Mercurial > repos > iuc > iqtree

comparison iqtree.xml @ 0:05ee0a74faef draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/iqtree/ commit 494efe4359ba046587dd2d5585464a3df05ba997
author iuc
date Wed, 15 Nov 2017 12:45:24 -0500
parents
children 288db50d1fb9
comparison
equal deleted inserted replaced
-1:000000000000 0:05ee0a74faef
1 <tool id="iqtree" name="IQ-TREE" version="1.5.5" >
2 <description>Phylogenomic / evolutionary tree construction from multiple sequences</description>
3 <requirements>
4 <requirement type="package" version="1.5.5">iqtree</requirement>
5 </requirements>
6 <command detect_errors='exit_code' ><![CDATA[
7 iqtree
8 -pre PREF
9 -nt AUTO
10 -redo
11
12 ## file
13 #if $general_options.s
14 -s '$general_options.s'
15 #end if
16
17 ## file
18 #if $general_options.t
19 -t '$general_options.t'
20 #end if
21
22 ## file
23 #if $general_options.te
24 -te '$general_options.te'
25 #end if
26
27 #if str($general_options.st) != ''
28 -st '$general_options.st'
29 #end if
30
31 #if str($general_options.seed) != ''
32 -seed '$general_options.seed'
33 #end if
34
35 $general_options.keep_ident
36 $general_options.safe
37
38 #if str($likelihood_mapping.lmap) != ''
39 -lmap '$likelihood_mapping.lmap'
40 #end if
41
42 ## file
43 #if $likelihood_mapping.lmclust
44 -lmclust '$likelihood_mapping.lmclust'
45 #end if
46
47 $likelihood_mapping.wql
48
49 #if str($modelling_parameters.automatic_model.cond_model.m) != ''
50 -m '$modelling_parameters.automatic_model.cond_model.m'
51 #end if
52
53 #if str($modelling_parameters.automatic_model.rcluster) != ''
54 -rcluster '$modelling_parameters.automatic_model.rcluster'
55 #end if
56
57 #if str($modelling_parameters.automatic_model.mset) != ''
58 -mset '$modelling_parameters.automatic_model.mset'
59 #end if
60
61 #if str($modelling_parameters.automatic_model.msub) != ''
62 -msub '$modelling_parameters.automatic_model.msub'
63 #end if
64
65 #if str($modelling_parameters.automatic_model.mfreq) != ''
66 -mfreq '$modelling_parameters.automatic_model.mfreq'
67 #end if
68
69 #if str($modelling_parameters.automatic_model.mrate) != ''
70 -mrate '$modelling_parameters.automatic_model.mrate'
71 #end if
72
73 #if str($modelling_parameters.automatic_model.cmin) != ''
74 -cmin '$modelling_parameters.automatic_model.cmin'
75 #end if
76
77 #if str($modelling_parameters.automatic_model.cmax) != ''
78 -cmax '$modelling_parameters.automatic_model.cmax'
79 #end if
80
81 #if str($modelling_parameters.automatic_model.merit) != ''
82 -merit '$modelling_parameters.automatic_model.merit'
83 #end if
84
85 $modelling_parameters.automatic_model.mtree
86
87 #if str($modelling_parameters.automatic_model.madd) != ''
88 -madd '$modelling_parameters.automatic_model.madd'
89 #end if
90
91 ## file
92 #if $modelling_parameters.automatic_model.mdef
93 -mdef '$modelling_parameters.automatic_model.mdef'
94 #end if
95
96 $modelling_parameters.specifying_substitution.mwopt
97
98 #if str($modelling_parameters.rate_heterogeneity.a) != ''
99 -a '$modelling_parameters.rate_heterogeneity.a'
100 #end if
101
102 $modelling_parameters.rate_heterogeneity.gmedian
103
104 #if str($modelling_parameters.rate_heterogeneity.i) != ''
105 -i '$modelling_parameters.rate_heterogeneity.i'
106 #end if
107
108 $modelling_parameters.rate_heterogeneity.opt_gamma_inv
109 $modelling_parameters.rate_heterogeneity.wsr
110
111 ## file
112 #if $modelling_parameters.partition_model.q
113 -q '$modelling_parameters.partition_model.q'
114 #end if
115
116 $modelling_parameters.partition_model.spp
117
118 ## file
119 #if $modelling_parameters.partition_model.sp
120 -sp '$modelling_parameters.partition_model.sp'
121 #end if
122
123 ## file
124 #if $modelling_parameters.site_specific_frequency.ft
125 -ft '$modelling_parameters.site_specific_frequency.ft'
126 #end if
127
128 #if str($modelling_parameters.site_specific_frequency.fs) != ''
129 -fs '$modelling_parameters.site_specific_frequency.fs'
130 #end if
131
132 $modelling_parameters.site_specific_frequency.fmax
133
134 #if str($tree_parameters.tree_search.ninit) != ''
135 -ninit '$tree_parameters.tree_search.ninit'
136 #end if
137
138 #if str($tree_parameters.tree_search.ntop) != ''
139 -ntop '$tree_parameters.tree_search.ntop'
140 #end if
141
142 #if str($tree_parameters.tree_search.nbest) != ''
143 -nbest '$tree_parameters.tree_search.nbest'
144 #end if
145
146 #if str($tree_parameters.tree_search.nstop) != ''
147 -nstop '$tree_parameters.tree_search.nstop'
