
          "0":{
-           "omega":1.762268314739328e-19,
-           "proportion":0.4504132080156107
+           "omega":1.761161171239182e-19,
+           "proportion":0.2691773911207853
           },
          "1":{
-           "omega":1.762268314739328e-19,
-           "proportion":0.08749553114962015
+           "omega":1.762922332410267e-19,
+           "proportion":0.2692122656891806
           },
          "2":{
-           "omega":2.19971015101232,
-           "proportion":0.4620912608347691
+           "omega":2.208286837998088,
+           "proportion":0.4616103431900341
           }
         },
        "Test":{
          "0":{
-           "omega":1.054840660215593e-44,
-           "proportion":0.4504132080156107
+           "omega":1.673670300056362e-44,
+           "proportion":0.2691773911207853
           },
          "1":{
-           "omega":1.054840660215593e-44,
-           "proportion":0.08749553114962015
+           "omega":1.677579612236672e-44,
+           "proportion":0.2692122656891806
           },
          "2":{
-           "omega":6.350765030542244,
-           "proportion":0.4620912608347691
+           "omega":6.354762788556926,
+           "proportion":0.4616103431900341
           }
         }
       },
@@ -357,35 +357,35 @@
      "estimated parameters":36
     },
    "RELAX null":{
-     "AIC-c":6946.046672507471,
-     "Log Likelihood":-3437.336313352972,
+     "AIC-c":6946.648596594286,
+     "Log Likelihood":-3437.63727539638,
      "Rate Distributions":{
        "Reference":{
          "0":{
-           "omega":0.1150006822953211,
-           "proportion":0.542405144031307
+           "omega":1.408928936991542e-20,
+           "proportion":0.265244047162938
           },
          "1":{
-           "omega":0.2401508033814633,
-           "proportion":0.08223353569636478
+           "omega":1.410337865928411e-20,
+           "proportion":0.28512630848952
           },
          "2":{
-           "omega":3.69263720947284,
-           "proportion":0.3753613202723282
+           "omega":3.213510017765925,
+           "proportion":0.4496296443475419
           }
         },
        "Test":{
          "0":{
-           "omega":0.1150006822953211,
-           "proportion":0.542405144031307
+           "omega":1.408928936991542e-20,
+           "proportion":0.265244047162938
           },
          "1":{
-           "omega":0.2401508033814633,
-           "proportion":0.08223353569636478
+           "omega":1.410337865928411e-20,
+           "proportion":0.28512630848952
           },
          "2":{
-           "omega":3.69263720947284,
-           "proportion":0.3753613202723282
+           "omega":3.213510017765925,
+           "proportion":0.4496296443475419
           }
         }
       },
@@ -393,35 +393,35 @@
      "estimated parameters":35
     },
    "RELAX partitioned descriptive":{
-     "AIC-c":6937.04707353565,
-     "Log Likelihood":-3427.626871923648,
+     "AIC-c":6937.049237937651,
+     "Log Likelihood":-3427.627954124649,
      "Rate Distributions":{
        "Reference":{
          "0":{
-           "omega":0.1943306885168281,
-           "proportion":0.3359458135547653
+           "omega":0.1847557016619168,
+           "proportion":0.4766160247339328
           },
          "1":{
-           "omega":0.2607558478587815,
-           "proportion":0.4332550437039296
+           "omega":0.3367540359539261,
+           "proportion":0.3005513276312735
           },
          "2":{
-           "omega":4.134271224300374,
-           "proportion":0.2307991427413052
+           "omega":4.272816072857538,
+           "proportion":0.2228326476347937
           }
         },
        "Test":{
          "0":{
-           "omega":0,
-           "proportion":0.4753488415962343
+           "omega":1.127143149593234e-21,
+           "proportion":0.2367540589657237
           },
          "1":{
-           "omega":0,
-           "proportion":0.03858318603767072
+           "omega":1.128270292740756e-21,
+           "proportion":0.2771164325302933
           },
          "2":{
-           "omega":6.017221959238516,
-           "proportion":0.486067972366095
+           "omega":6.023626417874829,
+           "proportion":0.4861295085039831
           }
         }
       },
@@ -430,7 +430,7 @@
     }
   },
  "input":{
-   "file name":"/tmp/tmpbauyxvdv/job_working_directory/000/3/working/./input.fasta",
+   "file name":"/tmp/tmpkgsdjj1d/job_working_directory/000/3/working/./input.fasta",
    "number of sequences":10,
    "number of sites":187,
    "partition count":1,
@@ -438,10 +438,11 @@
      "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.08509899999999999,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"
     }
   },
+ "runtime":"2.5.32",
  "test results":{
-   "LRT":16.20300116404087,
-   "p-value":5.690389451429301e-05,
-   "relaxation or intensification parameter":2.344938789085876
+   "LRT":16.80113246476958,
+   "p-value":4.150852429507523e-05,
+   "relaxation or intensification parameter":2.334214628944839
   },
  "tested":{
    "0":{
@@ -466,11 +467,11 @@
  "timers":{
    "General descriptive model fitting":{
      "order":2,
-     "timer":132
+     "timer":127
     },
    "Overall":{
      "order":0,
-     "timer":324
+     "timer":396
     },
    "Preliminary model fitting":{
      "order":1,
@@ -478,15 +479,15 @@
     },
    "RELAX alternative model fitting":{
      "order":3,
-     "timer":65
+     "timer":103
     },
    "RELAX null model fitting":{
      "order":4,
-     "timer":66
+     "timer":41
     },
    "RELAX partitioned descriptive":{
      "order":5,
-     "timer":53
+     "timer":116
     }
   }
 }
\ No newline at end of file
--- a/test-data/relax-out2-1.json	Sat Nov 27 11:25:19 2021 +0000
+++ b/test-data/relax-out2-1.json	Wed Mar 30 00:15:54 2022 +0000
@@ -1,60 +1,60 @@
 {
  "Synonymous site-posteriors":  [
-[0.2717348381268465, 0.5635158143073038, 0.5580958985234344, 0.4419267392327456, 0.1775513314393873, 0.01303903284026798, 0.00125071980641974, 0.2376006215377312, 0.8837687913991302, 0.697488732253998, 0.76440666757549, 0.1859131352278527, 0.4676839084660329, 0.5320161033357819, 0.4513687349306337, 0.8514990846254493, 0.9101555767748879, 0.9112112654445478, 0.9624478616388369, 0.9472735837633918, 0.8715894173292342, 0.9248557783401865, 0.3852870058193366, 0.7504386709677574, 0.7275694213063354, 0.1979029930878776, 0.2585255313006612, 0.426812371619399, 0.03564414482172501, 0.3292941826787388, 0.1427864928730872, 0.8324822227281018, 0.9311167984186458, 0.1209539167468769, 0.8726642109588801, 1.798577785061191e-05, 0.584102863529593, 0.5747348035616634, 0.5814406651776627, 0.02251840852563282, 0.1607002230623373, 0.499402751628698, 0.9327364905381349, 0.1164578922551683, 0.7414294602970922, 0.04004321943657974, 0.1252919499200681, 0.7016909689123084, 0.3099147090319344, 0.1594271385761372, 0.001721088532959928, 0.0002106542138058178, 0.7670245595319366, 0.01765606757145387, 0.08528617939935416, 0.01185048796937841, 0.008218049898468071, 0.294285815926654, 0.4088819101657737, 0.1819814701794264, 0.06741006997792491, 0.1648869485561294, 0.6641637464726119, 0.1696421815033135, 0.5337345685031449, 0.9785329157950278, 0.6089117121305408, 0.9214198863478258, 0.7040511824729966, 0.8748810706893103, 0.7603207301908244, 0.1587648197710778, 0.28009015626025, 0.9473769917649164, 0.03667497185975328, 0.6646432746680839, 0.005707942217110617, 0.4172795698582943, 0.002426641321239203, 0.9036479890682162, 0.8165937919459629, 0.5380686752231248, 0.8348947378138256, 0.8825623566861087, 0.003194607014896987, 0.1034323185116836, 0.1251183560640448, 0.6731739154042389, 0.02049494631105097, 0.7272701824195644, 0.9376578101739967, 0.03161216349993828, 0.08060038603464466, 0.05713766811791781, 0.7236799166647727, 0.03049686563145122, 0.4831167820690108, 0.3259152163804719, 0.9355990871535625, 0.2598255955335131, 0.649043721535527, 0.1395744847880144, 0.8655465087299661, 0.5535165112383126, 0.8759601400318501, 0.1331847979385494, 0.9385179832315519, 0.9590294197009215, 0.1177725177949566, 0.5310119897564728, 0.04436932195281112, 0.877273324169318, 0.07309972300058731, 0.8726642109588801, 0.0823189228969842, 0.674523501474146, 0.4093792912564727, 0.8837869026711356, 0.1208432028324516, 0.7875716367935024, 0.9342090047974666, 0.7281976470761374, 0.6335560301454017, 0.2642816632435872, 0.7601746562441594, 0.3971532429331721, 0.07967254820654134, 0.9205611063156326, 0.4126590346311199, 0.4718488374006657, 0.2324587146851173, 0.2530879180545083, 0.6735650752750825, 0.6778765556227805, 0.9393601651000962, 0.1757530496502532, 0.3931715696771638, 0.7913247469383754, 0.05849180455884406, 0.007027787474985664, 0.002980098295172601, 0.188566078048928, 0.02837364230845984, 0.008078062694748547, 0.4539148488391334, 0.2698860362225194, 0.03514662617223248, 0.8484422182215356, 0.5225500090930265, 0.8755046006217432, 0.01843684138990366, 0.6656855504934923, 0.7055653078864003, 0.236066638653311, 0.1567944657161159, 0.8781825877891227, 0.4362059051173987, 0.163327088806649, 0.004489982631214889, 0.03278376720971195, 0.03145887036879619, 0.6158371404365816, 0.8645373560796752, 0.6351698115277034, 0.04852978149651612, 0.2563374460202912, 0.07868312568368593, 0.9507071563814276, 0.007940480658871889, 0.9455733391892027, 0.4761025393051341, 0.06329409664274364, 0.486108446887078, 0.6554607928409875, 0.3294403859657761, 0.02718898835050054, 0.2632599441236705, 0.09462189267290307, 0.2747185708643275, 0.01971954733787938, 0.9591589529807978, 0.445066915720239, 0.7380186230528726, 0.3686112558749921, 0.9765948224615983, 0.9830372572797934, 0.3428744949444181],
-  [0.6626894690463668, 0.4168101145890417, 0.4227716136375318, 0.5460469376257381, 0.7920802349484392, 0.9148946082433389, 0.6025519507878634, 0.7576953307230244, 0.1161768196008485, 0.300870904847558, 0.2351081226775128, 0.8132535813497387, 0.5318877996344101, 0.4668967839553491, 0.5457786619820105, 0.1479110732581859, 0.08981215498205385, 0.08864753614086184, 0.03754663901787957, 0.05264738134386953, 0.1282694830193035, 0.07509403773664582, 0.6045747073099006, 0.2494182492383805, 0.2720633389832785, 0.7686452193266411, 0.7347907000739735, 0.5704008539033848, 0.8900810148388362, 0.6622067969268041, 0.8222772439705183, 0.1671173022573758, 0.06877381770722009, 0.8768213463619609, 0.1268874503761271, 0.1127865527442154, 0.4132113433068393, 0.4078574964781727, 0.4019815819137846, 0.8609057131470997, 0.8219904610542867, 0.497435507143602, 0.06718726850208989, 0.8529792964008307, 0.2575997459825998, 0.9202924086001865, 0.8495464183712909, 0.2964912971104518, 0.6713145926257978, 0.8291180520156611, 0.6114543507973933, 0.2852631377967785, 0.2328104534903255, 0.8072678280286864, 0.8704118647701751, 0.8427300705564067, 0.7172581750896507, 0.6964353697830554, 0.5892268563480649, 0.7827711632788862, 0.8763689637592522, 0.8149993211355185, 0.3354138449867816, 0.8200034180317622, 0.4608569377024781, 0.02146293171169837, 0.3894693088064173, 0.07856223214512185, 0.2951219222963878, 0.1248753788288069, 0.23850651390316, 0.822201023791224, 0.627275494762912, 0.05261813265775258, 0.8618949472054331, 0.3346412073253501, 0.8548149468968558, 0.5771185613312407, 0.7242200780105019, 0.09629867844856514, 0.1833251080952038, 0.4588348344430745, 0.1648017491057893, 0.1173023384873724, 0.7202020363335049, 0.841920226122869, 0.8253774540837836, 0.3259201372675988, 0.9264522698755596, 0.2718783364189744, 0.0623161368626097, 0.8817427136123017, 0.8412649479334562, 0.9101565666023068, 0.2759454352414827, 0.9059210056507722, 0.5150853978968362, 0.6682724435455734, 0.06435014148842051, 0.7307347025520569, 0.3503065425489416, 0.8426431543383731, 0.1343468579892265, 0.4453254501015221, 0.1238238880869908, 0.8434973789347984, 0.06147302641543798, 0.04096257607882416, 0.8697710797731286, 0.4656522682859228, 0.8377220353741578, 0.1225914426265887, 0.9157074633499515, 0.1268874503761271, 0.8810277708456211, 0.3236042343456706, 0.588466435226929, 0.1160918158368492, 0.868633806828536, 0.2120841007705051, 0.06578091460596601, 0.2717239680174366, 0.3631554309323438, 0.7318741011598721, 0.239303295331146, 0.5985069490535606, 0.8666265919603693, 0.07938077259629264, 0.5792577459252287, 0.5245227397084671, 0.7592533746052446, 0.7288592173620518, 0.3258846389358249, 0.3207495865537446, 0.06062952030075518, 0.8044647321952209, 0.6033218973236086, 0.2073209509499806, 0.9162118523056947, 0.7716338299835022, 0.5285881514017859, 0.8084325119883748, 0.9006732458311826, 0.7316022733524018, 0.539869789386791, 0.7265086919845559, 0.9506048395545971, 0.1507140050836589, 0.4768164423437415, 0.1243504919061002, 0.9208249402822801, 0.3328277190287885, 0.2938257782692427, 0.7556466811772135, 0.8229833832301169, 0.1217860716119049, 0.5579303813087731, 0.8256475188252808, 0.8404190118570157, 0.950929802178094, 0.913563134751453, 0.3826711465162441, 0.135233583856236, 0.3614714112014848, 0.9068087012645575, 0.7306455673064629, 0.8856728807826224, 0.04924521380966264, 0.7635888647846074, 0.05441972871740726, 0.5202968979030539, 0.9150032818678139, 0.5115466967684428, 0.3420818098691781, 0.6627903995193176, 0.9330488261015766, 0.7312957304732464, 0.9017792297379452, 0.722935810930791, 0.8786602595958583, 0.04081198111512852, 0.5544293545628831, 0.2612792602560225, 0.6262138192390445, 0.02340007387678394, 0.01696213795705415, 0.646589884642663],
