Mercurial > repos > iuc > iqtree

comparison iqtree.xml @ 1:288db50d1fb9 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/iqtree/ commit d4423a8641e86485dde733e8148c5bced4d8410c
author iuc
date Sat, 25 Nov 2017 18:17:09 -0500
parents 05ee0a74faef
children d1c340a5664b
comparison
equal deleted inserted replaced
0:05ee0a74faef 1:288db50d1fb9
1 <tool id="iqtree" name="IQ-TREE" version="1.5.5" > 1 <tool id="iqtree" name="IQ-TREE" version="1.5.5.1" >
2 <description>Phylogenomic / evolutionary tree construction from multiple sequences</description> 2 <description>Phylogenomic / evolutionary tree construction from multiple sequences</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="1.5.5">iqtree</requirement> 4 <requirement type="package" version="1.5.5">iqtree</requirement>
5 </requirements> 5 </requirements>
6 <command detect_errors='exit_code' ><![CDATA[ 6 <command detect_errors='exit_code' ><![CDATA[
7 iqtree 7 iqtree
8 -pre PREF 8 -pre PREF
9 -nt AUTO 9 -nt \${GALAXY_SLOTS:-10}
10 -redo 10 -redo
11 11
12 ## file 12 ## file
13 #if $general_options.s 13 #if $general_options.s
14 -s '$general_options.s' 14 -s '$general_options.s'
15 #end if 15 #end if
16 16
17 ## file 17 ## file
18 #if $general_options.t 18 #if $general_options.t
19 -t '$general_options.t' 19 -t '$general_options.t'
20 $tree_parameters.constructing_consensus.con
21 $tree_parameters.constructing_consensus.net
22 #if str($tree_parameters.constructing_consensus.bi) != ''
23 -bi '$tree_parameters.constructing_consensus.bi'
24 #end if
25
26 ## file
27 #if $tree_parameters.constructing_consensus.sup
28 -sup '$tree_parameters.constructing_consensus.sup'
29 #end if
30
31 #if str($tree_parameters.constructing_consensus.suptag) != ''
32 -suptag '$tree_parameters.constructing_consensus.suptag'
33 #end if
34
35 ## file
36 #if $tree_parameters.computing_robinson_foulds.rf
37 -rf '$tree_parameters.computing_robinson_foulds.rf'
38 $tree_parameters.computing_robinson_foulds.rf_all
39 $tree_parameters.computing_robinson_foulds.rf_adj
40 #end if
20 #end if 41 #end if
21 42
22 ## file 43 ## file
23 #if $general_options.te 44 #if $general_options.te
24 -te '$general_options.te' 45 -te '$general_options.te'
51 #end if 72 #end if
52 73
53 #if str($modelling_parameters.automatic_model.rcluster) != '' 74 #if str($modelling_parameters.automatic_model.rcluster) != ''
54 -rcluster '$modelling_parameters.automatic_model.rcluster' 75 -rcluster '$modelling_parameters.automatic_model.rcluster'
55 #end if 76 #end if
56 77
57 #if str($modelling_parameters.automatic_model.mset) != '' 78 #if str($modelling_parameters.automatic_model.mset) != ''
58 -mset '$modelling_parameters.automatic_model.mset' 79 -mset '$modelling_parameters.automatic_model.mset'
59 #end if 80 #end if
60 81
61 #if str($modelling_parameters.automatic_model.msub) != '' 82 #if str($modelling_parameters.automatic_model.msub) != ''
62 -msub '$modelling_parameters.automatic_model.msub' 83 -msub '$modelling_parameters.automatic_model.msub'
63 #end if 84 #end if
64 85
65 #if str($modelling_parameters.automatic_model.mfreq) != '' 86 #if str($modelling_parameters.automatic_model.mfreq) != ''
66 -mfreq '$modelling_parameters.automatic_model.mfreq' 87 -mfreq '$modelling_parameters.automatic_model.mfreq'
67 #end if 88 #end if
68 89
69 #if str($modelling_parameters.automatic_model.mrate) != '' 90 #if str($modelling_parameters.automatic_model.mrate) != ''
187 #end if 208 #end if
188 209
189 $tree_parameters.tree_topology.zw 210 $tree_parameters.tree_topology.zw