148 #end if
149
150 #if str($tree_parameters.tree_search.n) != ''
151 -n '$tree_parameters.tree_search.n'
152 #end if
153
154 #if str($tree_parameters.tree_search.sprrad) != ''
155 -sprrad '$tree_parameters.tree_search.sprrad'
156 #end if
157
158 #if str($tree_parameters.tree_search.pers) != ''
159 -pers '$tree_parameters.tree_search.pers'
160 #end if
161
162 $tree_parameters.tree_search.allnni
163 $tree_parameters.tree_search.djc
164
165 ## file
166 #if $tree_parameters.tree_search.g
167 -g '$tree_parameters.tree_search.g'
168 #end if
169
170 #if str($tree_parameters.single_branch.alrt) != ''
171 -alrt '$tree_parameters.single_branch.alrt'
172 #end if
173
174 $tree_parameters.single_branch.abayes
175
176 #if str($tree_parameters.single_branch.lbp) != ''
177 -lbp '$tree_parameters.single_branch.lbp'
178 #end if
179
180 ## file
181 #if $tree_parameters.tree_topology.z
182 -z '$tree_parameters.tree_topology.z'
183 #end if
184
185 #if str($tree_parameters.tree_topology.zb) != ''
186 -zb '$tree_parameters.tree_topology.zb'
187 #end if
188
189 $tree_parameters.tree_topology.zw
190 $tree_parameters.tree_topology.au
191
192 $tree_parameters.constructing_consensus.con
193 $tree_parameters.constructing_consensus.net
194
195 #if str($tree_parameters.constructing_consensus.minsup) != ''
196 -minsup '$tree_parameters.constructing_consensus.minsup'
197 #end if
198
199 #if str($tree_parameters.constructing_consensus.bi) != ''
200 -bi '$tree_parameters.constructing_consensus.bi'
201 #end if
202
203 ## file
204 #if $tree_parameters.constructing_consensus.sup
205 -sup '$tree_parameters.constructing_consensus.sup'
206 #end if
207
208 #if str($tree_parameters.constructing_consensus.suptag) != ''
209 -suptag '$tree_parameters.constructing_consensus.suptag'
210 #end if
211
212 ## file
213 #if $tree_parameters.computing_robinson_foulds.rf
214 -rf '$tree_parameters.computing_robinson_foulds.rf'
215 #end if
216
217 $tree_parameters.computing_robinson_foulds.rf_all
218 $tree_parameters.computing_robinson_foulds.rf_adj
219
220 #if str($tree_parameters.generating_random.r) != ''
221 -r '$tree_parameters.generating_random.r'
222 #end if
223
224 $tree_parameters.generating_random.ru
225 $tree_parameters.generating_random.rcat
226 $tree_parameters.generating_random.rbal
227 $tree_parameters.generating_random.rcsg
228
229 #if str($tree_parameters.generating_random.rlen) != ''
230 -rlen '$tree_parameters.generating_random.rlen'
231 #end if
232
233 #if str($bootstrap_parameters.ultrafast_bootstrap.bb) != ''
234 -bb '$bootstrap_parameters.ultrafast_bootstrap.bb'
235 #end if
236
237 $bootstrap_parameters.ultrafast_bootstrap.wbt
238 $bootstrap_parameters.ultrafast_bootstrap.wbtl
239
240 #if str($bootstrap_parameters.ultrafast_bootstrap.nm) != ''
241 -nm '$bootstrap_parameters.ultrafast_bootstrap.nm'
242 #end if
243
244 #if str($bootstrap_parameters.ultrafast_bootstrap.bcor) != ''
245 -bcor '$bootstrap_parameters.ultrafast_bootstrap.bcor'
246 #end if
247
248 #if str($bootstrap_parameters.ultrafast_bootstrap.nstep) != ''
249 -nstep '$bootstrap_parameters.ultrafast_bootstrap.nstep'
250 #end if
251
252 #if str($bootstrap_parameters.ultrafast_bootstrap.beps) != ''
253 -beps '$bootstrap_parameters.ultrafast_bootstrap.beps'
254 #end if
255
256 #if str($bootstrap_parameters.ultrafast_bootstrap.bspec) != ''
257 -bspec '$bootstrap_parameters.ultrafast_bootstrap.bspec'
258 #end if
259
260 $bootstrap_parameters.ultrafast_bootstrap.bnni
261
262 #if str($bootstrap_parameters.nonparametric_bootstrap.b) != ''
263 -b '$bootstrap_parameters.nonparametric_bootstrap.b'
264 #end if
265
266 $bootstrap_parameters.nonparametric_bootstrap.bc
267 $bootstrap_parameters.nonparametric_bootstrap.bo
268
269 #if str($miscellaneous_options.fconst) != ''
270 -fconst '$miscellaneous_options.fconst'
271 #end if
272
273 ]]>
274 </command>
275 <inputs>
276 <section name="general_options" expanded="True" title="General options">
277 <param argument="-s" type="data" format="txt" optional="true" label="Specify input alignment file in PHYLIP, FASTA, NEXUS, CLUSTAL or MSF format."/>
278 <param argument="-st" type="select" label="Specify sequence type as either of DNA, AA, BIN, MORPH, CODON or NT2AA for DNA, amino-acid, binary, morphological, codon or DNA-to-AA-translated sequences">
279 <help><![CDATA[
280 Note that -st CODON is always necessary when using codon models and you also need to specify a genetic code like this if differed from the standard genetic code.