-  [0.06557569282678667, 0.01967407110365451, 0.01913248783903384, 0.0120263231415164, 0.03036843361217343, 0.07206635891639328, 0.3961973294057168, 0.004704047739244364, 5.438900002120045e-05, 0.00164036289844408, 0.0004852097469972091, 0.0008332834224085657, 0.0004282918995570831, 0.001087112708869119, 0.002852603087355827, 0.0005898421163648459, 3.226824305841269e-05, 0.0001411984145905345, 5.499343283400918e-06, 7.90348927388237e-05, 0.0001410996514624031, 5.018392316756171e-05, 0.01013828687076274, 0.0001430797938620912, 0.0003672397103861051, 0.03345178758548123, 0.006683768625365442, 0.002786774477216176, 0.07427484033943885, 0.008499020394457128, 0.0349362631563945, 0.0004004750145224402, 0.0001093838741341128, 0.002224736891162243, 0.0004483386649928336, 0.887195461477934, 0.002685793163567702, 0.01740769996016384, 0.01657775290855277, 0.1165758783272675, 0.01730931588337583, 0.003161741227700084, 7.624095977511847e-05, 0.03056281134400099, 0.0009707937203079199, 0.0396643719632338, 0.02516163170864108, 0.001817733977239793, 0.01877069834226778, 0.01145480940820172, 0.3868245606696468, 0.7145262079894158, 0.0001649869777379475, 0.17507610439986, 0.04430195583047072, 0.1454194414742148, 0.2745237750118811, 0.009278814290290408, 0.001891233486161397, 0.03524736654168742, 0.05622096626282277, 0.02011373030835192, 0.0004224085406065104, 0.01035440046492424, 0.005408493794377071, 4.15249327386775e-06, 0.001618979063041763, 1.788150705243962e-05, 0.000826895230615602, 0.0002435504818827977, 0.001172755906015731, 0.01903415643769825, 0.09263434897683805, 4.8755773309914e-06, 0.1014300809348136, 0.0007155180065658238, 0.1394771108860336, 0.00560186881046495, 0.2733532806682589, 5.3332483218848e-05, 8.109995883345423e-05, 0.003096490333800809, 0.0003035130803851473, 0.0001353048265188285, 0.2766033566515981, 0.0546474553654474, 0.04950418985217168, 0.0009059473281622822, 0.05305278381338922, 0.0008514811614612199, 2.605296339365474e-05, 0.08664512288775998, 0.07813466603189904, 0.03270576527977536, 0.0003746480937446711, 0.06358212871777665, 0.001797820034153072, 0.005812340073954746, 5.077135801693337e-05, 0.009439701914429836, 0.0006497359155314646, 0.01778236087361252, 0.0001066332808073946, 0.001158038660165389, 0.0002159718811591629, 0.02331782312665233, 8.990353010030482e-06, 8.004220254467764e-06, 0.01245640243191475, 0.003335741957604481, 0.1179086426730309, 0.0001352332040930898, 0.01119281364946127, 0.0004483386649928336, 0.03665330625739472, 0.001872264180183387, 0.002154273516598294, 0.0001212814920152467, 0.01052299033901241, 0.0003442624359924907, 1.008059656744195e-05, 7.838490642616451e-05, 0.003288538922254504, 0.003844235596540642, 0.0005220484246945975, 0.004339808013267371, 0.05370085983308932, 5.81210880747816e-05, 0.008083219443651434, 0.003628422890867134, 0.008287910709638229, 0.01805286458343986, 0.0005502857890926899, 0.001373857823474923, 1.031459914862341e-05, 0.01978221815452602, 0.003506532999227595, 0.001354302111643929, 0.02529634313546128, 0.2213383825415122, 0.4684317503030413, 0.003001409962697131, 0.07095311186035747, 0.2603196639528496, 0.006215361774075545, 0.003605271792924552, 0.01424853427317049, 0.0008437766948056027, 0.0006335485632318505, 0.000144907472156624, 0.06073821832781605, 0.00148673047771923, 0.0006089138443571592, 0.008286680169475522, 0.0202221510537672, 3.134059897233663e-05, 0.005863713573828175, 0.01102539236807026, 0.1550910055117694, 0.01628643061219398, 0.05497799487975088, 0.00149171304717441, 0.0002290600640888508, 0.003358777270811912, 0.0446615172389264, 0.01301698667324574, 0.03564399353369165, 4.76298089098848e-05, 0.2284706545565208, 6.932093390199401e-06, 0.003600562791811967, 0.02170262148944251, 0.002344856344479302, 0.002457397289834446, 0.007769214514906187, 0.03976218554792285, 0.005444325403083032, 0.00359887758915189, 0.002345618204881661, 0.1016201930662625, 2.906590407364353e-05, 0.0005037297168778199, 0.0007021166911049794, 0.005174924885963465, 5.103661617929586e-06, 6.047631523361472e-07, 0.01053562041291899] 
+[0.6636913410863983, 0.4162861463391083, 0.4207669648198341, 0.5266957556553843, 0.7895328001950979, 0.9272590205679656, 0.6152945530195142, 0.7578515907144813, 0.1238947876214084, 0.3018037085532145, 0.2282864078469784, 0.7937331893941735, 0.5320234040808555, 0.4706871966418729, 0.5439405260809865, 0.1517881809649885, 0.09043162428247122, 0.08685065723885507, 0.03885767834229433, 0.05375215759679093, 0.1268225432845697, 0.07577668231270167, 0.6052751007842404, 0.2502160552371602, 0.2736708121460947, 0.7706988555442902, 0.748841088623575, 0.5723843790763415, 0.8949826459565234, 0.6384606763319275, 0.8239292808797724, 0.1664437117300734, 0.06847586601224155, 0.8824121911043322, 0.1271766673209644, 0.1148021398435604, 0.4117122840037579, 0.406499277480147, 0.4008888256405372, 0.8646423634969567, 0.8190691829853963, 0.500042208706628, 0.06797606990283254, 0.8587865476515109, 0.2593957205794197, 0.9238491908671513, 0.8512119846143551, 0.3063762561200102, 0.6669337037749883, 0.8301646821437867, 0.636853262388444, 0.2905505446517289, 0.241935494101366, 0.8128255914518664, 0.8694325465217606, 0.848675874090462, 0.7267309584033903, 0.6911098971620047, 0.583052312866751, 0.7867301296752277, 0.8804662810822645, 0.809644890871663, 0.3376753254168838, 0.8283707254597538, 0.4508845830660299, 0.0216331593168105, 0.3776212213040052, 0.07931015513156162, 0.2950308574589764, 0.1222844084424193, 0.2323128587705404, 0.8289275512891175, 0.631178544197552, 0.05325361766368054, 0.8662251485184755, 0.3212301783117932, 0.861017744903573, 0.5761459249816555, 0.7343170662946317, 0.09741215372980042, 0.1807849329793456, 0.4569927206185401, 0.1643327673634512, 0.1185284443150185, 0.7324030664891016, 0.8472376168908595, 0.8234507825433042, 0.3173650640633187, 0.9292941067446137, 0.2735709551124761, 0.06276324502006964, 0.8863623602779909, 0.8489458938246637, 0.9130985854899469, 0.2797994574222102, 0.9075929417789967, 0.5150137541063844, 0.6723801037322925, 0.06367665954274145, 0.7320704660828672, 0.3527697452184735, 0.8461914351678148, 0.1351211810935134, 0.4613328492603073, 0.124276342334713, 0.8475110259360163, 0.06206865929630392, 0.04122997041189784, 0.8672530362064098, 0.4581644690927911, 0.8415744872053624, 0.1236376392825715, 0.9203127839835408, 0.1271766673209644, 0.8695568439105728, 0.3242726536321666, 0.6064715811235907, 0.1165318836810881, 0.8722046458122451, 0.2149812075751182, 0.0665951965283386, 0.2742588346922531, 0.3653273246144033, 0.721568903142608, 0.2413820620693605, 0.588103471777193, 0.8686043286753734, 0.08010632672074527, 0.5761580378346324, 0.523544810651528, 0.7668186650136124, 0.731052877850959, 0.329467117190821, 0.3208367729701002, 0.06144214634573335, 0.8062919404136638, 0.6220061302015701, 0.2090699504697991, 0.9185889308419551, 0.7767477941019779, 0.5356868588016898, 0.8031407570629746, 0.9042937966352298, 0.7393000429370805, 0.5400823150565389, 0.7357099400943075, 0.9523857813416914, 0.1564516235889077, 0.4882755555291234, 0.1252145971401747, 0.9240797408523314, 0.3440045440887274, 0.2962312024479645, 0.7573666819357475, 0.8253574958581319, 0.1229691454797458, 0.5683960261123714, 0.8313273153092753, 0.8469672878626771, 0.9486952624246412, 0.9172349146810788, 0.3831591722552873, 0.1357178596976572, 0.363473489194153, 0.9082063423261078, 0.7310413241232628, 0.8851632091676694, 0.04945472390779559, 0.7711621490316225, 0.05488172075128287, 0.5228323482367553, 0.9173152634471772, 0.5124114157230398, 0.346256158312588, 0.6630870619405116, 0.9355504393694619, 0.7330631304859381, 0.8707601306551315, 0.7291701265889592, 0.8821257366537769, 0.04095247534309823, 0.557046605833562, 0.2622389511630402, 0.6288683743714585, 0.02357245006214095, 0.01713741578412558, 0.6313826523714624],
+  [0.2743023322221135, 0.5648645480971858, 0.5610960776914764, 0.4621444588317666, 0.1819965032117472, 0.01517197054895779, 0.001285397066934852, 0.237770173435577, 0.8760503299639748, 0.6966768513330499, 0.7712865741432136, 0.2055692959279675, 0.467588869184186, 0.5282957092313009, 0.453437004105985, 0.847639070476195, 0.9095387221217649, 0.9130173283763429, 0.9611371520818773, 0.9461719883146444, 0.873047603689393, 0.9241758773756539, 0.3848527557848621, 0.7496554398915677, 0.7259919964828598, 0.1973397259414319, 0.2447900856732285, 0.4250247107226652, 0.03429018564702653, 0.3539948086571276, 0.1450851756870583, 0.8331853667881707, 0.9314221729539086, 0.1155834134320015, 0.8724048672977598, 1.658149540309682e-05, 0.5857807252539552, 0.5769264752570858, 0.583342930893849, 0.0215334743838001, 0.1647435430160246, 0.4969703115959077, 0.9319523213673911, 0.1120232565307321, 0.7396778054077812, 0.03846059219499338, 0.124741136519381, 0.6918274167480769, 0.3154849659265925, 0.1590682430392637, 0.001836229882631717, 0.0002034017393107424, 0.7579012000277034, 0.01735892166466877, 0.08798304057869616, 0.01146612791194987, 0.008601665367279597, 0.3004065992434943, 0.4151827426052813, 0.1799608029504698, 0.06543181733505059, 0.1714883912428835, 0.6619495195203547, 0.161756213558491, 0.5444269499484111, 0.9783629791905525, 0.6209074641176577, 0.9206735094819766, 0.7041969237894216, 0.8774942699878289, 0.7666042372884002, 0.1529761317593632, 0.2789425737851874, 0.9467419798292375, 0.03638938423500817, 0.678116525125977, 0.005910684102002454, 0.4185581088481673, 0.002443996905814817, 0.902535873911968, 0.8191375545438203, 0.5401040388229511, 0.8353864808422348, 0.8813445820703684, 0.00350938678529145, 0.0992516191193913, 0.1347359809015424, 0.6818172006149786, 0.02044736325813198, 0.7256410623816163, 0.9372121455357204, 0.03088878301519983, 0.07601676939007423, 0.0559749856872087, 0.7198493258127491, 0.03183264044654346, 0.4833204800795115, 0.3221546205405407, 0.9362770435568251, 0.2589952528575054, 0.6466319253669296, 0.1370169244963471, 0.8647809495623066, 0.5375451664705625, 0.8755213924953222, 0.1303446736387168, 0.9379231352051123, 0.9587627304498215, 0.1207709523391801, 0.5386965662114014, 0.04497147293590154, 0.8762357274135854, 0.06921574659346287, 0.8724048672977598, 0.09671624002291995, 0.6739368423457478, 0.3914371458076842, 0.8833557721469369, 0.1179588715226985, 0.7846926977092684, 0.9333956547485719, 0.7256697026859646, 0.6315381343526444, 0.2751879457887698, 0.7581240564366307, 0.4079042867350654, 0.08091801951934784, 0.9198388540255344, 0.4161840803525, 0.4730238129204362, 0.225316614523093, 0.2518726579149618, 0.6700195787372318, 0.6778609099844141, 0.9385484325504536, 0.1751675532775389, 0.3746416429219113, 0.7896088460404121, 0.0574475487335897, 0.00706418528017537, 0.002698835991446662, 0.1942393779079875, 0.02848879063995053, 0.008028003301764043, 0.4539460272089236, 0.2607483569893428, 0.03453846141958155, 0.842711940541689, 0.5111295576759028, 0.8746499560497694, 0.01865198977450388, 0.6545255752387773, 0.7032007243820316, 0.2350520278588946, 0.1553898765268458, 0.8770020555354116, 0.4259201253847322, 0.1583072295940648, 0.004509379685615725, 0.03730764989652958, 0.03036924658056715, 0.6154442548257876, 0.8640685103645906, 0.6333037498350568, 0.04933287455002722, 0.2563285804215318, 0.08132358198234572, 0.9505007239266517, 0.007989028846656622, 0.9451119766086844, 0.4737570872827806, 0.0624233884749149, 0.4853828661457041, 0.6513578185861575, 0.3297174192967562, 0.02787756041241257, 0.2618158305562596, 0.1261438040827525, 0.2686373189356275, 0.02030654222548294, 0.9590203770469019, 0.4424908221974789, 0.7371035763826296, 0.3662894256913484, 0.9764227961257468, 0.9828620417082331, 0.3588696325875525],