190 $tree_parameters.tree_topology.au 211 $tree_parameters.tree_topology.au
191 212
192 $tree_parameters.constructing_consensus.con
193 $tree_parameters.constructing_consensus.net
194
195 #if str($tree_parameters.constructing_consensus.minsup) != '' 213 #if str($tree_parameters.constructing_consensus.minsup) != ''
196 -minsup '$tree_parameters.constructing_consensus.minsup' 214 -minsup '$tree_parameters.constructing_consensus.minsup'
197 #end if 215 #end if
198 216
199 #if str($tree_parameters.constructing_consensus.bi) != ''
200 -bi '$tree_parameters.constructing_consensus.bi'
201 #end if
202
203 ## file
204 #if $tree_parameters.constructing_consensus.sup
205 -sup '$tree_parameters.constructing_consensus.sup'
206 #end if
207
208 #if str($tree_parameters.constructing_consensus.suptag) != ''
209 -suptag '$tree_parameters.constructing_consensus.suptag'
210 #end if
211
212 ## file
213 #if $tree_parameters.computing_robinson_foulds.rf
214 -rf '$tree_parameters.computing_robinson_foulds.rf'
215 #end if
216
217 $tree_parameters.computing_robinson_foulds.rf_all
218 $tree_parameters.computing_robinson_foulds.rf_adj
219 217
220 #if str($tree_parameters.generating_random.r) != '' 218 #if str($tree_parameters.generating_random.r) != ''
221 -r '$tree_parameters.generating_random.r' 219 -r '$tree_parameters.generating_random.r'
222 #end if 220 #end if
223 221
260 $bootstrap_parameters.ultrafast_bootstrap.bnni 258 $bootstrap_parameters.ultrafast_bootstrap.bnni
261 259
262 #if str($bootstrap_parameters.nonparametric_bootstrap.b) != '' 260 #if str($bootstrap_parameters.nonparametric_bootstrap.b) != ''
263 -b '$bootstrap_parameters.nonparametric_bootstrap.b' 261 -b '$bootstrap_parameters.nonparametric_bootstrap.b'
264 #end if 262 #end if
265 263
266 $bootstrap_parameters.nonparametric_bootstrap.bc 264 $bootstrap_parameters.nonparametric_bootstrap.bc
267 $bootstrap_parameters.nonparametric_bootstrap.bo 265 $bootstrap_parameters.nonparametric_bootstrap.bo
268 266
269 #if str($miscellaneous_options.fconst) != '' 267 #if str($miscellaneous_options.fconst) != ''
270 -fconst '$miscellaneous_options.fconst' 268 -fconst '$miscellaneous_options.fconst'
271 #end if 269 #end if
272 270
273 ]]> 271 ]]>
274 </command> 272 </command>
275 <inputs> 273 <inputs>
276 <section name="general_options" expanded="True" title="General options"> 274 <section name="general_options" expanded="True" title="General options">
277 <param argument="-s" type="data" format="txt" optional="true" label="Specify input alignment file in PHYLIP, FASTA, NEXUS, CLUSTAL or MSF format."/> 275 <param argument="-s" type="data" format="txt" optional="true" label="Specify input alignment file in PHYLIP, FASTA, NEXUS, CLUSTAL or MSF format."/>
278 <param argument="-st" type="select" label="Specify sequence type as either of DNA, AA, BIN, MORPH, CODON or NT2AA for DNA, amino-acid, binary, morphological, codon or DNA-to-AA-translated sequences"> 276 <param argument="-st" type="select" label="Specify sequence type as either of DNA, AA, BIN, MORPH, CODON or NT2AA for DNA, amino-acid, binary, morphological, codon or DNA-to-AA-translated sequences">
279 <help><![CDATA[ 277 <help><![CDATA[
280 Note that -st CODON is always necessary when using codon models and you also need to specify a genetic code like this if differed from the standard genetic code. 278 Note that -st CODON is always necessary when using codon models and you also need to specify a genetic code like this if differed from the standard genetic code.