281 <br /><i>-st</i> NT2AA tells IQ-TREE to translate protein-coding DNA into AA sequences and then subsequent analysis will work on the AA sequences. You can also use a genetic code like -st NT2AA5 for the Invertebrate Mitochondrial Code (see genetic code table).]]>
282 </help>
283 <option value="DNA">DNA</option>
284 <option value="AA">AA</option>
285 <option value="BIN">BIN</option>
286 <option value="MORPH">MORPH</option>
287 <option value="CODON">CODON</option>
288 <option value="NT2AA">NT2AA</option>
289 </param>
290 <param argument="-t" type="data" format="nhx" optional="true" label="Specify a file containing starting tree for tree search"/>
291 <param argument="-te" type="data" format="nhx" optional="true" label="Like -t but fixing user tree" help="That means, no tree search is performed and IQ-TREE computes the log-likelihood of the fixed user tree."/>
292 <param argument="-seed" type="integer" optional="true" label="Specify a random number seed to reproduce a previous run (leave blank to randomize)"/>
293 <param argument="-keep_ident" type="boolean" truevalue="-keep-ident" falsevalue="" checked="false" label="Keep identical sequences in the alignment" help="By default: IQ-TREE will remove them during the analysis and add them in the end."/>
294 <param argument="-safe" type="boolean" truevalue="-safe" falsevalue="" checked="false" label="Turn on safe numerical mode to avoid numerical underflow for large data sets with many sequences (typically in the order of thousands)" help="This mode is automatically turned on when having more than 2000 sequences."/>
295 </section>
296 <section name="likelihood_mapping" expanded="False" title="Likelihood mapping analysis">
297 <param argument="-lmap" type="integer" optional="true" label="Specify the number of quartets to be randomly drawn" help="If you specify -lmap ALL, all unique quartets will be drawn, instead."/>
298 <param argument="-lmclust" type="data" format="txt" optional="true" label="Specify a NEXUS file containing taxon clusters (see below for example) for quartet mapping analysis."/>
299 <param argument="-wql" type="boolean" truevalue="-wql" falsevalue="" checked="false" label="Write quartet log-likelihoods into .lmap.quartetlh file (typically not needed)."/>
300 </section>
301 <section name="modelling_parameters" title="Modelling Parameters">
302 <section name="automatic_model" expanded="False" title="Automatic model selection">
303 <conditional name="cond_model" >
304 <param name="opt_custommodel" type="boolean" checked="false" label="Use Custom Model" help="See http://www.iqtree.org/doc/Substitution-Models"/>
305 <when value="true">
306 <param argument="-m" type="text" label="Model">
307 <sanitizer>
308 <valid initial="string.ascii_uppercase,+" />
309 </sanitizer>
310 </param>
311 </when>
312 <when value="false">
313 <param argument="-m" type="select" label="Perform standard model selection like jModelTest (for DNA) and ProtTest (for protein)" >
314 <help><![CDATA[
315 Moreover, IQ-TREE also works for codon, binary and morphogical data.
316 <table>
317 <tr>
318 <td><i>TESTONLY</i></td>
319 <td>Perform standard model selection like jModelTest (for DNA) and ProtTest (for protein). Moreover, IQ-TREE also works for codon, binary and morphogical data.</td>
320 </tr>
321 <tr>
322 <td><i>TEST</i></td>
323 <td>Like -m TESTONLY but immediately followed by tree reconstruction using the best-fit model found. So this performs both model selection and tree inference within a single run.</td>
324 </tr>
325 <tr>
326 <td><i>TESTNEWONLY</i></td>
327 <td>Perform an extended model selection that additionally includes FreeRate model compared with -m TESTONLY. Recommended as replacement for -m TESTONLY. Note that LG4X is a FreeRate model, but by default is not included because it is also a protein mixture model. To include it, use -madd option (see table below).</td>
328 </tr>
329 <tr>
330 <td><i>TESTNEW</i></td>
331 <td>Like -m MF but immediately followed by tree reconstruction using the best-fit model found.</td>
332 </tr>
333 <tr>
334 <td><i>TESTMERGEONLY</i></td>
335 <td>Select best-fit partitioning scheme like PartitionFinder.</td>
336 </tr>
337 <tr>
338 <td><i>TESTMERGE</i></td>
339 <td>Like -m TESTMERGEONLY but immediately followed by tree reconstruction using the best partitioning scheme found.</td>
340 </tr>
341 <tr>
342 <td><i>TESTNEWMERGEONLY</i></td>
343 <td>Like -m TESTMERGEONLY but additionally includes FreeRate model.</td>
344 </tr>
345 <tr>
346 <td><i>TESTNEWMERGE</i></td>
347 <td>Like -m MF+MERGE but immediately followed by tree reconstruction using the best partitioning scheme found.</td>
348 </tr>
349 </table>
350 ]]>
351 </help>
352 <option value="TESTONLY">TESTONLY</option>
353 <option value="TEST">TEST</option>
354 <option value="TESTNEWONLY">TESTNEWONLY</option>
355 <option value="TESTNEW">TESTNEW</option>
356 <option value="TESTMERGEONLY">TESTMERGEONLY</option>
357 <option value="TESTMERGE">TESTMERGE</option>
358 <option value="TESTNEWMERGEONLY">TESTNEWMERGEONLY</option>
359 <option value="TESTNEWMERGE">TESTNEWMERGE</option>
360 </param>
361 </when>
362 </conditional>
363 <param argument="-rcluster" type="integer" optional="true" label="Specify the percentage for the relaxed clustering algorithm (Lanfear et al., 2014)" help="This is similar to --rcluster-percent option of PartitionFinder. For example, with -rcluster 10 only the top 10% partition schemes are considered to save computations." />
364 <param argument="-mset" type="text" optional="true" label="Specify the name of a program (raxml, phyml or mrbayes) to restrict to only those models supported by the specified program" help="Alternatively, one can specify a comma-separated list of base models. For example, -mset WAG,LG,JTT will restrict model selection to WAG, LG, and JTT instead of all 18 AA models to save computations.">
365 <sanitizer>
366 <valid initial="string.ascii_uppercase,string.punctuation" />
367 </sanitizer>
368 </param>
369 <param argument="-msub" type="select" label="Specify either nuclear, mitochondrial, chloroplast or viral to restrict to those AA models designed for specified source." help="">