+  [0.06200632669148827, 0.0188493055637058, 0.01813695748868956, 0.01115978551284925, 0.02847069659315495, 0.05756900888307675, 0.3834200499135511, 0.004378235849941886, 5.488241461678214e-05, 0.001519440113735824, 0.0004270180098079827, 0.0006975146778590436, 0.0003877267349584992, 0.001017094126826182, 0.002622469813028469, 0.0005727485588164091, 2.965359576402203e-05, 0.0001320143848021717, 5.16957582842479e-06, 7.585408856458547e-05, 0.0001298530260371754, 4.744031164439256e-05, 0.00987214343089759, 0.0001285048712720931, 0.0003371913710453744, 0.03196141851427783, 0.006368825703196368, 0.002590910200993363, 0.07072716839645006, 0.007544515010945032, 0.0309855434331694, 0.0003709214817558358, 0.0001019610338498684, 0.002004395463666237, 0.0004184653812758382, 0.8851812786610365, 0.002506990742287029, 0.01657424726276721, 0.01576824346561369, 0.1138241621192431, 0.0161872739985793, 0.002987479697464419, 7.160872977626964e-05, 0.02919019581775702, 0.0009264740127991631, 0.03769021693785515, 0.024046878866264, 0.001796327131912845, 0.01758133029841935, 0.01076707481694939, 0.3613105077289244, 0.7092460536089605, 0.0001633058709305536, 0.1698154868834648, 0.04258441289954325, 0.1398579979975882, 0.2646673762293301, 0.008483503594501085, 0.001764944527967773, 0.03330906737430261, 0.05410190158268501, 0.0188667178854535, 0.0003751550627614564, 0.00987306098175521, 0.00468846698555898, 3.861492637121265e-06, 0.001471314578337083, 1.633538646184149e-05, 0.0007722187516018551, 0.0002213215697517784, 0.001082903941059475, 0.01809631695151915, 0.08987888201726048, 4.402507081878654e-06, 0.09738546724651619, 0.0006532965622299613, 0.1330715709944246, 0.00529596617017732, 0.2632389367995536, 5.197235823149346e-05, 7.751247683417043e-05, 0.002903240558508806, 0.0002807517943139329, 0.0001269736146131525, 0.2640875467256069, 0.0535107639897493, 0.04181323655515343, 0.0008177353217027728, 0.05025852999725455, 0.0007879825059076829, 2.460944420999514e-05, 0.08274885670680922, 0.07503733678526217, 0.03092642882284448, 0.0003512167650406857, 0.06057441777445976, 0.001665765814104195, 0.005465275727166909, 4.629690043346711e-05, 0.008934281059627363, 0.0005983294145967669, 0.01679164033583811, 9.786934418001151e-05, 0.001121984269130162, 0.0002022651699647995, 0.02214430042526674, 8.205498583727208e-06, 7.299138280612693e-06, 0.01197601145441014, 0.003138964695807494, 0.1134540398587359, 0.0001266333038430186, 0.01047146942299623, 0.0004184653812758382, 0.03372691606650723, 0.001790504022085792, 0.002091273068725143, 0.0001123441719750002, 0.009836482665056569, 0.0003260947156132632, 9.14872308955314e-06, 7.146262178219897e-05, 0.003134541032952301, 0.003243151068622122, 0.0004938814940087337, 0.003992241487741484, 0.05047765180527879, 5.48192537202422e-05, 0.007657881812867755, 0.003431376428035763, 0.007864720463294618, 0.01707446423407925, 0.0005133040719471362, 0.001302317045485735, 9.421103812965013e-06, 0.01854050630879726, 0.003352226876518583, 0.001321203489788831, 0.02396352042445499, 0.2161880206178467, 0.4616143052068635, 0.002619865029037861, 0.06721741272481974, 0.2526719537611555, 0.005971657734537447, 0.003541702916349505, 0.01307575723872694, 0.000836435869403401, 0.0005948867949737228, 0.000135446810055918, 0.0572682693731649, 0.001469880672495321, 0.0005680731700038486, 0.007581290205357887, 0.01925262761502234, 2.879898484263142e-05, 0.005683848502896345, 0.01036545509665985, 0.1485233324517072, 0.01399708767882932, 0.05239583873835423, 0.001396572918925218, 0.0002136299377520914, 0.003222760970790264, 0.04246078312386508, 0.01263009545520527, 0.03351320884998494, 4.455216555274879e-05, 0.220848822121721, 6.302640032649731e-06, 0.003410564480463807, 0.02026134807790796, 0.002205718131256128, 0.002386023101254252, 0.007195518762732099, 0.03657200021812555, 0.005121038957802429, 0.003096065262115961, 0.002192554475413347, 0.09756772112074018, 2.714760999993297e-05, 0.0004625719689592339, 0.0006574724543301372, 0.004842199937193064, 4.753812112263883e-06, 5.425076412366099e-07, 0.009747715040984947] 
   ],
  "analysis":0,
  "branch attributes":{
    "0":{
      "BABOON":{
-       "General descriptive":0.001859093275691098,
-       "MG94xREV with separate rates for branch sets":0.001728762656048212,
-       "Nucleotide GTR":0.001680040630127455,
-       "RELAX alternative":0.001429829115377586,
-       "RELAX null":0.00162000085935921,
-       "RELAX partitioned descriptive":0.001425818785563505,
-       "k (general descriptive)":0.09975999558426636,
+       "General descriptive":0.001859562666773025,
+       "MG94xREV with separate rates for branch sets":0.001729040005725717,
+       "Nucleotide GTR":0.001685167654714891,
+       "RELAX alternative":0.001434762988174167,
+       "RELAX null":0.001618077326700096,
+       "RELAX partitioned descriptive":0.001426437398554912,
+       "k (general descriptive)":0.09975760133237818,
        "original name":"BABOON"
       },
      "CAT":{
-       "General descriptive":0.3647017264253697,
-       "MG94xREV with separate rates for branch sets":0.276093367337407,
-       "Nucleotide GTR":0.2660909938917123,
-       "RELAX alternative":0.3756323856089179,
-       "RELAX null":0.3608767062015097,
-       "RELAX partitioned descriptive":0.3779196268605463,
-       "k (general descriptive)":2.315896411158361,
+       "General descriptive":0.3649705108927348,
+       "MG94xREV with separate rates for branch sets":0.2761191158060541,
+       "Nucleotide GTR":0.2660536011315811,
+       "RELAX alternative":0.3757111787573828,
+       "RELAX null":0.360767755751942,
+       "RELAX partitioned descriptive":0.3768226672635935,
+       "k (general descriptive)":2.322824217601444,
        "original name":"CAT"
       },
      "CHIMP":{
-       "General descriptive":0.001848668319765628,
-       "MG94xREV with separate rates for branch sets":0.001822931846626064,
-       "Nucleotide GTR":0.001818373670119325,
-       "RELAX alternative":0.00185493617203229,
-       "RELAX null":0.001854095610530333,
-       "RELAX partitioned descriptive":0.00185387819029751,
-       "k (general descriptive)":5.254528914257314,
+       "General descriptive":0.001848544328521468,
+       "MG94xREV with separate rates for branch sets":0.001822551054713939,
+       "Nucleotide GTR":0.001820258053351119,
+       "RELAX alternative":0.001854643673065862,
+       "RELAX null":0.00185572990722179,
+       "RELAX partitioned descriptive":0.001854201499317722,
+       "k (general descriptive)":5.263917013225917,
        "original name":"CHIMP"
       },
      "COW":{
-       "General descriptive":0.3732204271616263,
-       "MG94xREV with separate rates for branch sets":0.2488439658756959,
-       "Nucleotide GTR":0.2481025999892287,
-       "RELAX alternative":0.3383682965197552,
-       "RELAX null":0.3267413510264365,
-       "RELAX partitioned descriptive":0.3368059806284254,
-       "k (general descriptive)":2.844135916463983,
+       "General descriptive":0.3734992963367884,
+       "MG94xREV with separate rates for branch sets":0.248802707042435,
+       "Nucleotide GTR":0.2480198736772598,
+       "RELAX alternative":0.3379561449590825,
+       "RELAX null":0.3268684624461423,
+       "RELAX partitioned descriptive":0.336296078659758,
+       "k (general descriptive)":2.847745204182733,
        "original name":"COW"
       },
      "HORSE":{
-       "General descriptive":0.2802894874897226,
-       "MG94xREV with separate rates for branch sets":0.2115283499416638,
-       "Nucleotide GTR":0.2090310577070883,
-       "RELAX alternative":0.263552542851074,
-       "RELAX null":0.2568271402938284,
-       "RELAX partitioned descriptive":0.262017696350779,
-       "k (general descriptive)":1.928668982186118,
+       "General descriptive":0.2805104186424681,
+       "MG94xREV with separate rates for branch sets":0.2114983058912022,
+       "Nucleotide GTR":0.2090998951755368,
+       "RELAX alternative":0.2639982922145814,
+       "RELAX null":0.2570519477156736,
+       "RELAX partitioned descriptive":0.26200095593742,
+       "k (general descriptive)":1.930891329212253,
        "original name":"HORSE"
       },
      "HUMAN":{
@@ -64,101 +64,101 @@
        "RELAX alternative":0,
        "RELAX null":0,
        "RELAX partitioned descriptive":0,
-       "k (general descriptive)":1.458575021945062,
+       "k (general descriptive)":1.416548546052124,
        "original name":"HUMAN"
       },
      "MOUSE":{
-       "General descriptive":0.1308201891676921,
-       "MG94xREV with separate rates for branch sets":0.1193025698417779,
-       "Nucleotide GTR":0.1180171198334285,
-       "RELAX alternative":0.1517050531281043,
-       "RELAX null":0.1483289620283821,
-       "RELAX partitioned descriptive":0.1490164254890325,
-       "k (general descriptive)":0.4631708151770838,
+       "General descriptive":0.1308803878257961,
+       "MG94xREV with separate rates for branch sets":0.1192893635530923,
+       "Nucleotide GTR":0.1181058300538561,
+       "RELAX alternative":0.1516183081271659,
+       "RELAX null":0.1483567973872321,
+       "RELAX partitioned descriptive":0.1488950288407203,
+       "k (general descriptive)":0.4621316779775653,
        "original name":"MOUSE"
       },
      "Node1":{
-       "General descriptive":0.3501050632149825,
-       "MG94xREV with separate rates for branch sets":0.2890877742792198,
-       "Nucleotide GTR":0.2767237570684924,
-       "RELAX alternative":0.4255409853463661,
-       "RELAX null":0.4550463522153177,
-       "RELAX partitioned descriptive":0.4344852084340091,
-       "k (general descriptive)":0.4579130056597299
+       "General descriptive":0.3501143091462658,
+       "MG94xREV with separate rates for branch sets":0.2891531817656844,
+       "Nucleotide GTR":0.2767105173979571,
+       "RELAX alternative":0.420525835142383,
+       "RELAX null":0.4545405634998693,
+       "RELAX partitioned descriptive":0.4297776151561553,
+       "k (general descriptive)":0.4575702395890889
       },
      "Node12":{
-       "General descriptive":0.01766689355384354,
-       "MG94xREV with separate rates for branch sets":0.01757408524377322,
-       "Nucleotide GTR":0.01784803874223016,
-       "RELAX alternative":0.01676792601958491,
-       "RELAX null":0.01717214969820526,
-       "RELAX partitioned descriptive":0.01691268333643598,
-       "k (general descriptive)":0.124164332983979
+       "General descriptive":0.01766178787800134,
+       "MG94xREV with separate rates for branch sets":0.0175770110347634,
+       "Nucleotide GTR":0.01784222107494562,
+       "RELAX alternative":0.01626048141633729,
+       "RELAX null":0.01716868534229337,
+       "RELAX partitioned descriptive":0.01647240042293572,
+       "k (general descriptive)":0.124120594408151
       },
      "Node2":{
-       "General descriptive":0.0577170117416439,
-       "MG94xREV with separate rates for branch sets":0.06231584601001511,
-       "Nucleotide GTR":0.06613162123865737,
-       "RELAX alternative":0.0656020383942497,
-       "RELAX null":0.06749468776339668,
-       "RELAX partitioned descriptive":0.063727560710161,
-       "k (general descriptive)":0.5375515816350908
+       "General descriptive":0.05770266360624338,
+       "MG94xREV with separate rates for branch sets":0.06229443926236622,
+       "Nucleotide GTR":0.06614755778044307,
+       "RELAX alternative":0.06487498265124983,
+       "RELAX null":0.06743647945583151,
+       "RELAX partitioned descriptive":0.06330449773182804,
+       "k (general descriptive)":0.5360768532731082
       },
      "Node3":{
-       "General descriptive":0.1331109882486915,
-       "MG94xREV with separate rates for branch sets":0.1003158387194354,
-       "Nucleotide GTR":0.09886326330774685,
-       "RELAX alternative":0.1377575305960468,
-       "RELAX null":0.1387229575435225,
-       "RELAX partitioned descriptive":0.1370056132243871,
-       "k (general descriptive)":1.983651509686636
+       "General descriptive":0.1330256319960288,
+       "MG94xREV with separate rates for branch sets":0.1003154990002797,
+       "Nucleotide GTR":0.09883748387954429,
+       "RELAX alternative":0.1378173139909468,
+       "RELAX null":0.1387701954254672,
+       "RELAX partitioned descriptive":0.136719474302551,
+       "k (general descriptive)":1.981625732305646
       },
      "Node8":{
-       "General descriptive":0.1404566834691408,
-       "MG94xREV with separate rates for branch sets":0.1126868091796008,
-       "Nucleotide GTR":0.106239268140425,
-       "RELAX alternative":0.1456361998411515,
-       "RELAX null":0.1432141493320635,
-       "RELAX partitioned descriptive":0.1499980670367906,
-       "k (general descriptive)":2.210307133212389
+       "General descriptive":0.1404338383825282,
+       "MG94xREV with separate rates for branch sets":0.1127066220459272,
+       "Nucleotide GTR":0.1062201244057951,
+       "RELAX alternative":0.1439313895033506,
+       "RELAX null":0.14318831284655,
+       "RELAX partitioned descriptive":0.1481785335086442,
+       "k (general descriptive)":2.211998835217187
       },
      "Node9":{
-       "General descriptive":0.0266459915750866,
-       "MG94xREV with separate rates for branch sets":0.02627629459000785,
-       "Nucleotide GTR":0.02566573875750134,
-       "RELAX alternative":0.02987801750435297,
-       "RELAX null":0.02953491567444994,
-       "RELAX partitioned descriptive":0.02997035035825657,
-       "k (general descriptive)":0.07328040064262234
+       "General descriptive":0.02665501999328081,
+       "MG94xREV with separate rates for branch sets":0.02627402966233569,
+       "Nucleotide GTR":0.02567813733543303,