281 <br /><i>-st</i> NT2AA tells IQ-TREE to translate protein-coding DNA into AA sequences and then subsequent analysis will work on the AA sequences. You can also use a genetic code like -st NT2AA5 for the Invertebrate Mitochondrial Code (see genetic code table).]]> 279 <br/><i>-st</i> NT2AA tells IQ-TREE to translate protein-coding DNA into AA sequences and then subsequent analysis will work on the AA sequences. You can also use a genetic code like -st NT2AA5 for the Invertebrate Mitochondrial Code (see genetic code table).]]>
282 </help> 280 </help>
283 <option value="DNA">DNA</option> 281 <option value="DNA">DNA</option>
284 <option value="AA">AA</option> 282 <option value="AA">AA</option>
285 <option value="BIN">BIN</option> 283 <option value="BIN">BIN</option>
286 <option value="MORPH">MORPH</option> 284 <option value="MORPH">MORPH</option>
287 <option value="CODON">CODON</option> 285 <option value="CODON">CODON</option>
288 <option value="NT2AA">NT2AA</option> 286 <option value="NT2AA">NT2AA</option>
289 </param> 287 </param>
290 <param argument="-t" type="data" format="nhx" optional="true" label="Specify a file containing starting tree for tree search"/> 288 <param argument="-t" type="data" format="nhx" optional="true" label="Specify a file containing starting tree for tree search"/>
291 <param argument="-te" type="data" format="nhx" optional="true" label="Like -t but fixing user tree" help="That means, no tree search is performed and IQ-TREE computes the log-likelihood of the fixed user tree."/> 289 <param argument="-te" type="data" format="nhx" optional="true" label="Like -t but fixing user tree" help="That means, no tree search is performed and IQ-TREE computes the log-likelihood of the fixed user tree."/>
292 <param argument="-seed" type="integer" optional="true" label="Specify a random number seed to reproduce a previous run (leave blank to randomize)"/> 290 <param argument="-seed" type="integer" optional="true" label="Specify a random number seed to reproduce a previous run (leave blank to randomize)"/>
293 <param argument="-keep_ident" type="boolean" truevalue="-keep-ident" falsevalue="" checked="false" label="Keep identical sequences in the alignment" help="By default: IQ-TREE will remove them during the analysis and add them in the end."/> 291 <param argument="-keep_ident" type="boolean" truevalue="-keep-ident" falsevalue="" checked="false" label="Keep identical sequences in the alignment" help="By default: IQ-TREE will remove them during the analysis and add them in the end."/>
294 <param argument="-safe" type="boolean" truevalue="-safe" falsevalue="" checked="false" label="Turn on safe numerical mode to avoid numerical underflow for large data sets with many sequences (typically in the order of thousands)" help="This mode is automatically turned on when having more than 2000 sequences."/> 292 <param argument="-safe" type="boolean" truevalue="-safe" falsevalue="" checked="false" label="Turn on safe numerical mode to avoid numerical underflow for large data sets with many sequences (typically in the order of thousands)" help="This mode is automatically turned on when having more than 2000 sequences."/>
295 </section> 293 </section>
296 <section name="likelihood_mapping" expanded="False" title="Likelihood mapping analysis"> 294 <section name="likelihood_mapping" expanded="False" title="Likelihood mapping analysis">
297 <param argument="-lmap" type="integer" optional="true" label="Specify the number of quartets to be randomly drawn" help="If you specify -lmap ALL, all unique quartets will be drawn, instead."/> 295 <param argument="-lmap" type="integer" optional="true" label="Specify the number of quartets to be randomly drawn" help="If you specify -lmap ALL, all unique quartets will be drawn, instead."/>
298 <param argument="-lmclust" type="data" format="txt" optional="true" label="Specify a NEXUS file containing taxon clusters (see below for example) for quartet mapping analysis."/> 296 <param argument="-lmclust" type="data" format="txt" optional="true" label="Specify a NEXUS file containing taxon clusters (see below for example) for quartet mapping analysis."/>
299 <param argument="-wql" type="boolean" truevalue="-wql" falsevalue="" checked="false" label="Write quartet log-likelihoods into .lmap.quartetlh file (typically not needed)."/> 297 <param argument="-wql" type="boolean" truevalue="-wql" falsevalue="" checked="false" label="Write quartet log-likelihoods into .lmap.quartetlh file (typically not needed)."/>
300 </section> 298 </section>
301 <section name="modelling_parameters" title="Modelling Parameters"> 299 <section name="modelling_parameters" title="Modelling Parameters">
302 <section name="automatic_model" expanded="False" title="Automatic model selection"> 300 <section name="automatic_model" expanded="False" title="Automatic model selection">
303 <conditional name="cond_model" > 301 <conditional name="cond_model" >
304 <param name="opt_custommodel" type="boolean" checked="false" label="Use Custom Model" help="See http://www.iqtree.org/doc/Substitution-Models"/> 302 <param name="opt_custommodel" type="boolean" checked="false" label="Use Custom Model" help="See http://www.iqtree.org/doc/Substitution-Models"/>
305 <when value="true"> 303 <when value="true">
306 <param argument="-m" type="text" label="Model"> 304 <param argument="-m" type="text" label="Model">
307 <sanitizer> 305 <sanitizer>
308 <valid initial="string.ascii_uppercase,+" /> 306 <valid initial="string.ascii_uppercase,+" />
309 </sanitizer> 307 </sanitizer>
310 </param> 308 </param>
311 </when> 309 </when>
312 <when value="false"> 310 <when value="false">
313 <param argument="-m" type="select" label="Perform standard model selection like jModelTest (for DNA) and ProtTest (for protein)" > 311 <param argument="-m" type="select" label="Perform standard model selection like jModelTest (for DNA) and ProtTest (for protein)" >
314 <help><![CDATA[ 312 <help><![CDATA[
315 Moreover, IQ-TREE also works for codon, binary and morphogical data. 313 <b>Note:</b> Only <code>TEST</code> and custom models that do not rely on <code>MF</code> can be used in conjunction with bootstrap parameters (-b)<br/><br/>