370 <option value="nuclear">nuclear</option>
371 <option value="mitochondrial">mitochondrial</option>
372 <option value="chloroplast">chloroplast</option>
373 <option value="viral">viral</option>
374 </param>
375 <param argument="-mfreq" type="text" optional="true" label="Specify a comma-separated list of frequency types for model selection" >
376 <sanitizer>
377 <valid initial="string.ascii_uppercase,string.digits,x,string.punctuation" />
378 </sanitizer>
379 </param>
380 <param argument="-mrate" type="text" optional="true" label="Specify a comma-separated list of rate heterogeneity types for model selection">
381 <sanitizer>
382 <valid initial="string.ascii_uppercase,string.punctuation" />
383 </sanitizer>
384 </param>
385 <param argument="-cmin" type="integer" value="2" optional="true" label="Specify minimum number of categories for FreeRate model"/>
386 <param argument="-cmax" type="integer" value="10" optional="true" label="Specify maximum number of categories for FreeRate model"/>
387 <param argument="-merit" type="select" label="Specify either AIC, AICc or BIC for the optimality criterion to apply for new procedure" help="">
388 <option value="AIC">AIC</option>
389 <option value="AICc">AICc</option>
390 <option value="BIC">BIC</option>
391 </param>
392 <param argument="-mtree" type="boolean" truevalue="-mtree" falsevalue="" checked="false" label="Turn on full tree search for each model considered, to obtain more accurate result"/>
393 <param argument="-madd" type="text" optional="true" label="Specify a comma-separated list of mixture models to additionally consider for model selection" help="For example, -madd LG4M,LG4X to additionally include these two protein mixture models.">
394 <sanitizer>
395 <valid initial="string.ascii_uppercase,string.digits,string.punctuation" />
396 </sanitizer>
397 </param>
398 <param argument="-mdef" type="data" format="txt" optional="true" label="Specify a NEXUS model file to define new models."/>
399 </section>
400 <section name="specifying_substitution" expanded="False" title="Specifying substitution models">
401 <param argument="-mwopt" type="boolean" truevalue="-mwopt" falsevalue="" checked="false" label="Turn on optimizing weights of mixture models" help="Note that for models like LG+C20+F+G this mode is automatically turned on, but not for LG+C20+G."/>
402 </section>
403 <section name="rate_heterogeneity" expanded="False" title="Rate heterogeneity">
404 <param argument="-a" type="text" optional="true" label="Specify the Gamma shape parameter (default: estimate)">
405 <sanitizer>
406 <valid initial="string.printable" />
407 </sanitizer>
408 </param>
409 <param argument="-gmedian" type="boolean" truevalue="-gmedian" falsevalue="" checked="false" label="Perform the median approximation for Gamma rate heterogeneity instead of the default mean approximation (Yang, 1994)"/>
410 <param argument="-i" type="text" optional="true" label="Specify the proportion of invariable sites (default: estimate)">
411 <sanitizer>
412 <valid initial="string.printable" />
413 </sanitizer>
414 </param>
415 <param argument="--opt_gamma_inv" type="boolean" truevalue="--opt-gamma-inv" falsevalue="" checked="false" label="Perform more thorough estimation for +I+G model parameters"/>
416 <param argument="-wsr" type="boolean" truevalue="-wsr" falsevalue="" checked="false" label="Write per-site rates to .rate file"/>
417 </section>
418 <section name="partition_model" expanded="False" title="Partition model options">
419 <param argument="-q" type="data" format="txt" optional="true" label="Specify partition file for edge-equal partition model" help="That means, all partitions share the same set of branch lengths (like -q option of RAxML)."/>
420 <param argument="-spp" type="boolean" truevalue="-spp" falsevalue="" checked="false" label="Like -q but allowing partitions to have different evolutionary speeds (edge-proportional partition model)."/>
421 <param argument="-sp" type="data" format="txt" optional="true" label="Specify partition file for edge-unlinked partition model" help="That means, each partition has its own set of branch lengths (like -M option of RAxML). This is the most parameter-rich partition model to accomodate heterotachy."/>
422 </section>
423 <section name="site_specific_frequency" expanded="False" title="Site-specific frequency model options">
424 <param argument="-ft" type="data" format="nhx" optional="true" label="Specify a guide tree to infer site frequency profiles."/>
425 <param argument="-fs" type="float" optional="true" label="Specify a site frequency file, e.g" help="the .sitefreq file obtained from -ft run. This will save memory used for the first phase of the analysis."/>
426 <param argument="-fmax" type="boolean" truevalue="-fmax" falsevalue="" checked="false" label="Switch to posterior maximum mode for obtaining site-specific profiles" help="Default: posterior mean."/>
427 </section>
428 </section>
429 <section name="tree_parameters" title="Tree Parameters">
430 <section name="tree_search" expanded="False" title="Tree search parameters">
431 <param argument="-n" type="integer" optional="true" label="Skip subsequent tree search (n = 0), useful when you only want to assess the phylogenetic information of the alignment. Otherwise specify number of iterations to stop (this option overrides -nstop criterion)." />
432 <param argument="-ninit" type="integer" value="100" optional="true" label="Specify number of initial parsimony trees"/>
433 <param argument="-ntop" type="integer" value="20" optional="true" label="Specify number of top initial parsimony trees to optimize with ML nearest neighbor interchange (NNI) search to initialize the candidate set"/>
434 <param argument="-nbest" type="integer" value="5" optional="true" label="Specify number of trees in the candidate set to maintain during ML tree search"/>
435 <param argument="-nstop" type="integer" value="100" optional="true" label="Specify number of unsuccessful iterations to stop"/>
436 <param argument="-sprrad" type="integer" value="6" optional="true" label="Specify SPR radius for the initial parsimony tree search"/>