+       "RELAX alternative":0.02985671529404269,
+       "RELAX null":0.02953553824738531,
+       "RELAX partitioned descriptive":0.02996950192160838,
+       "k (general descriptive)":0.07343805012797726
       },
      "PIG":{
-       "General descriptive":0.2103978170052953,
-       "MG94xREV with separate rates for branch sets":0.1921267861604921,
-       "Nucleotide GTR":0.1871893456388788,
-       "RELAX alternative":0.2514899807955971,
-       "RELAX null":0.2481060168445591,
-       "RELAX partitioned descriptive":0.251294309938668,
-       "k (general descriptive)":1.57905583202459,
+       "General descriptive":0.2105401970679286,
+       "MG94xREV with separate rates for branch sets":0.1921302603267553,
+       "Nucleotide GTR":0.1871390433004313,
+       "RELAX alternative":0.2517917117490165,
+       "RELAX null":0.2483169436500481,
+       "RELAX partitioned descriptive":0.2506475053874151,
+       "k (general descriptive)":1.582105640200874,
        "original name":"PIG"
       },
      "RAT":{
-       "General descriptive":0.07161013387643886,
-       "MG94xREV with separate rates for branch sets":0.06830746072347418,
-       "Nucleotide GTR":0.06661283005976348,
-       "RELAX alternative":0.07293805936494982,
-       "RELAX null":0.07115038941652747,
-       "RELAX partitioned descriptive":0.07467247582140474,
-       "k (general descriptive)":1.319839560623237,
+       "General descriptive":0.07158272879959397,
+       "MG94xREV with separate rates for branch sets":0.06831927364558048,
+       "Nucleotide GTR":0.06661490534189227,
+       "RELAX alternative":0.07311180317129368,
+       "RELAX null":0.07112698282214641,
+       "RELAX partitioned descriptive":0.07451416024404128,
+       "k (general descriptive)":1.317928928374736,
        "original name":"RAT"
       },
      "RHMONKEY":{
-       "General descriptive":0.003674114425886965,
-       "MG94xREV with separate rates for branch sets":0.003753885794232333,
-       "Nucleotide GTR":0.003775170135617877,
-       "RELAX alternative":0.004180662465434332,
-       "RELAX null":0.003978610819466039,
-       "RELAX partitioned descriptive":0.004190519057865823,
-       "k (general descriptive)":5.183560186695944,
+       "General descriptive":0.003673715052669516,
+       "MG94xREV with separate rates for branch sets":0.003755247927570558,
+       "Nucleotide GTR":0.003778804730491441,
+       "RELAX alternative":0.004176749981889291,
+       "RELAX null":0.00397871921631754,
+       "RELAX partitioned descriptive":0.004188079354984015,
+       "k (general descriptive)":5.301456309232226,
        "original name":"RHMONKEY"
       }
     },
@@ -207,21 +207,21 @@
   },
  "fits":{
    "General descriptive":{
-     "AIC-c":6945.891070751259,
-     "Log Likelihood":-3420.486789501042,
+     "AIC-c":6945.886057024934,
+     "Log Likelihood":-3420.484282637879,
      "Rate Distributions":{
        "Shared":{
          "0":{
-           "omega":2.20271427504516e-18,
-           "proportion":0.00789425874100967
+           "omega":2.201373594751134e-18,
+           "proportion":0.5258178735075876
           },
          "1":{
-           "omega":2.20271427504516e-18,
-           "proportion":0.5381203586928067
+           "omega":2.201373594751134e-18,
+           "proportion":0.01992025780064184
           },
          "2":{
-           "omega":2.202714092571507,
-           "proportion":0.4539853825661836
+           "omega":2.201373412388544,
+           "proportion":0.4542618686917706
           }
         }
       },
@@ -229,7 +229,7 @@
      "estimated parameters":51
     },
    "MG94xREV with separate rates for branch sets":{
-     "AIC-c":6987.278662183248,
+     "AIC-c":6987.278076404838,
      "Equilibrium frequencies":      [
 [0.04876086397632926],
       [0.03982224127745371],
@@ -293,177 +293,177 @@
       [0.01417464125436193],
       [0.01189287130232129] 
       ],
-     "Log Likelihood":-3461.064480792223,
+     "Log Likelihood":-3461.064187903018,
      "Rate Distributions":{
        "non-synonymous/synonymous rate ratio for *Reference*":        [
-[1.240656122625563, 1] 
+[1.243401858007084, 1] 
         ],
        "non-synonymous/synonymous rate ratio for *Test*":        [
-[0.5611761689874598, 1] 
+[0.5612874934764923, 1] 
         ]
       },
      "display order":1,
      "estimated parameters":32
     },
    "Nucleotide GTR":{
-     "AIC-c":7112.857310169033,
+     "AIC-c":7112.857288723968,
      "Equilibrium frequencies":      [
 [0.3592490842490842],
       [0.181959706959707],
       [0.240018315018315],
       [0.2187728937728937] 
       ],
-     "Log Likelihood":-3532.32122446679,
+     "Log Likelihood":-3532.321213744258,
      "Rate Distributions":{
        "Substitution rate from nucleotide A to nucleotide C":0.5501644800943087,
        "Substitution rate from nucleotide A to nucleotide G":1,
-       "Substitution rate from nucleotide A to nucleotide T":0.2647746107611847,
-       "Substitution rate from nucleotide C to nucleotide G":0.4917423221832032,
-       "Substitution rate from nucleotide C to nucleotide T":1.02837595903795,
-       "Substitution rate from nucleotide G to nucleotide T":0.304509117524575
+       "Substitution rate from nucleotide A to nucleotide T":0.2646800222727828,
+       "Substitution rate from nucleotide C to nucleotide G":0.4918071762416347,
+       "Substitution rate from nucleotide C to nucleotide T":1.028675134787727,
+       "Substitution rate from nucleotide G to nucleotide T":0.3045013055839741
       },
      "display order":0,
      "estimated parameters":24
     },
    "RELAX alternative":{
-     "AIC-c":6901.392449196474,
-     "Log Likelihood":-3408.754211469135,
+     "AIC-c":6909.668413948684,
+     "Log Likelihood":-3408.69933855329,
      "Rate Distributions":{
        "Reference":{
          "0":{
            "omega":0,
-           "proportion":0.3814061972635792
+           "proportion":0.3825895192221547
           },
          "1":{
-           "omega":0.4330262245823013,
+           "omega":0.003503464580598538,
            "proportion":0
           },
          "2":{
-           "omega":2.405594515133199,
-           "proportion":0.6185938027364208
+           "omega":2.417572962231385,
+           "proportion":0.6174104807778453
           }
         },
        "Synonymous site-to-site rates":{
          "0":{
-           "proportion":0.2800901562602482,
-           "rate":0.2837970682663188
+           "proportion":0.2789425737851868,
+           "rate":0.2834765074731829
           },
          "1":{
-           "proportion":0.6272754947629234,
-           "rate":0.9947075941569237
+           "proportion":0.6311785441975573,
+           "rate":0.9970973177052372
           },
          "2":{
-           "proportion":0.09263434897682828,
-           "rate":3.20135608237551
+           "proportion":0.089878882017256,
+           "rate":3.244142488658602
           }
         },
        "Test":{
          "0":{
            "omega":0,
-           "proportion":0.3814061972635792
+           "proportion":0.3825895192221547
           },
          "1":{
-           "omega":0.9999750044281671,
+           "omega":0.9998114377116485,
            "proportion":0
           },
          "2":{
-           "omega":1.00002621592498,
-           "proportion":0.6185938027364208
+           "omega":1.000029443594731,
+           "proportion":0.6174104807778453
           }
         }
       },
      "display order":2,
-     "estimated parameters":41
+     "estimated parameters":45
     },
    "RELAX null":{
-     "AIC-c":6910.777215627525,
-     "Log Likelihood":-3414.491942969586,
+     "AIC-c":6919.152853316747,
+     "Log Likelihood":-3414.491495151524,
      "Rate Distributions":{
        "Reference":{
          "0":{
            "omega":0,
-           "proportion":0.04600287725570656
+           "proportion":0.3885051761591228
           },
          "1":{
-           "omega":0,
-           "proportion":0.3432466763494891
+           "omega":0.9958737025997172,
+           "proportion":0
           },
          "2":{
-           "omega":1.896477292815783,
-           "proportion":0.6107504463948045
+           "omega":1.887643080900262,
+           "proportion":0.6114948238408772
           }
         },
        "Synonymous site-to-site rates":{
          "0":{
-           "proportion":0.2641095265325168,
-           "rate":0.2744837794048847
+           "proportion":0.2642938080646302,
+           "rate":0.2741590488311177
           },
          "1":{
-           "proportion":0.6330324513232739,
-           "rate":0.9729462345446451
+           "proportion":0.633162055223991,
+           "rate":0.9728788992663913
           },
          "2":{
-           "proportion":0.1028580221442092,
-           "rate":3.029415427453047
+           "proportion":0.1025441367113787,
+           "rate":3.038218152856258
           }
         },
        "Test":{
          "0":{
            "omega":0,
-           "proportion":0.04600287725570656
+           "proportion":0.3885051761591228
           },
          "1":{
-           "omega":0,
-           "proportion":0.3432466763494891
+           "omega":0.9958737025997172,
+           "proportion":0
           },
          "2":{
-           "omega":1.896477292815783,
-           "proportion":0.6107504463948045
+           "omega":1.887643080900262,
+           "proportion":0.6114948238408772
           }
         }
       },
      "display order":3,
-     "estimated parameters":40
+     "estimated parameters":44
     },
    "RELAX partitioned descriptive":{
-     "AIC-c":6909.42794543134,
-     "Log Likelihood":-3408.579104294618,
+     "AIC-c":6917.810941882631,
+     "Log Likelihood":-3408.559317095162,
      "Rate Distributions":{
        "Reference":{
          "0":{
-           "omega":0.05035684771569529,
-           "proportion":0.3805224005150026
+           "omega":0.03550460650841439,
+           "proportion":0.354985198548996
           },
          "1":{
-           "omega":0.07013486723985318,
-           "proportion":0.003462124163764896
+           "omega":0.05439939847728128,
+           "proportion":0.02231130867735708
           },
          "2":{
-           "omega":2.344944921144001,
-           "proportion":0.6160154753212325
+           "omega":2.333762420535514,
+           "proportion":0.6227034927736469
           }
         },
        "Test":{
          "0":{
            "omega":0,
-           "proportion":0.03160127773820932
+           "proportion":0.3705590531463396
           },
          "1":{
            "omega":0,
-           "proportion":0.4079248249859382
+           "proportion":0.06265340406614885
           },
          "2":{
-           "omega":1.11269394570475,
-           "proportion":0.5604738972758525
+           "omega":1.08372848194659,
+           "proportion":0.5667875427875115
           }
         }
       },
      "display order":5,
-     "estimated parameters":45
+     "estimated parameters":49
     }
   },
  "input":{
-   "file name":"/tmp/tmpbauyxvdv/job_working_directory/000/5/working/./input.nex",
+   "file name":"/tmp/tmpkgsdjj1d/job_working_directory/000/5/working/./input.nex",
    "number of sequences":10,
    "number of sites":187,
    "partition count":1,
@@ -471,10 +471,11 @@
      "0":"((((PIG:0.147969,COW:0.21343)Node3:0.08509899999999999,HORSE:0.165787,CAT:0.264806)Node2:0.058611,((RHMONKEY:0.002015,BABOON:0.003108)Node9:0.022733,(HUMAN:0.004349,CHIMP:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,RAT:0.050958,MOUSE:0.09795)"
     }
   },
+ "runtime":"2.5.32",
  "test results":{
-   "LRT":11.47546300090198,
-   "p-value":0.0007052107640865835,
-   "relaxation or intensification parameter":2.986519568748539e-05
+   "LRT":11.58431319646934,
+   "p-value":0.0006651049394417186,
+   "relaxation or intensification parameter":3.335337302186161e-05
   },
  "tested":{
    "0":{
@@ -499,11 +500,11 @@
  "timers":{
    "General descriptive model fitting":{
      "order":2,
-     "timer":127
+     "timer":105
     },
    "Overall":{
      "order":0,
-     "timer":645
+     "timer":3013
     },
    "Preliminary model fitting":{
      "order":1,
@@ -511,15 +512,15 @@
     },
    "RELAX alternative model fitting":{
      "order":3,
-     "timer":178
+     "timer":1229
     },
    "RELAX null model fitting":{
      "order":4,
-     "timer":115
+     "timer":690
     },
    "RELAX partitioned descriptive":{
      "order":5,
-     "timer":216
+     "timer":980
     }
   }
 }
\ No newline at end of file
--- a/test-data/relax-out2-2.json	Sat Nov 27 11:25:19 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,3427 +0,0 @@
-#NEXUS
-
-BEGIN TAXA;
-	DIMENSIONS NTAX = 10;
-	TAXLABELS
-		'HUMAN' 'CHIMP' 'BABOON' 'RHMONKEY' 'COW' 'PIG' 'HORSE' 'CAT' 'MOUSE' 'RAT' ;
-END;
-
-BEGIN CHARACTERS;
-	DIMENSIONS NCHAR = 561;
-	FORMAT
-		DATATYPE = DNA
-		GAP=-
-		MISSING=?