437 <param argument="-pers" type="float" value="0.5" optional="true" label="Specify perturbation strength (between 0 and 1) for randomized NNI"/>
438 <param argument="-allnni" type="boolean" truevalue="-allnni" falsevalue="" checked="false" label="Turn on more thorough and slower NNI search"/>
439 <param argument="-djc" type="boolean" truevalue="-djc" falsevalue="" checked="false" label="Avoid computing ML pairwise distances and BIONJ tree."/>
440 <param argument="-g" type="data" format="txt" optional="true" label="Specify a topological constraint tree file in NEWICK format" help="The constraint tree can be a multifurcating tree and need not to include all taxa."/>
441 </section>
442 <section name="single_branch" expanded="False" title="Single branch tests">
443 <param argument="-alrt" type="integer" optional="true" label="Specify number of replicates (&gt;=1000) to perform SH-like approximate likelihood ratio test (SH-aLRT) (Guindon et al., 2010)" help="If number of replicates is set to 0 (-alrt 0), then the parametric aLRT test (Anisimova and Gascuel 2006) is performed, instead of SH-aLRT."/>
444 <param argument="-abayes" type="boolean" truevalue="-abayes" falsevalue="" checked="false" label="Perform approximate Bayes test (Anisimova et al., 2011)."/>
445 <param argument="-lbp" type="integer" optional="true" label="Specify number of replicates (&gt;=1000) to perform fast local bootstrap probability method (Adachi and Hasegawa, 1996)."/>
446 </section>
447 <section name="tree_topology" expanded="False" title="Tree topology tests">
448 <param argument="-z" type="data" format="txt" optional="true" label="Specify a file containing a set of trees" help="IQ-TREE will compute the log-likelihoods of all trees."/>
449 <param argument="-zb" type="integer" optional="true" label="Specify the number of RELL (Kishino et al., 1990) replicates (&gt;=1000) to perform several tree topology tests for all trees passed via -z" help="The tests include bootstrap proportion (BP), KH test (Kishino and Hasegawa, 1989), SH test (Shimodaira and Hasegawa, 1999) and expected likelihood weights (ELW) (Strimmer and Rambaut, 2002)."/>
450 <param argument="-zw" type="boolean" truevalue="-zw" falsevalue="" checked="false" label="Used together with -zb to additionally perform the weighted-KH and weighted-SH tests."/>
451 <param argument="-au" type="boolean" truevalue="-au" falsevalue="" checked="false" label="Used together with -zb to additionally perform the approximately unbiased (AU) test (Shimodaira, 2002)" help="Note that you have to specify the number of replicates for the AU test via -zb."/>
452 </section>
453 <section name="constructing_consensus" expanded="False" title="Constructing consensus tree">
454 <param argument="-con" type="boolean" truevalue="-con" falsevalue="" checked="false" label="Compute consensus tree of the trees passed via -t" help="Resulting consensus tree is written to .contree file."/>
455 <param argument="-net" type="boolean" truevalue="-net" falsevalue="" checked="false" label="Compute consensus network of the trees passed via -t" help="Resulting consensus network is written to .nex file."/>
456 <param argument="-minsup" type="float" value="0.0" optional="true" label="Specify a minimum threshold (between 0 and 1) to keep branches in the consensus tree"/>
457 <param argument="-bi" type="integer" optional="true" label="Specify a burn-in, which is the number of beginning trees passed via -t to discard before consensus construction" help="This is useful e.g. when summarizing trees from MrBayes analysis."/>
458 <param argument="-sup" type="data" format="nhx" optional="true" label="Specify an input “target” tree file" help="That means, support values are first extracted from the trees passed via -t, and then mapped onto the target tree. Resulting tree with assigned support values is written to .suptree file. This option is useful to map and compare support values from different approaches onto a single tree."/>
459 <param argument="-suptag" type="text" optional="true" label="Specify name of a node in -sup target tree" help="The corresponding node of .suptree will then be assigned with IDs of trees where this node appears. Special option -suptag ALL will assign such IDs for all nodes of the target tree."/>
460 </section>
461 <section name="computing_robinson_foulds" expanded="False" title="Computing Robinson-Foulds distance">
462 <param argument="-rf" type="data" format="nhx" optional="true" label="Specify a second set of trees" help="IQ-TREE computes all pairwise RF distances between two tree sets passed via -t and -rf"/>
463 <param argument="-rf_all" type="boolean" truevalue="-rf_all" falsevalue="" checked="false" label="Compute all-to-all RF distances between all trees passed via -t"/>
464 <param argument="-rf_adj" type="boolean" truevalue="-rf_adj" falsevalue="" checked="false" label="Compute RF distances between adjacent trees passed via -t"/>
465 </section>
466 <section name="generating_random" expanded="False" title="Generating random trees">
467 <param argument="-r" type="integer" optional="true" label="Specify number of taxa" help="IQ-TREE will create a random tree under Yule-Harding model with specified number of taxa"/>
468 <param argument="-ru" type="boolean" truevalue="-ru" falsevalue="" checked="false" label="Like -r, but a random tree is created under uniform model."/>
469 <param argument="-rcat" type="boolean" truevalue="-rcat" falsevalue="" checked="false" label="Like -r, but a random caterpillar tree is created."/>
470 <param argument="-rbal" type="boolean" truevalue="-rbal" falsevalue="" checked="false" label="Like -r, but a random balanced tree is created."/>
471 <param argument="-rcsg" type="boolean" truevalue="-rcsg" falsevalue="" checked="false" label="Like -r, bur a random circular split network is created."/>
472 <param argument="-rlen" type="text" optional="true" label="Specify three numbers: minimum, mean and maximum branch lengths of the random tree">
473 <sanitizer>
474 <valid initial="string.digits,string.whitespace" />
475 </sanitizer>
476 </param>
477 </section>
478 </section>
479 <section name="bootstrap_parameters" title="Bootstrap Parameters">
480 <section name="ultrafast_bootstrap" expanded="False" title="Ultrafast bootstrap parameters">
481 <param argument="-bb" type="integer" optional="true" label="Specify number of bootstrap replicates (&gt;=1000)."/>
482 <param argument="-wbt" type="boolean" truevalue="-wbt" falsevalue="" checked="false" label="Turn on writing bootstrap trees to .ufboot file"/>
483 <param argument="-wbtl" type="boolean" truevalue="-wbtl" falsevalue="" checked="false" label="Like -wbt but bootstrap trees written with branch lengths"/>
484 <param argument="-nm" type="integer" value="1000" optional="true" label="Specify maximum number of iterations to stop"/>
485 <param argument="-bcor" type="float" value="0.99" optional="true" label="Specify minimum correlation coefficient for UFBoot convergence criterion"/>
486 <param argument="-nstep" type="integer" value="100" optional="true" label="Specify iteration interval checking for UFBoot convergence"/>
487 <param argument="-beps" type="float" value="0.5" optional="true" label="Specify a small epsilon to break tie in RELL evaluation for bootstrap trees"/>
488 <param argument="-bspec" type="text" optional="true" label="Specify the resampling strategies for partitioned analysis" help="By default, IQ-TREE resamples alignment sites within partitions. With -bspec GENE IQ-TREE will resample partitions. With -bspec GENESITE IQ-TREE will resample partitions and then resample sites within resampled partitions (Gadagkar et al., 2005).">
489 <sanitizer>
490 <valid initial="string.ascii_uppercase" />
491 </sanitizer>
492 </param>
493 <param argument="-bnni" type="boolean" truevalue="-bnni" falsevalue="" checked="false" label="Perform an additional step to further optimize UFBoot trees by nearest neighbor interchange (NNI) based directly on bootstrap alignments" help="This option is recommended in the presence of severe model violations. It increases computing time by 2-fold but reduces the risk of overestimating branch supports due to severe model violations. Introduced in IQ-TREE 1.6."/>
494 </section>
495 <section name="nonparametric_bootstrap" expanded="False" title="Nonparametric bootstrap">
496 <param argument="-b" type="integer" optional="true" label="Specify number of bootstrap replicates (recommended &gt;=100)" help="This will perform both bootstrap and analysis on original alignment and provide a consensus tree."/>
497 <param argument="-bc" type="boolean" truevalue="-bc" falsevalue="" checked="false" label="Like -b but omit analysis on original alignment."/>
498 <param argument="-bo" type="boolean" truevalue="-bo" falsevalue="" checked="false" label="Like -b but only perform bootstrap analysis (no analysis on original alignment and no consensus tree)."/>
499 </section>
500 </section>
501 <section name="miscellaneous_options" expanded="False" title="Miscellaneous options">
502 <param argument="-fconst" type="text" optional="true" label="Specify a list of comma-separated integer numbers" help="The number of entries should be equal to the number of states in the model (e.g. 4 for DNA and 20 for protein). IQ-TREE will then add a number of constant sites accordingly. For example, -fconst 10,20,15,40 will add 10 constant sites of all A, 20 constant sites of all C, 15 constant sites of all G and 40 constant sites of all T into the alignment.">
503 <sanitizer>
504 <valid initial="string.digits,string.punctuation" />
505 </sanitizer>
506 </param>
507 </section>
508 </inputs>
509 <outputs>
510 <data name='bionj' format='nhx' from_work_dir="*.bionj" label="${tool.name} on ${on_string}: BIONJ Tree" />
511 <data name='treefile' format='nhx' from_work_dir="*.treefile" label="${tool.name} on ${on_string}: MaxLikelihood Tree" />
512 <data name='contree' format='nhx' from_work_dir="*.contree" label="${tool.name} on ${on_string}: Consensus Tree" />
513 <data name='mldist' format='mldist' from_work_dir="*.mldist" label="${tool.name} on ${on_string}: MaxLikelihood Distance Matrix"/>
514 <data name='splits.nex' format='nex' from_work_dir="*.splits.nex" label="${tool.name} on ${on_string}: Occurence Frequencies in Bootstrap Trees" />
515 <data name='iqtree' format='iqtree' from_work_dir="*.iqtree" label="${tool.name} on ${on_string}: Report and Final Tree" />
516 </outputs>
517 <tests>
518 <test>
519 <param name="seed" value="1257" />
520 <param name="st" value="AA" />
521 <param name="s" value="example.phy" />
522 <param name="m" value="TESTNEW" />
523 <param name="msub" value="nuclear" />
524 <param name="madd" value="LG4M,LG4X" />
525 <param name="merit" value="AICc" />
526 <param name="bb" value="2000" />
527 <output name='bionj'>
528 <assert_contents>
529 <has_text_matching expression=".*Human.*Whale.*" />
530 </assert_contents>
531 </output>
532 <output name='iqtree'>
533 <assert_contents>
534 <has_text_matching expression="VT\+F\+R3(\s+((-|\d|\.)+))+" />
535 </assert_contents>
536 </output>
537 <output name='mldist'>
538 <assert_contents>
539 <has_line_matching expression="^Frog(\s+((\d|\.)+))+\s+$" />
540 <has_line_matching expression="^Whale(\s+((\d|\.)+))+\s+$" />
541 <has_line_matching expression="^Cow(\s+((\d|\.)+))+\s+$" />
542 </assert_contents>
543 </output>
544 <output name='treefile'>
545 <assert_contents>
546 <has_line_matching expression="\(LngfishAu:(\d|\..)+,\(LngfishSA:(\d.)+,.*" />
547 </assert_contents>
548 </output>
549 <output name='contree' >
550 <assert_contents>
551 <has_line_matching
552 expression="\(LngfishAu:(\d|\..)+,\(LngfishSA:(\d.)+,.*\)\d+:(\d|\.)+,.*" />
553 </assert_contents>
554 </output>
555 <output name='splits.nex'>
556 <assert_contents>
557 <has_line line="BEGIN Splits;" />
558 <has_line line="END; [Splits]" />
559 </assert_contents>
560 </output>
561 </test>
562 <test>
563 <param name='s' value='example.phy' />
564 <output name='iqtree'>
565 <assert_contents>
566 <has_text_matching expression=".*Human.*Whale.*" />
567 </assert_contents>
568 </output>
569 <output name='treefile'>
570 <assert_contents>
571 <has_text_matching expression="\(LngfishAu:(\d|\..)+,\(LngfishSA:(\d.)+,.*" />