-	;
-
-MATRIX
-	'HUMAN'    AAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
-	'CHIMP'    GAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
-	'BABOON'   AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAAATGGGAGAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAATTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
-	'RHMONKEY' AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAGATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAAYTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGRCCCCGAATTAAACCTGTATCAAGATGGGAAACATGTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
-	'COW'      ------------GAAAGCATTGTCGTCTGGGGTGCCCTGGATCATGACCTCAACCTGGACATTCCTGGTTTTCCAAGAAGTGATATAGTGGCAGATATAAAATGGAACAGA------AACAAAAACAAGATTGCACGAATAAAGAAAGATATGCCACTTCACAATGAAATGGACAAATATGATATGTTTACAAATGGAACTCTGAAAATTAAAACT---CTGATGAGAAACGATAGTGGTCTCTATGAGGTAGAGGTTTATGATTCAAATGGAGTAAACCTACTGAGCAAAAAATTTGATTTGAAGATTCAAGAGATGCTCTCAGGACCTGAAATTAACTGGATCTGTACCAACAGAACTGTGAGCTGCAAGGTAGAAAATGGAAGTAATCCTAAATTACAACTGTTTTTAAATACGACCCGTGTCAAACAAGATCATGGGAAGCTCATCACCTACACGTGGAACACCAGATGGAATAAAACATTCAAGTGCGTGGCGAGTAACCATGTCGATAGCAAAGTCAGCATAGAGATCGCCGTGTGTCCAGATGAAGGTCTGGAT
-	'PIG'      ---------------ACTGAGGTTGTCTGGGGCATCGTGGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATATACGATGGCAGAAG------AATGAAAACAAGATCGCAGAATTTAAAAAAAACAAAGAAACTCACCCTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGAT---CTGAAGAGAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGGAGAGAAAATTTGATTTGCCGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCTGTGCCGACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGTATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACACCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCATGGTGACCATCAGTTGTACGGGGCAAGGTCTGGAT
-	'HORSE'    ------------AAGAATATCACCATCTTGGGTGCCCTGGAACGTGATATCAACCTGGACATTCCTGCTTTTCAAATGAGTGAGCATGTAGAAGATATACAATGGAGCAAA------GGAAAAACCAAGATTGCAAAATTCAAAAATGGCAGTATGACTTTCCAGAAAGATAAAACATACGAGGTATTAAAAAATGGAACTCTGAAAATTAAACAT---CTGGAGAGAATTCATGAAGGTACCTACAAGGTAGACGCATATGATAGTGATGGAAAAAATGTGTTGGAGGAAACATTTCATTTGAGCCTTCTAGAGATGGTCTCAAAACCTAATATCTCCTGGAGCTGCACCAACACCACCCTGACCTGCGAGGTGACAAAAGGAACTGACTTTGAGTTAAAACTCTATCTAAATGGGAGAATGATCCAAAAAAGTCCTCGCAAAGTCATCGTATACAAGCGGGCCAGCAACCAAATTGCGTCCTTCAAGTGCACAGCCAATAACACAGTCAGCGAGGAAAGCAGCTCTGTGGTCATCAGGTGTACAGAGAAAGGTCTGGAT
-	'CAT'      ---------GCAAATGATGATATCGTCTGGGGTACCCTGGGTCAGGACATCAACCTGGACATTCCTGATTCTCAA---GGGATTAATATAGATGATATACACTGGGAAAAA------GGCAAGAAGAAGGTGGCGAGGTTCCAAATTAGCAACAAGCCTAAGAATCCAGATGAAAAATATAATGTGTCAATGAATGGAACTCTGAAAATTAAACAT---CTGATGCTAGAAGACTGCGATACCTACAAGGTTGTTATATACGATAAGGATGGAAAGAATGTGTTGGATAAAACATTTCAGCTGAAGATTCAAGAGAAGGTCTCAACGCCTAACATCGACTGGAATTGTATCAACAAAACCCTGGTCTGTAAGGTATCAAATGGAACAGACCCTGAATTAAAACTGTACGTAAATGGGACCAGTATCAAGCCCGTTTCTTCGAAGTTCAGCACATACAGGTTTATAAACAAGCAGAAGATATTAGTCAACTGCACGGCAGAAAACAAAGTCAGCAAGGAAAGCGACGTGAAGATGATCACTTGTTCAGAGAAGGGTCTGGAC
-	'MOUSE'    ---------AGAGACAATGAGACCATCTGGGGTGTCTTGGGTCATGGCATCACCCTGAACATCCCCAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGTAAGG------AGGGGCACCCTGGTCGCAGAGTTTAAAAGGAAGAAGCCACCTTTTTTGATATCAGAAACGTATGAGGTCTTAGCAAACGGATCCCTGAAGATAAAGAAGCCGATGATGAGAAACGACAGTGGCACCTATAATGTAATGGTGTATGGCACAAATGGGATGACTAGGCTGGAGAAGGACCTGGACGTGAGGATTCTGGAGAGGGTCTCAAAGCCCATGATCCACTGGGAATGCCCCAACACAACCCTGACCTGTGCGGTCTTGCAAGGGACAGATTTTGAACTGAAGCTGTATCAAGGGGAAACACTACTCAATAGTCTCCCCCAGAAGAACATGAGTTACCAGTGG---ACCAACCTGAACGCACCATTCAAGTGTGAGGCGATAAACCCGGTCAGCAAGGAGTCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCC
-	'RAT'      ---------AGAGACAGTGGGACCGTCTGGGGTGCCCTGGGTCATGGCATCAACCTGAACATCCCTAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGAGAGG------GGGAGCACCCTGGTTGCCGAGTTTAAAAGGAAGATGAAGCCTTTTTTGAAATCGGGAGCATTTGAGATCTTAGCAAATGGAGACTTGAAGATAAAGAAT---CTGACAAGAGATGACAGTGGCACCTATAATGTAACGGTATACAGCACAAATGGGACACGTATCCTGGACAAGGCACTGGACTTGAGGATTCTAGAGATGGTCTCAAAGCCGATGATCTACTGGGAGTGCAGCAACGCAACCCTGACCTGTGAGGTCTTGGAAGGAACAGATGTTGAACTAAAGCTGTACCAAGGAAAGGAGCATCTCAGGAGCCTCCGTCAGAAGACCATGAGTTACCAGTGG---ACCAACCTGAGAGCACCGTTTAAGTGCAAGGCGGTAAACAGGGTCAGCCAGGAGTCTGAGATGGAAGTTGTCAACTGTCCAGAGAAAGGTCTGCCC;
-END;
-
-BEGIN TREES;
-	TREE tree = ((((PIG:0.147969,COW:0.213430):0.085099,HORSE:0.165787,CAT:0.264806):0.058611,((RHMONKEY{PR}:0.002015,BABOON{PR}:0.003108){PR}:0.022733,(HUMAN{PR}:0.004349,CHIMP{PR}:0.000799){PR}:0.011873){PR}:0.101856){PR}:0.340802,RAT:0.050958,MOUSE:0.097950);
-END;
-
-BEGIN HYPHY;
-
-
-global relax._shared_srv.rv_gdd_weights_0=0.2800901562602482;
-relax._shared_srv.rv_gdd_weights_0:<1;
-global relax._shared_srv.rv_gdd_weights_1=0.8713250696842594;
-relax._shared_srv.rv_gdd_weights_1:<1;
-global relax._shared_srv.rv_gdd_rates_0=0.3376189995051599;
-global relax._shared_srv.rv_gdd_rates_1=1.183353248823191;
-global relax._shared_srv.rv_gdd_rates_2=3.808491201808699;
-global relax.reference.omega1=0;
-relax.reference.omega1:<1;
-global relax.reference.theta_AC=0.5020727351677378;
-global relax.reference.theta_AT=0.2075009146597777;
-global relax.reference.bsrel_mixture_aux_1=0;
-relax.reference.bsrel_mixture_aux_1:<1;
-global relax.reference.omega2=0.4330262245823013;
-relax.reference.omega2:<1;
-global relax.reference.omega3=2.405594515133199;
-relax.reference.omega3:>1;
-relax.reference.omega3:<10000000000;
-global relax.reference.theta_GT=0.2806046300455884;
-global relax.reference.theta_CG=0.4897252395553077;
-global relax.reference.theta_CT=1.086984235984869;
-global relax.reference.bsrel_mixture_aux_0=0.3814061972635792;
-relax.reference.bsrel_mixture_aux_0:<1;
-global relax.K=4.975000000000001;
-relax.K:<50;
-global relax._shared_srv.rv_gdd_norm:=relax._shared_srv.rv_gdd_rates_0*relax._shared_srv.rv_gdd_weights_0+relax._shared_srv.rv_gdd_rates_1*(1-relax._shared_srv.rv_gdd_weights_0)*relax._shared_srv.rv_gdd_weights_1+relax._shared_srv.rv_gdd_rates_2*(1-relax._shared_srv.rv_gdd_weights_0)*(1-relax._shared_srv.rv_gdd_weights_1);
-global relax.reference.theta_AG:=1;
-global relax.test.bsrel_mixture_aux_0:=relax.reference.bsrel_mixture_aux_0;
-relax.test.bsrel_mixture_aux_0:<1;
-global relax.test.omega1:=relax.reference.omega1^relax.K;
-relax.test.omega1:<1;
-global relax.test.theta_AC:=relax.reference.theta_AC;
-global relax.test.theta_AG:=1;
-global relax.test.theta_AT:=relax.reference.theta_AT;
-global relax.test.theta_CG:=relax.reference.theta_CG;
-global relax.test.theta_CT:=relax.reference.theta_CT;
-global relax.test.theta_GT:=relax.reference.theta_GT;
-global relax.test.bsrel_mixture_aux_1:=relax.reference.bsrel_mixture_aux_1;
-relax.test.bsrel_mixture_aux_1:<1;
-global relax.test.omega2:=relax.reference.omega2^relax.K;
-relax.test.omega2:<1;
-global relax.test.omega3:=relax.reference.omega3^relax.K;
-relax.test.omega3:>1;
-relax.test.omega3:<10000000000;
-
-relax._shared_srv.rv_gdd.weights={1,3};
-relax._shared_srv.rv_gdd.weights[0][0]:=1*relax._shared_srv.rv_gdd_weights_0;
-relax._shared_srv.rv_gdd.weights[0][1]:=1*(1-relax._shared_srv.rv_gdd_weights_0)*relax._shared_srv.rv_gdd_weights_1;
-relax._shared_srv.rv_gdd.weights[0][2]:=1*(1-relax._shared_srv.rv_gdd_weights_0)*(1-relax._shared_srv.rv_gdd_weights_1);
-
-
-relax._shared_srv.rv_gdd.points={1,3};
-relax._shared_srv.rv_gdd.points[0][0]:=relax._shared_srv.rv_gdd_rates_0/relax._shared_srv.rv_gdd_norm;
-relax._shared_srv.rv_gdd.points[0][1]:=relax._shared_srv.rv_gdd_rates_1/relax._shared_srv.rv_gdd_norm;
-relax._shared_srv.rv_gdd.points[0][2]:=relax._shared_srv.rv_gdd_rates_2/relax._shared_srv.rv_gdd_norm;
-
-
-category relax._shared_srv.rv_gdd=(3,relax._shared_srv.rv_gdd.weights,MEAN,,relax._shared_srv.rv_gdd.points,0,1,);
-
-relax.reference_Q_component_1={61,61};
-relax.reference_Q_component_1[0][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[0][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[0][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[0][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[0][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[0][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[0][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[0][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[1][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[1][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[1][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[1][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[1][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[1][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[1][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[1][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[1][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[2][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[2][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[2][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[2][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[2][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[2][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[2][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[2][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[3][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[3][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[3][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[3][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[3][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[3][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[3][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[3][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[3][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[4][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[4][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[4][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[4][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[4][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[4][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[4][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[4][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[4][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[5][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[5][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[5][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[5][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[5][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[5][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[5][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[5][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[5][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[6][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[6][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[6][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[6][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[6][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[6][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[6][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[6][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[6][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[7][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[7][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[7][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[7][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[7][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[7][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[7][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[7][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[7][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[8][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[8][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[8][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[8][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[8][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[8][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[8][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[8][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[9][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[9][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[9][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[9][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[9][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[9][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[9][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[9][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[9][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[10][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[10][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[10][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[10][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[10][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[10][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[10][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[10][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[10][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[11][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[11][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[11][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[11][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[11][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[11][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[11][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[11][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[11][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[12][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[12][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[12][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[12][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[12][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[12][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[12][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[12][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[12][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[13][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[13][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[13][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[13][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[13][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[13][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[13][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[13][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[13][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[14][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[14][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[14][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[14][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[14][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[14][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[14][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[14][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[14][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[15][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[15][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[15][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[15][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[15][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[15][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[15][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[15][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[15][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[16][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[16][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[16][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[16][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[16][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[16][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[16][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[16][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[17][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[17][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[17][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[17][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[17][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[17][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[17][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[17][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[17][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[18][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[18][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[18][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[18][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[18][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[18][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[18][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[18][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[19][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[19][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[19][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[19][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[19][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[19][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[19][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[19][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[19][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[20][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[20][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[20][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[20][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[20][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[20][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[20][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[20][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[20][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[21][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[21][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[21][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[21][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[21][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[21][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[21][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[21][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[21][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[22][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[22][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[22][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[22][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[22][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[22][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[22][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[22][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[22][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[23][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[23][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[23][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[23][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[23][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[23][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[23][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[23][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[23][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[24][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[24][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[24][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[24][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[24][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[24][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[24][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[24][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[25][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[25][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[25][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[25][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[25][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[25][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[25][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[25][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[25][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[26][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[26][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[26][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[26][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[26][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[26][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[26][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[26][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[26][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[27][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[27][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[27][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[27][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[27][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[27][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[27][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[27][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[27][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[28][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[28][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[28][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[28][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[28][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[28][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[28][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[28][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[28][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[29][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[29][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[29][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[29][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[29][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[29][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[29][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[29][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[29][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[30][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[30][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[30][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[30][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[30][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[30][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[30][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[30][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[30][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[31][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[31][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[31][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[31][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[31][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[31][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[31][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[31][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[31][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[32][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[32][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[32][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[32][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[32][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[32][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[32][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[32][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[33][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[33][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[33][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[33][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[33][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[33][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[33][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[33][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[33][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[34][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[34][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[34][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[34][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[34][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[34][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[34][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[34][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[35][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[35][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[35][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[35][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[35][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[35][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[35][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[35][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[35][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[36][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[36][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[36][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[36][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[36][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[36][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[36][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[36][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[36][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[37][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[37][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[37][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[37][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[37][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[37][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[37][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[37][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[37][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[38][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[38][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[38][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[38][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[38][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[38][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[38][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[38][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[38][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[39][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[39][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[39][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[39][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[39][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[39][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[39][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[39][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[39][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[40][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[40][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[40][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[40][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[40][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[40][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[40][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[40][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[41][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[41][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[41][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[41][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[41][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[41][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[41][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[41][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[41][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[42][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[42][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[42][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[42][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[42][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[42][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[42][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[42][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[42][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[43][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[43][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[43][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[43][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[43][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[43][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[43][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[43][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[43][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[44][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[44][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[44][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[44][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[44][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[44][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[44][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[44][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[44][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[45][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[45][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[45][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[45][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[45][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[45][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[45][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[45][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[45][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[46][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[46][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[46][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[46][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[46][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[46][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[46][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[46][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[46][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[47][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[47][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[47][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[47][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[47][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[47][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[47][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[47][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[47][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[48][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[48][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[48][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[48][49]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[48][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[48][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[48][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[49][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[49][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[49][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[49][48]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[49][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[49][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[49][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[50][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[50][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[50][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[50][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[50][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[50][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[50][57]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[51][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[51][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[51][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[51][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[51][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_1[51][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[51][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[51][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[51][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[52][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[52][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[52][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[52][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[52][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_1[52][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[52][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[52][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[53][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[53][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[53][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[53][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[53][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_1[53][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[53][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_1[53][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[53][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[54][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[54][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[54][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[54][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[54][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[54][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[54][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[54][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[55][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[55][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[55][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[55][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[55][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[55][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[55][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[56][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[56][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[56][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[56][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
-relax.reference_Q_component_1[56][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[56][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[56][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[56][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[57][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[57][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[57][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[57][50]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[57][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[57][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[57][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[58][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[58][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[58][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[58][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[58][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[58][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[58][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
-relax.reference_Q_component_1[58][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[58][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[59][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[59][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[59][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[59][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[59][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[59][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_1[59][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
-relax.reference_Q_component_1[59][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[60][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[60][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[60][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[60][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[60][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
-relax.reference_Q_component_1[60][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-relax.reference_Q_component_1[60][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
-relax.reference_Q_component_1[60][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_1[60][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
-
-
-relax.reference_Q_component_2={61,61};
-relax.reference_Q_component_2[0][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[0][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[0][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[0][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[0][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[0][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[0][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[0][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[1][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[1][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[1][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[1][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[1][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[1][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[1][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[1][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[1][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[2][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[2][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[2][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[2][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[2][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[2][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[2][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[2][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[3][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[3][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[3][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[3][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[3][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[3][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[3][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[3][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[3][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[4][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[4][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[4][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[4][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[4][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[4][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[4][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[4][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[4][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[5][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[5][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[5][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[5][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[5][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[5][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[5][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[5][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[5][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[6][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[6][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[6][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[6][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[6][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[6][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[6][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[6][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[6][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[7][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[7][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[7][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[7][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[7][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[7][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[7][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[7][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[7][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[8][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[8][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[8][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[8][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[8][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[8][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[8][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[8][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[9][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[9][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[9][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[9][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[9][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[9][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[9][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[9][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[9][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[10][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[10][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[10][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[10][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[10][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[10][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[10][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[10][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[10][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[11][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[11][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[11][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[11][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[11][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[11][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[11][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[11][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[11][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[12][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[12][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[12][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[12][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[12][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[12][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[12][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[12][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[12][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[13][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[13][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[13][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[13][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[13][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[13][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[13][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[13][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[13][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[14][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[14][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[14][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[14][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[14][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[14][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[14][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[14][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[14][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[15][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[15][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[15][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[15][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[15][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[15][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[15][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[15][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[15][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[16][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[16][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[16][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[16][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[16][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[16][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[16][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[16][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[17][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[17][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[17][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[17][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[17][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[17][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[17][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[17][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[17][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[18][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[18][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[18][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[18][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[18][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[18][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[18][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[18][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[19][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[19][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[19][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[19][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[19][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[19][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[19][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[19][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[19][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[20][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[20][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[20][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[20][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[20][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[20][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[20][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[20][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[20][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[21][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[21][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[21][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[21][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[21][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[21][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[21][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[21][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