572 </assert_contents>
573 </output>
574 </test>
575 </tests>
576 <help>
577 IQ-TREE
578 =======
579
580 The full documentation can be found here_.
581
582 .. _here : http://www.iqtree.org/doc/
583
584 General Tutorial
585 ===================
586
587 Input data
588 ----------
589
590 IQ-TREE takes as input a *multiple sequence alignment* and will reconstruct an evolutionary tree that is best explained by the input data. The input alignment can be in various common formats. For example the PHYLIP_ format which may look like:
591
592 .. _PHYLIP: http://evolution.genetics.washington.edu/phylip/doc/sequence.html
593
594 ::
595
596 7 28
597 Frog AAATTTGGTCCTGTGATTCAGCAGTGAT
598 Turtle CTTCCACACCCCAGGACTCAGCAGTGAT
599 Bird CTACCACACCCCAGGACTCAGCAGTAAT
600 Human CTACCACACCCCAGGAAACAGCAGTGAT
601 Cow CTACCACACCCCAGGAAACAGCAGTGAC
602 Whale CTACCACGCCCCAGGACACAGCAGTGAT
603 Mouse CTACCACACCCCAGGACTCAGCAGTGAT
604
605 This tiny alignment contains 7 DNA sequences from several animals with the sequence length of 28 nucleotides. IQ-TREE also supports other file formats such as FASTA, NEXUS, CLUSTALW. The FASTA file for the above example may look like this:
606
607 ::
608
609 >Frog
610 AAATTTGGTCCTGTGATTCAGCAGTGAT
611 >Turtle
612 CTTCCACACCCCAGGACTCAGCAGTGAT
613 >Bird
614 CTACCACACCCCAGGACTCAGCAGTAAT
615 >Human
616 CTACCACACCCCAGGAAACAGCAGTGAT
617 >Cow
618 CTACCACACCCCAGGAAACAGCAGTGAC
619 >Whale
620 CTACCACGCCCCAGGACACAGCAGTGAT
621 >Mouse
622 CTACCACACCCCAGGACTCAGCAGTGAT
623
624 **NOTE**: If you have raw sequences, you need to first apply alignment programs like MAFFT_ or ClustalW_ to align the sequences, before feeding them into IQ-TREE.
625
626 .. _MAFFT: http://mafft.cbrc.jp/alignment/software/
627 .. _ClustalW: http://www.clustal.org
628
629
630 Running example
631 ---------------------
632
633 From the download_ there is an example alignment called `example.phy`
634 in PHYLIP format. This example contains parts of the mitochondrial DNA sequences of several animals (Source: `Phylogenetic Handbook`_)
635
636 .. _`Phylogenetic Handbook` : http://www.kuleuven.be/aidslab/phylogenybook/home.html)).
637 .. _download: http://www.iqtree.org/#download
638
639 You can now start to reconstruct a maximum-likelihood tree
640 from this alignment by entering (assuming that you are now in the same folder with `example.phy`):
641
642 ::iqtree -s example.phy -st AA -seed 9999 -m TESTNEW -msub nuclear -madd LG4M,LG4x -merit AICc -bb 2000
643
644 * **-s** is the option to specify the name of the alignment file
645
646 * **-st** specifies the sequence type as amino-acid
647
648 * **-seed** ensures that the output files remain the same for subsequent runs
649
650 * **-m** sets the modelling parameter for standard model selection
651
652 * **-msub** determines the type sub-modelling
653
654 * **-madd** provides an additional selection mixed models
655
656 * **-merit** asserts the type of optimality criterion
657
658 * **-bb** defines the number of replicates
659
660
661 Each of these parameters are available under the relevant sub-sections in the main tool interface.
662
663 At the end of the run IQ-TREE will write several output files including:
664
665 * **example.phy.iqtree**: the main report file that is self-readable. You should look at this file to see the computational results. It also contains a textual representation of the final tree (see below).
666
667 * **example.phy.treefile**: the ML tree in NEWICK format, which can be visualized by any supported tree viewer programs like FigTree or iTOL.
668
669 **NOTE**: Starting with version 1.5.4, with this simple command IQ-TREE will by default perform ModelFinder to find the best-fit substitution model and then infer a phylogenetic tree using the selected model.
670
671 For this example data the resulting maximum-likelihood tree may look like this (extracted from **.iqtree** file):
672
673 **NOTE**: Tree is UNROOTED although outgroup taxon 'LngfishAu' is drawn at root
674
675 ::
676
677 +--------------LngfishAu
678 |
679 | +--------------LngfishSA
680 +--------|
681 | +--------------LngfishAf
682 |
683 | +-------------------Frog
684 +------|
685 | +-----------------Turtle
686 | +-----|
687 | | | +-----------------------Sphenodon
688 | | | +--|
689 | | | | +--------------------------Lizard
690 | | +---|
691 | | | +---------------------Crocodile
692 | | +------|
693 | | +------------------Bird
694 +---------|
695 | +----------------Human
696 | +--|
697 | | | +--------Seal
698 | | +--|
699 | | | +-------Cow
700 | | +---|
701 | | +---------Whale
702 | +----|
703 | | | +------Mouse
704 | | +---------|
705 | | +--------Rat
706 +----------|
707 | +----------------Platypus
708 +---|
709 +-------------Opossum
710
711
712 This makes sense as the mammals (**Human** to **Opossum**) form a clade, whereas the reptiles **Turtle** to **Crocodile**) and **Bird** form a separate sister clade. Here the tree is drawn at the *outgroup* Lungfish which is more accient than other species in this example. However, please note that IQ-TREE always produces an **unrooted tree** as it knows nothing about this biological background; IQ-TREE simply draws the tree this way as **LngfishAu** is the first sequence occuring in the alignment.
713
714 Choosing the right substitution model
715 -------------------------------------
716
717 IQ-TREE will choose the best model for you automatically if specify any of the TEST models, but valid custom models can also be specified that conform to those found in Models_ page.
718
719 .. _Models: http://www.iqtree.org/doc/Substitution-Models#binary-and-morphological-models
720
721
722 ------------------------------
723
724 Advanced Parameter Selection
725 ============================
726
727 Using codon models
728 ------------------
729
730 IQ-TREE supports a number of codon models. You need to input a protein-coding DNA alignment and specify codon data by option **-st CODON** (Otherwise, IQ-TREE applies DNA model because it detects that your alignment has DNA sequences):
731
732 ::
733
734 iqtree -s coding_gene.phy -st CODON
735
736 If your alignment length is not divisible by 3, IQ-TREE will stop with an error message. IQ-TREE will group sites 1,2,3 into codon site 1; sites 4,5,6 to codon site 2; etc. Moreover, any codon, which has at least one gap/unknown/ambiguous nucleotide, will be treated as unknown codon character.
737
738 Note that the above command assumes the standard genetic code. If your sequences follow 'The Invertebrate Mitochondrial Code', then run:
739
740 ::
741
742 iqtree -s coding_gene.phy -st CODON5
743
744 Note that ModelFinder works for codon alignments. IQ-TREE version >= 1.5.4 will automatically invokes ModelFinder to find the best-fit codon model.
745
746
747 Assessing branch supports with ultrafast bootstrap approximation
748 ----------------------------------------------------------------
749
750 To overcome the computational burden required by the nonparametric bootstrap, IQ-TREE introduces an ultrafast bootstrap approximation (UFBoot) ([Minh et al., 2013]) that is orders of magnitude faster than the standard procedure and provides relatively unbiased branch support values. Citation for UFBoot:
751
752 B.Q. Minh, M.A.T. Nguyen, and A. von Haeseler (2013) Ultrafast approximation for phylogenetic bootstrap. _Mol. Biol. Evol., 30:1188-1195.
753
754 ::
755
756 iqtree -s example.phy -m TIM2+I+G -bb 1000
757
758 **-bb** specifies the number of bootstrap replicates where 1000 is the minimum number recommended. The section **MAXIMUM LIKELIHOOD TREE** in **example.phy.iqtree** shows a textual representation of the maximum likelihood tree with branch support values in percentage. The NEWICK format of the tree is printed to the file **example.phy.treefile**. In addition, IQ-TREE writes the following files:
759
760 * **example.phy.contree**: the consensus tree with assigned branch supports where branch lengths are optimized on the original alignment.
761
762 * **example.phy.splits**: support values in percentage for all splits (bipartitions), computed as the occurence frequencies in the bootstrap trees. This file is in "star-dot" format.
763
764 * **example.phy.splits.nex**: has the same information as **example.phy.splits** but in NEXUS format, which can be viewed with the program SplitsTree_ to explore the conflicting signals in the data. So it is more informative than consensus tree, e.g. you can see how highly supported the second best conflicting split is, which had no chance to enter the consensus tree.
765
766 .. _SplitsTree: http://www.splitstree.org
767
768
769 Reducing impact of severe model violations with UFBoot
770 ------------------------------------------------------
771
772 Starting with IQ-TREE version 1.6 we provide a new option **-bnni** to reduce the risk of overestimating branch supports with UFBoot due to severe model violations. With this option UFBoot will further optimize each bootstrap tree using a hill-climbing nearest neighbor interchange (NNI) search based directly on the corresponding bootstrap alignment.
773
774 Thus, if severe model violations are present in the data set at hand, users are advised to append **-bnni** to the regular UFBoot command:
775
776 iqtree -s example.phy -m TIM2+I+G -bb 1000 -bnni
777
778 For more details see:
779
780 D.T. Hoang, O. Chernomor, A. von Haeseler, B.Q. Minh, L.S. Vinh (2017) UFBoot2: Improving the ultrafast bootstrap approximation.
781
782
783 Assessing branch supports with standard nonparametric bootstrap
784 ----------------------------------------------------------------
785
786 The standard nonparametric bootstrap is invoked by the **-b** option:
787
788 iqtree -s example.phy -m TIM2+I+G -b 100
789
790 **-b** specifies the number of bootstrap replicates where 100
791 is the minimum recommended number. The output files are similar to those produced by the UFBoot procedure.
792
793
794
795 Assessing branch supports with single branch tests
796 --------------------------------------------------
797
798 IQ-TREE provides an implementation of the SH-like approximate likelihood ratio test ([Guindon et al., 2010]). To perform this test, run:
799
800 ::
801
802 iqtree -s example.phy -m TIM2+I+G -alrt 1000
803
804 **-alrt** specifies the number of bootstrap replicates for SH-aLRT where 1000 is the minimum number recommended.
805
806 IQ-TREE also supports other tests such as the aBayes test (Anisimova et al., 2011) and the local bootstrap test (Adachi and Hasegawa, 1996).
807
808 You can also perform both SH-aLRT and the ultrafast bootstrap within one single run:
809
810 ::
811
812 iqtree -s example.phy -m TIM2+I+G -alrt 1000 -bb 1000
813
814 The branches of the resulting **.treefile** will be assigned with both SH-aLRT and UFBoot support values, which are readable by any tree viewer program like FigTree, Dendroscope or ETE. You can also look at the textual tree figure in **.iqtree** file:
815
816 **NOTE**: Tree is UNROOTED although outgroup taxon 'LngfishAu' is drawn at root
817 Numbers in parentheses are SH-aLRT support (%) / ultrafast bootstrap support (%)
818
819 ::
820
821 +-------------LngfishAu
822 |
823 | +--------------LngfishSA
824 +-------| (100/100)
825 | +------------LngfishAf
826 |
827 | +--------------------Frog
828 +------| (99.8/100)
829 | +-----------------Turtle
830 | +--| (85/72)
831 | | | +------------------------Crocodile
832 | | +----| (96.5/97)
833 | | +------------------Bird
834 | +--| (39/51)
835 | | +---------------------------Sphenodon
836 | +-----| (98.2/99)
837 | | +-------------------------------Lizard
838 +---------| (100/100)
839 | +--------------Human
840 | +--| (92.3/93)
841 | | | +------Seal
842 | | +--| (68.3/75)
843 | | | +-----Cow
844 | | +--| (99.7/100)
845 | | +-------Whale
846 | +----| (99.1/100)
847 | | | +---Mouse
848 | | +---------| (100/100)
849 | | +------Rat
850 +-----------| (100/100)
851 | +--------------Platypus
852 +--| (93/98)
853 +-----------Opossum
854
855
856 From this figure, the branching patterns within reptiles are poorly supported (e.g. **Sphenodon** with SH-aLRT: 39%, UFBoot: 51% and **Turtle** with SH-aLRT: 85%, UFBoot: 72%) as well as the phylogenetic position of **Seal** within mammals (SH-aLRT: 68.3%, UFBoot: 75%). Other branches appear to be well supported.
857 </help>
858 <citations>
859 <citation type="doi">10.1093/molbev/msu300</citation>
860 <citation type="doi">10.1093/molbev/mst024</citation>
861 </citations>
862 </tool>