[21][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[22][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[22][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[22][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[22][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[22][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[22][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[22][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[22][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[22][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[23][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[23][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[23][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[23][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[23][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[23][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[23][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[23][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[23][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[24][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[24][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[24][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[24][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[24][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[24][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[24][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[24][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[25][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[25][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[25][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[25][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[25][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[25][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[25][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[25][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[25][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[26][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[26][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[26][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[26][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[26][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[26][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[26][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[26][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[26][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[27][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[27][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[27][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[27][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[27][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[27][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[27][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[27][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[27][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[28][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[28][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[28][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[28][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[28][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[28][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[28][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[28][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[28][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[29][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[29][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[29][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[29][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[29][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[29][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[29][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[29][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[29][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[30][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[30][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[30][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[30][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[30][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[30][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[30][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[30][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[30][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[31][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[31][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[31][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[31][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[31][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[31][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[31][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[31][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[31][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[32][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[32][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[32][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[32][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[32][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[32][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[32][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[32][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[33][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[33][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[33][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[33][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[33][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[33][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[33][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[33][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[33][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[34][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[34][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[34][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[34][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[34][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[34][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[34][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[34][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[35][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[35][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[35][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[35][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[35][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[35][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[35][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[35][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[35][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[36][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[36][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[36][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[36][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[36][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[36][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[36][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[36][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[36][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[37][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[37][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[37][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[37][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[37][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[37][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[37][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[37][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[37][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[38][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[38][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[38][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[38][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[38][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[38][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[38][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[38][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[38][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[39][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[39][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[39][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[39][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[39][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[39][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[39][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[39][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[39][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[40][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[40][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[40][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[40][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[40][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[40][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[40][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[40][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[41][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[41][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[41][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[41][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[41][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[41][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[41][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[41][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[41][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[42][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[42][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[42][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[42][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[42][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[42][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[42][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[42][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[42][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[43][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[43][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[43][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[43][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[43][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[43][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[43][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[43][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[43][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[44][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[44][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[44][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[44][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[44][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[44][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[44][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[44][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[44][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[45][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[45][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[45][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[45][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[45][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[45][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[45][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[45][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[45][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[46][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[46][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[46][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[46][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[46][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[46][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[46][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[46][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[46][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[47][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[47][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[47][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[47][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[47][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[47][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[47][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[47][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[47][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[48][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[48][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[48][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[48][49]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[48][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[48][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[48][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[49][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[49][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[49][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[49][48]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[49][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[49][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[49][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[50][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[50][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[50][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[50][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[50][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[50][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[50][57]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[51][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[51][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[51][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[51][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[51][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_2[51][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[51][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[51][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[51][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[52][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[52][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[52][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[52][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[52][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_2[52][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[52][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[52][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[53][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[53][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[53][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[53][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[53][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_2[53][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[53][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_2[53][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[53][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[54][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[54][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[54][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[54][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[54][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[54][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[54][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[54][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[55][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[55][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[55][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[55][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[55][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[55][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[55][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[56][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[56][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[56][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[56][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
-relax.reference_Q_component_2[56][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[56][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[56][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[56][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[57][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[57][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[57][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[57][50]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[57][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[57][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[57][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[58][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[58][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[58][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[58][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[58][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[58][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[58][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
-relax.reference_Q_component_2[58][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[58][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[59][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[59][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[59][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[59][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[59][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[59][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_2[59][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
-relax.reference_Q_component_2[59][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[60][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[60][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[60][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[60][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[60][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
-relax.reference_Q_component_2[60][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-relax.reference_Q_component_2[60][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
-relax.reference_Q_component_2[60][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_2[60][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
-
-
-relax.reference_Q_component_3={61,61};
-relax.reference_Q_component_3[0][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[0][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[0][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[0][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[0][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[0][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[0][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[0][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[1][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[1][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[1][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[1][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[1][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[1][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[1][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[1][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[1][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[2][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[2][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[2][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[2][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[2][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[2][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[2][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[2][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[3][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[3][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[3][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[3][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[3][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[3][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[3][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[3][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[3][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[4][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[4][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[4][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[4][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[4][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[4][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[4][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[4][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[4][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[5][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[5][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[5][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[5][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[5][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[5][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[5][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[5][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[5][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[6][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[6][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[6][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[6][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[6][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[6][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[6][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[6][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[6][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[7][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[7][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[7][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[7][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[7][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[7][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[7][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[7][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[7][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[8][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[8][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[8][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[8][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[8][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[8][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[8][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[8][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[9][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[9][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[9][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[9][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[9][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[9][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[9][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[9][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[9][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[10][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[10][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[10][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[10][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[10][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[10][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[10][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[10][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[10][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[11][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[11][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[11][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[11][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[11][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[11][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[11][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[11][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[11][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[12][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[12][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[12][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[12][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[12][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[12][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[12][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[12][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[12][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[13][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[13][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[13][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[13][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[13][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[13][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[13][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[13][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[13][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[14][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[14][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[14][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[14][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[14][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[14][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[14][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[14][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[14][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[15][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[15][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[15][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[15][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[15][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[15][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[15][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[15][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[15][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[16][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[16][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[16][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[16][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[16][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[16][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[16][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[16][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[17][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[17][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[17][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[17][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[17][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[17][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[17][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[17][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[17][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[18][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[18][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[18][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[18][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[18][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[18][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[18][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[18][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[19][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[19][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[19][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[19][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[19][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[19][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[19][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[19][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[19][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[20][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[20][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[20][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[20][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[20][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[20][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[20][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[20][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[20][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[21][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[21][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[21][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[21][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[21][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[21][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[21][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[21][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[21][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[22][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[22][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[22][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[22][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[22][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[22][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[22][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[22][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[22][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[23][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[23][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[23][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[23][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[23][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[23][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[23][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[23][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[23][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[24][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[24][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[24][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[24][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[24][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[24][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[24][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[24][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[25][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[25][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[25][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[25][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[25][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[25][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[25][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[25][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[25][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[26][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[26][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[26][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[26][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[26][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[26][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[26][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[26][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[26][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[27][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[27][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[27][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[27][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[27][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[27][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[27][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[27][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[27][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[28][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[28][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[28][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[28][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[28][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[28][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[28][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[28][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[28][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[29][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[29][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[29][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[29][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[29][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[29][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[29][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[29][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[29][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[30][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[30][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[30][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[30][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[30][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[30][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[30][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[30][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[30][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[31][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[31][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[31][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[31][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[31][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[31][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[31][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[31][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[31][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[32][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[32][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[32][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[32][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[32][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[32][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[32][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[32][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[33][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[33][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[33][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[33][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[33][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[33][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[33][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[33][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[33][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[34][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[34][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[34][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[34][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[34][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[34][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[34][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[34][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[35][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[35][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[35][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[35][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[35][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[35][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[35][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[35][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[35][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[36][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[36][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[36][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[36][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[36][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[36][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[36][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[36][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[36][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[37][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[37][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[37][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[37][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[37][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[37][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[37][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[37][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[37][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[38][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[38][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[38][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[38][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[38][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[38][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[38][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[38][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[38][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[39][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[39][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[39][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[39][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[39][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[39][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[39][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[39][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[39][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[40][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[40][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[40][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[40][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[40][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[40][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[40][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[40][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[41][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[41][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[41][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[41][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[41][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[41][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[41][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[41][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[41][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[42][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[42][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[42][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[42][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[42][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[42][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[42][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[42][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[42][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[43][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[43][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[43][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[43][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[43][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[43][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[43][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[43][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[43][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[44][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[44][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[44][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[44][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[44][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[44][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[44][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[44][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[44][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[45][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[45][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[45][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[45][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[45][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[45][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[45][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[45][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[45][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[46][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[46][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[46][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[46][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[46][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[46][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[46][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[46][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[46][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[47][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[47][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[47][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[47][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[47][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[47][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[47][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[47][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[47][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[48][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[48][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[48][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[48][49]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[48][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[48][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[48][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[49][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[49][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[49][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[49][48]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[49][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[49][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[49][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[50][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[50][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[50][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[50][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[50][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[50][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[50][57]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[51][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[51][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[51][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[51][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[51][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
-relax.reference_Q_component_3[51][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[51][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[51][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[51][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[52][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[52][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[52][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[52][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[52][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
-relax.reference_Q_component_3[52][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[52][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[52][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[53][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[53][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[53][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[53][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[53][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
-relax.reference_Q_component_3[53][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[53][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
-relax.reference_Q_component_3[53][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[53][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[54][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[54][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[54][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[54][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[54][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[54][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[54][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[54][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[55][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[55][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[55][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[55][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[55][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[55][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[55][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[56][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[56][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[56][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[56][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
-relax.reference_Q_component_3[56][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[56][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[56][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[56][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[57][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[57][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[57][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[57][50]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[57][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[57][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[57][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[58][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[58][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[58][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[58][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[58][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[58][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[58][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
-relax.reference_Q_component_3[58][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[58][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[59][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[59][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[59][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[59][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[59][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[59][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
-relax.reference_Q_component_3[59][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
-relax.reference_Q_component_3[59][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[60][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[60][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[60][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[60][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[60][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
-relax.reference_Q_component_3[60][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-relax.reference_Q_component_3[60][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
-relax.reference_Q_component_3[60][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
-relax.reference_Q_component_3[60][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
-
-
-relax.reference_pi={
-{0.04876086397632926} 
-{0.03982224127745371} 
-{0.0494959405650269} 
-{0.04152830682371345} 
-{0.01810345074594235} 
-{0.01478480742075003} 
-{0.01837636270304883} 
-{0.01541821854326533} 
-{0.01892910005547028} 
-{0.01545910240515689} 
-{0.01921445878706794} 
-{0.01612140169177368} 
-{0.02829747763884322} 
-{0.02311011106415996} 
-{0.02872406592369408} 
-{0.02410019507229243} 
-{0.01663805943190806} 
-{0.01358804506433061} 
-{0.01688888041768248} 
-{0.01417018446135155} 
-{0.006177213955434187} 
-{0.005044834822351987} 
-{0.006270336287397383} 
-{0.00526096577332031} 
-{0.006458939937330408} 
-{0.005274916061901906} 
-{0.006556309326397028} 
-{0.005500904159606446} 
-{0.009655594186286731} 
-{0.007885574003572761} 
-{0.009801153568494354} 
-{0.008223407979974132} 
-{0.03327785448210915} 
-{0.02717750758119989} 
-{0.03377952261833742} 
-{0.02834184710178207} 
-{0.01235507229404208} 
-{0.01009019590244688} 
-{0.01254132667213156} 
-{0.01052248035033209} 
-{0.01291855364640413} 
-{0.01055038238273567} 
-{0.01311330258173711} 
-{0.01100238215235291} 
-{0.01931219560697892} 
-{0.0157719705998612} 
-{0.01960332955558842} 
-{0.01644767379420349} 
-{0.01965132601881859} 
-{0.02049322866376102} 
-{0.008933621043463411} 
-{0.007295949736387736} 
-{0.009068296583349953} 
-{0.007608523013862737} 
-{0.007628698224327205} 
-{0.009481877006094248} 
-{0.00795552712159237} 
-{0.01396413011303752} 
-{0.01140428846505027} 
-{0.01417464125436193} 
-{0.01189287130232129} 
-};
-Model relax.reference=('Exp(relax.reference_Q_component_1)*1*relax.reference.bsrel_mixture_aux_0+Exp(relax.reference_Q_component_2)*1*(1-relax.reference.bsrel_mixture_aux_0)*relax.reference.bsrel_mixture_aux_1+Exp(relax.reference_Q_component_3)*1*(1-relax.reference.bsrel_mixture_aux_0)*(1-relax.reference.bsrel_mixture_aux_1)',relax.reference_pi,EXPLICIT_FORM_MATRIX_EXPONENTIAL);
-
-relax.test_Q_component_1={61,61};
-relax.test_Q_component_1[0][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[0][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[0][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[0][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[0][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[0][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[0][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[0][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[1][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[1][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[1][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[1][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[1][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[1][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[1][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[1][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[1][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[2][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[2][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[2][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[2][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[2][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[2][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[2][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[2][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[3][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[3][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[3][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[3][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[3][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[3][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[3][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[3][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[3][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[4][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[4][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[4][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[4][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[4][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[4][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[4][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[4][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[4][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[5][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[5][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[5][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[5][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[5][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[5][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[5][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[5][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[5][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[6][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[6][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[6][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[6][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[6][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[6][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[6][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[6][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[6][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[7][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[7][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[7][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[7][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[7][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[7][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[7][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[7][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[7][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[8][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[8][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[8][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[8][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[8][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[8][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[8][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[8][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[9][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[9][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[9][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[9][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[9][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[9][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[9][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[9][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[9][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[10][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[10][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[10][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[10][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[10][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[10][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[10][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[10][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[10][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[11][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[11][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[11][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[11][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[11][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[11][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[11][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[11][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[11][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[12][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[12][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[12][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[12][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[12][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[12][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[12][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[12][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[12][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[13][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[13][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[13][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[13][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[13][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[13][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[13][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[13][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[13][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[14][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[14][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[14][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[14][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[14][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[14][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[14][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[14][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[14][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[15][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[15][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[15][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[15][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[15][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[15][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[15][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[15][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[15][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[16][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[16][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[16][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[16][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[16][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[16][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[16][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[16][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[17][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[17][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[17][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[17][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[17][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[17][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[17][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[17][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[17][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[18][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[18][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[18][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[18][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[18][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[18][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[18][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[18][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[19][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[19][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[19][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[19][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[19][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[19][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[19][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[19][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[19][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[20][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[20][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[20][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[20][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[20][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[20][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[20][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[20][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[20][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[21][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[21][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[21][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[21][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[21][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[21][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[21][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[21][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[21][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[22][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[22][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[22][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[22][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[22][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[22][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[22][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[22][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[22][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[23][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[23][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[23][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[23][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[23][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[23][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[23][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[23][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[23][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[24][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[24][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[24][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[24][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[24][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[24][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[24][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[24][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[25][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[25][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[25][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[25][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[25][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[25][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[25][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[25][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[25][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[26][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[26][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[26][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[26][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[26][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[26][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[26][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[26][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[26][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[27][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[27][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[27][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[27][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[27][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[27][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[27][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[27][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[27][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[28][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[28][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[28][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[28][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[28][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[28][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[28][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[28][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[28][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[29][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[29][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[29][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[29][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[29][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[29][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[29][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[29][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[29][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[30][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[30][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[30][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[30][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[30][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[30][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[30][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[30][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[30][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[31][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[31][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[31][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[31][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[31][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[31][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[31][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[31][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[31][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[32][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[32][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[32][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[32][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[32][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[32][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[32][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[32][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[33][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[33][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[33][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[33][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[33][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[33][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[33][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[33][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[33][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[34][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[34][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[34][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[34][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[34][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[34][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[34][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[34][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[35][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[35][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[35][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[35][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[35][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[35][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[35][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[35][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[35][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[36][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[36][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[36][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[36][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[36][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[36][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[36][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[36][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[36][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[37][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[37][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[37][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[37][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[37][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[37][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[37][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[37][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[37][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[38][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[38][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[38][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[38][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[38][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[38][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[38][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[38][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[38][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[39][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[39][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[39][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[39][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[39][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[39][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[39][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[39][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[39][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[40][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[40][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[40][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[40][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[40][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[40][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[40][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[40][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[41][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[41][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[41][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[41][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[41][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[41][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[41][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[41][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[41][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[42][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[42][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[42][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[42][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[42][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[42][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[42][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[42][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[42][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[43][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[43][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[43][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[43][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[43][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[43][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[43][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[43][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[43][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[44][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[44][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[44][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[44][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[44][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[44][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[44][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[44][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[44][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[45][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[45][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[45][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[45][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[45][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[45][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[45][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[45][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[45][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[46][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[46][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[46][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[46][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[46][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[46][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[46][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[46][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[46][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[47][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[47][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[47][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[47][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[47][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[47][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[47][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[47][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[47][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[48][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[48][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[48][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[48][49]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[48][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[48][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[48][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[49][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[49][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[49][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[49][48]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[49][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[49][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[49][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[50][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[50][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[50][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[50][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[50][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[50][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[50][57]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[51][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[51][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[51][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[51][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[51][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_1[51][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[51][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[51][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[51][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[52][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[52][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[52][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[52][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[52][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_1[52][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[52][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[52][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[53][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[53][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[53][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[53][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[53][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_1[53][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[53][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_1[53][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[53][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[54][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[54][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[54][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[54][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[54][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[54][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[54][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[54][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[55][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[55][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[55][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[55][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[55][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[55][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[55][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[56][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[56][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[56][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[56][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AG;
-relax.test_Q_component_1[56][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[56][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[56][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[56][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[57][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[57][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[57][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[57][50]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[57][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[57][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[57][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[58][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[58][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[58][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[58][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[58][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[58][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[58][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AC;
-relax.test_Q_component_1[58][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[58][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[59][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[59][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[59][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[59][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[59][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[59][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_1[59][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CG;
-relax.test_Q_component_1[59][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[60][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[60][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[60][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[60][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[60][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_CT;
-relax.test_Q_component_1[60][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-relax.test_Q_component_1[60][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_AT;
-relax.test_Q_component_1[60][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_1[60][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.omega1*relax.test.theta_GT;
-
-
-relax.test_Q_component_2={61,61};
-relax.test_Q_component_2[0][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[0][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[0][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[0][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[0][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[0][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[0][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[0][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[1][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[1][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[1][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[1][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[1][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[1][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[1][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[1][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[1][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[2][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[2][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[2][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[2][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[2][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[2][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[2][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[2][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[3][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[3][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[3][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[3][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[3][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[3][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[3][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[3][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[3][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[4][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[4][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[4][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[4][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[4][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[4][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[4][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[4][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[4][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[5][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[5][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[5][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[5][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[5][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[5][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[5][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[5][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[5][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[6][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[6][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[6][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[6][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[6][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[6][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[6][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[6][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[6][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[7][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[7][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[7][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[7][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[7][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[7][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[7][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[7][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[7][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[8][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[8][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[8][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[8][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[8][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[8][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[8][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[8][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[9][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[9][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[9][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[9][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[9][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[9][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[9][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[9][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[9][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[10][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[10][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[10][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[10][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[10][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[10][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[10][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[10][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[10][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[11][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[11][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[11][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[11][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[11][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[11][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[11][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[11][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[11][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[12][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[12][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[12][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[12][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[12][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[12][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[12][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[12][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[12][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[13][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[13][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[13][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[13][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[13][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[13][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[13][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[13][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[13][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[14][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[14][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[14][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[14][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[14][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[14][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[14][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[14][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[14][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[15][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[15][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[15][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[15][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[15][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[15][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[15][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[15][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[15][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[16][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[16][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[16][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[16][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[16][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[16][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[16][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[16][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[17][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[17][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[17][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[17][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[17][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[17][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[17][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[17][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[17][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[18][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[18][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[18][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[18][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[18][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[18][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[18][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[18][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[19][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[19][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[19][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[19][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[19][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[19][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[19][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[19][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[19][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[20][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[20][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[20][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[20][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[20][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[20][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[20][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[20][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[20][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[21][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[21][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[21][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[21][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[21][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[21][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[21][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[21][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[21][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[22][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[22][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[22][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[22][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[22][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[22][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[22][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[22][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[22][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[23][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[23][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[23][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[23][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[23][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[23][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[23][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[23][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[23][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[24][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[24][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[24][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[24][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[24][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[24][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[24][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[24][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[25][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[25][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[25][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[25][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[25][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[25][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[25][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[25][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[25][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[26][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[26][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[26][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[26][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[26][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[26][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[26][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[26][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[26][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[27][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[27][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[27][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[27][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[27][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[27][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[27][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[27][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[27][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[28][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[28][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[28][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[28][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[28][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[28][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[28][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[28][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[28][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[29][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[29][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[29][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[29][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[29][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[29][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[29][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[29][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[29][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[30][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[30][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[30][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[30][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[30][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[30][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[30][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[30][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[30][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[31][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[31][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[31][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[31][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[31][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[31][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[31][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[31][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[31][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[32][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[32][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[32][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[32][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[32][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[32][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[32][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[32][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[33][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[33][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[33][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[33][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[33][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[33][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[33][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[33][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[33][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[34][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[34][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[34][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[34][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[34][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[34][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[34][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[34][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[35][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[35][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[35][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[35][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[35][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[35][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[35][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[35][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[35][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[36][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[36][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[36][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[36][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[36][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[36][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[36][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[36][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[36][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[37][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[37][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[37][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[37][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[37][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[37][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[37][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[37][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[37][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[38][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[38][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[38][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[38][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[38][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[38][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[38][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[38][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[38][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[39][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[39][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[39][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[39][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[39][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[39][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[39][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[39][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[39][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[40][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[40][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[40][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[40][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[40][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[40][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[40][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[40][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[41][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[41][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[41][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[41][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[41][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[41][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[41][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[41][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[41][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[42][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[42][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[42][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[42][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[42][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[42][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[42][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[42][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[42][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[43][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[43][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[43][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[43][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[43][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[43][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[43][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[43][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[43][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[44][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[44][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[44][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[44][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[44][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[44][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[44][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[44][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[44][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[45][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[45][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[45][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[45][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[45][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[45][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[45][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[45][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[45][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[46][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[46][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[46][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[46][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[46][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[46][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[46][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[46][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[46][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[47][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[47][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[47][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[47][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[47][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[47][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[47][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[47][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[47][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[48][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[48][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[48][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[48][49]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[48][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[48][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[48][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[49][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[49][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[49][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[49][48]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[49][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[49][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[49][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[50][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[50][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[50][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[50][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[50][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[50][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[50][57]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[51][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[51][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[51][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[51][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[51][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_2[51][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[51][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[51][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[51][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[52][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[52][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[52][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[52][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[52][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_2[52][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[52][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[52][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[53][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[53][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[53][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[53][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[53][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_2[53][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[53][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_2[53][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[53][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[54][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[54][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[54][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[54][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[54][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[54][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[54][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[54][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[55][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[55][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[55][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[55][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[55][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[55][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[55][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[56][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[56][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[56][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[56][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega2;
-relax.test_Q_component_2[56][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[56][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[56][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[56][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[57][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[57][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[57][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[57][50]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[57][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[57][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[57][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[58][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[58][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[58][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[58][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[58][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[58][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[58][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega2;
-relax.test_Q_component_2[58][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[58][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[59][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[59][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[59][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[59][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[59][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[59][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_2[59][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega2;
-relax.test_Q_component_2[59][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[60][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[60][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[60][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[60][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[60][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega2;
-relax.test_Q_component_2[60][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-relax.test_Q_component_2[60][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega2;
-relax.test_Q_component_2[60][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_2[60][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega2;
-
-
-relax.test_Q_component_3={61,61};
-relax.test_Q_component_3[0][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[0][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[0][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[0][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[0][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[0][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[0][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[0][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[1][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[1][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[1][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[1][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[1][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[1][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[1][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[1][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[1][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[2][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[2][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[2][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[2][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[2][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[2][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[2][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[2][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[3][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[3][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[3][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[3][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[3][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[3][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[3][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[3][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[3][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[4][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[4][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[4][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[4][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[4][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[4][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[4][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[4][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[4][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[5][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[5][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[5][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[5][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[5][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[5][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[5][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[5][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[5][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[6][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[6][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[6][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[6][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[6][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[6][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[6][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[6][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[6][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[7][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[7][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[7][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[7][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[7][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[7][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[7][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[7][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[7][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[8][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[8][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[8][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[8][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[8][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[8][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[8][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[8][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[9][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[9][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[9][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[9][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[9][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[9][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[9][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[9][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[9][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[10][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[10][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[10][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[10][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[10][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[10][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[10][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[10][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[10][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[11][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[11][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[11][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[11][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[11][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[11][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[11][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[11][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[11][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[12][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[12][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[12][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[12][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[12][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[12][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[12][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[12][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[12][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[13][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[13][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[13][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[13][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[13][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[13][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[13][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[13][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[13][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[14][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[14][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[14][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[14][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[14][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[14][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[14][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[14][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[14][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[15][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[15][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[15][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[15][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[15][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[15][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[15][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[15][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[15][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[16][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[16][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[16][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[16][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[16][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[16][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[16][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[16][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[17][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[17][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[17][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[17][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[17][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[17][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[17][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[17][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[17][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[18][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[18][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[18][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[18][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[18][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[18][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[18][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[18][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[19][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[19][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[19][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[19][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[19][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[19][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[19][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[19][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[19][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[20][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[20][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[20][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[20][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[20][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[20][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[20][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[20][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[20][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[21][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[21][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[21][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[21][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[21][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[21][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[21][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[21][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[21][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[22][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[22][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[22][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[22][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[22][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[22][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[22][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[22][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[22][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[23][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[23][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[23][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[23][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[23][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[23][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[23][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[23][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[23][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[24][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[24][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[24][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[24][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[24][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[24][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[24][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[24][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[25][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[25][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[25][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[25][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[25][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[25][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[25][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[25][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[25][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[26][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[26][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[26][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[26][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[26][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[26][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[26][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[26][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[26][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[27][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[27][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[27][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[27][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[27][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[27][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[27][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[27][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[27][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[28][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[28][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[28][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[28][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[28][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[28][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[28][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[28][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[28][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[29][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[29][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[29][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[29][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[29][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[29][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[29][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[29][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[29][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[30][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[30][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[30][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[30][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[30][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[30][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[30][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[30][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[30][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[31][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[31][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[31][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[31][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[31][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[31][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[31][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[31][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[31][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[32][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[32][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[32][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[32][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[32][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[32][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[32][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[32][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[33][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[33][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[33][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[33][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[33][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[33][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[33][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[33][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[33][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[34][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[34][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[34][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[34][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[34][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[34][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[34][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[34][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[35][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[35][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[35][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[35][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[35][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[35][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[35][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[35][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[35][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[36][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[36][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[36][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[36][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[36][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[36][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[36][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[36][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[36][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[37][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[37][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[37][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[37][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[37][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[37][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[37][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[37][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[37][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[38][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[38][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[38][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[38][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[38][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[38][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[38][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[38][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[38][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[39][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[39][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[39][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[39][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[39][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[39][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[39][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[39][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[39][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[40][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[40][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[40][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[40][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[40][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[40][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[40][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[40][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[41][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[41][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[41][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[41][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[41][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[41][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[41][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[41][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[41][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[42][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[42][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[42][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[42][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[42][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[42][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[42][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[42][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[42][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[43][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[43][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[43][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[43][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[43][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[43][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[43][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[43][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[43][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[44][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[44][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[44][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[44][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[44][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[44][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[44][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[44][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[44][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[45][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[45][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[45][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[45][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[45][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[45][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[45][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[45][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[45][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[46][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[46][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[46][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[46][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[46][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[46][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[46][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[46][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[46][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[47][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[47][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[47][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[47][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[47][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[47][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[47][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[47][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[47][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[48][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[48][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[48][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[48][49]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[48][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[48][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[48][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[49][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[49][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[49][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[49][48]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[49][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[49][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[49][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[50][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[50][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[50][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[50][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[50][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[50][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[50][57]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[51][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[51][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[51][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[51][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[51][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC;
-relax.test_Q_component_3[51][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[51][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[51][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[51][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[52][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[52][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[52][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[52][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[52][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG;
-relax.test_Q_component_3[52][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[52][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[52][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[53][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[53][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[53][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[53][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[53][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT;
-relax.test_Q_component_3[53][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[53][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT;
-relax.test_Q_component_3[53][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[53][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[54][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[54][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[54][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[54][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[54][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[54][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[54][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[54][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[55][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[55][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[55][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[55][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[55][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[55][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[55][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[56][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[56][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[56][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[56][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AG*relax.test.omega3;
-relax.test_Q_component_3[56][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[56][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[56][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[56][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[57][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[57][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[57][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[57][50]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[57][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[57][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[57][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[58][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[58][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[58][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[58][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[58][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[58][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[58][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AC*relax.test.omega3;
-relax.test_Q_component_3[58][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[58][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[59][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[59][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[59][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[59][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[59][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[59][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AG;
-relax.test_Q_component_3[59][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CG*relax.test.omega3;
-relax.test_Q_component_3[59][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[60][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[60][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[60][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[60][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[60][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.test.theta_CT*relax.test.omega3;
-relax.test_Q_component_3[60][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-relax.test_Q_component_3[60][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.test.theta_AT*relax.test.omega3;
-relax.test_Q_component_3[60][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.test.theta_CT;
-relax.test_Q_component_3[60][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.test.theta_GT*relax.test.omega3;
-
-
-relax.test_pi={
-{0.04876086397632926} 
-{0.03982224127745371} 
-{0.0494959405650269} 
-{0.04152830682371345} 
-{0.01810345074594235} 
-{0.01478480742075003} 
-{0.01837636270304883} 
-{0.01541821854326533} 
-{0.01892910005547028} 
-{0.01545910240515689} 
-{0.01921445878706794} 
-{0.01612140169177368} 
-{0.02829747763884322} 
-{0.02311011106415996} 
-{0.02872406592369408} 
-{0.02410019507229243} 
-{0.01663805943190806} 
-{0.01358804506433061} 
-{0.01688888041768248} 
-{0.01417018446135155} 
-{0.006177213955434187} 
-{0.005044834822351987} 
-{0.006270336287397383} 
-{0.00526096577332031} 
-{0.006458939937330408} 
-{0.005274916061901906} 
-{0.006556309326397028} 
-{0.005500904159606446} 
-{0.009655594186286731} 
-{0.007885574003572761} 
-{0.009801153568494354} 
-{0.008223407979974132} 
-{0.03327785448210915} 
-{0.02717750758119989} 
-{0.03377952261833742} 
-{0.02834184710178207} 
-{0.01235507229404208} 
-{0.01009019590244688} 
-{0.01254132667213156} 
-{0.01052248035033209} 
-{0.01291855364640413} 
-{0.01055038238273567} 
-{0.01311330258173711} 
-{0.01100238215235291} 
-{0.01931219560697892} 
-{0.0157719705998612} 
-{0.01960332955558842} 
-{0.01644767379420349} 
-{0.01965132601881859} 
-{0.02049322866376102} 
-{0.008933621043463411} 
-{0.007295949736387736} 
-{0.009068296583349953} 
-{0.007608523013862737} 
-{0.007628698224327205} 
-{0.009481877006094248} 
-{0.00795552712159237} 
-{0.01396413011303752} 
-{0.01140428846505027} 
-{0.01417464125436193} 
-{0.01189287130232129} 
-};
-Model relax.test=('Exp(relax.test_Q_component_1)*1*relax.test.bsrel_mixture_aux_0+Exp(relax.test_Q_component_2)*1*(1-relax.test.bsrel_mixture_aux_0)*relax.test.bsrel_mixture_aux_1+Exp(relax.test_Q_component_3)*1*(1-relax.test.bsrel_mixture_aux_0)*(1-relax.test.bsrel_mixture_aux_1)',relax.test_pi,EXPLICIT_FORM_MATRIX_EXPONENTIAL);
-TRY_NUMERIC_SEQUENCE_MATCH=0;
-ACCEPT_ROOTED_TREES=0;
-Tree O_SJmzEX.tree_id_0=((((PIG{relax.reference},COW{relax.reference})Node3{relax.reference},HORSE{relax.reference},CAT{relax.reference})Node2{relax.reference},((RHMONKEY{relax.test},BABOON{relax.test})Node9{relax.test},(HUMAN{relax.test},CHIMP{relax.test})Node12{relax.test})Node8{relax.test})Node1{relax.test},RAT{relax.reference},MOUSE{relax.reference});
-
-O_SJmzEX.tree_id_0.PIG.t=0.4536172365685577;
-O_SJmzEX.tree_id_0.COW.t=0.6103212983838633;
-O_SJmzEX.tree_id_0.Node3.t=0.2484758643179366;
-O_SJmzEX.tree_id_0.HORSE.t=0.4753747079725157;
-O_SJmzEX.tree_id_0.CAT.t=0.6775352409130856;
-O_SJmzEX.tree_id_0.Node2.t=0.1183276378467358;
-O_SJmzEX.tree_id_0.RHMONKEY.t=0.01420592464486799;
-O_SJmzEX.tree_id_0.BABOON.t=0.00485857082125907;
-O_SJmzEX.tree_id_0.Node9.t=0.1015257435189256;
-O_SJmzEX.tree_id_0.HUMAN.t=0;
-O_SJmzEX.tree_id_0.CHIMP.t=0.006303088015069631;
-O_SJmzEX.tree_id_0.Node12.t=0.05697754732758539;
-O_SJmzEX.tree_id_0.Node8.t=0.4948729770972781;
-O_SJmzEX.tree_id_0.Node1.t=1.445991686991002;
-O_SJmzEX.tree_id_0.RAT.t=0.1315597576696033;
-O_SJmzEX.tree_id_0.MOUSE.t=0.2736332745970835;SetParameter (DEFER_CONSTRAINT_APPLICATION, 1, 0);
-SetParameter (DEFER_CONSTRAINT_APPLICATION, 0, 0);
-
-DataSet relax.codon_data = ReadDataFile(USE_NEXUS_FILE_DATA);
-DataSetFilter relax.filter.default = CreateFilter(relax.codon_data,3,"0-560","5,4,6,7,3,2,0,1,9,8","TAA,TAG,TGA");
-ASSUME_REVERSIBLE_MODELS=1;
-USE_LAST_RESULTS=0;
-LikelihoodFunction O_SJmzEX.likelihoodFunction = (relax.filter.default,O_SJmzEX.tree_id_0);
-
-END;
\ No newline at end of file