314 IQ-TREE also works for codon, binary and morphogical data.
316 <table> 315 <table>
317 <tr> 316 <tr>
318 <td><i>TESTONLY</i></td> 317 <td><i>TESTONLY</i></td>
319 <td>Perform standard model selection like jModelTest (for DNA) and ProtTest (for protein). Moreover, IQ-TREE also works for codon, binary and morphogical data.</td> 318 <td>Perform standard model selection like jModelTest (for DNA) and ProtTest (for protein). Moreover, IQ-TREE also works for codon, binary and morphogical data.</td>
320 </tr> 319 </tr>
346 <td><i>TESTNEWMERGE</i></td> 345 <td><i>TESTNEWMERGE</i></td>
347 <td>Like -m MF+MERGE but immediately followed by tree reconstruction using the best partitioning scheme found.</td> 346 <td>Like -m MF+MERGE but immediately followed by tree reconstruction using the best partitioning scheme found.</td>
348 </tr> 347 </tr>
349 </table> 348 </table>
350 ]]> 349 ]]>
351 </help> 350 </help>
352 <option value="TESTONLY">TESTONLY</option> 351 <option value="" selected="true">(None)</option>
353 <option value="TEST">TEST</option> 352 <option value="TESTONLY">TESTONLY</option>
354 <option value="TESTNEWONLY">TESTNEWONLY</option> 353 <option value="TEST">TEST</option>
355 <option value="TESTNEW">TESTNEW</option> 354 <option value="TESTNEWONLY">TESTNEWONLY</option>
356 <option value="TESTMERGEONLY">TESTMERGEONLY</option> 355 <option value="TESTNEW">TESTNEW</option>
357 <option value="TESTMERGE">TESTMERGE</option> 356 <option value="TESTMERGEONLY">TESTMERGEONLY</option>
358 <option value="TESTNEWMERGEONLY">TESTNEWMERGEONLY</option> 357 <option value="TESTMERGE">TESTMERGE</option>
359 <option value="TESTNEWMERGE">TESTNEWMERGE</option> 358 <option value="TESTNEWMERGEONLY">TESTNEWMERGEONLY</option>
360 </param> 359 <option value="TESTNEWMERGE">TESTNEWMERGE</option>
361 </when> 360 </param>
362 </conditional> 361 </when>
363 <param argument="-rcluster" type="integer" optional="true" label="Specify the percentage for the relaxed clustering algorithm (Lanfear et al., 2014)" help="This is similar to --rcluster-percent option of PartitionFinder. For example, with -rcluster 10 only the top 10% partition schemes are considered to save computations." /> 362 </conditional>
364 <param argument="-mset" type="text" optional="true" label="Specify the name of a program (raxml, phyml or mrbayes) to restrict to only those models supported by the specified program" help="Alternatively, one can specify a comma-separated list of base models. For example, -mset WAG,LG,JTT will restrict model selection to WAG, LG, and JTT instead of all 18 AA models to save computations."> 363 <param argument="-rcluster" type="integer" optional="true" label="Specify the percentage for the relaxed clustering algorithm (Lanfear et al., 2014)" help="This is similar to --rcluster-percent option of PartitionFinder. For example, with -rcluster 10 only the top 10% partition schemes are considered to save computations." />
365 <sanitizer> 364 <param argument="-mset" type="text" optional="true" label="Specify the name of a program (raxml, phyml or mrbayes) to restrict to only those models supported by the specified program" help="Alternatively, one can specify a comma-separated list of base models. For example, -mset WAG,LG,JTT will restrict model selection to WAG, LG, and JTT instead of all 18 AA models to save computations.">
366 <valid initial="string.ascii_uppercase,string.punctuation" /> 365 <sanitizer>
367 </sanitizer> 366 <valid initial="string.ascii_uppercase,string.punctuation" />
368 </param> 367 </sanitizer>
369 <param argument="-msub" type="select" label="Specify either nuclear, mitochondrial, chloroplast or viral to restrict to those AA models designed for specified source." help=""> 368 </param>
370 <option value="nuclear">nuclear</option> 369 <param argument="-msub" type="select" label="Specify either nuclear, mitochondrial, chloroplast or viral to restrict to those AA models designed for specified source." help="">
371 <option value="mitochondrial">mitochondrial</option> 370 <option value="nuclear">nuclear</option>
372 <option value="chloroplast">chloroplast</option> 371 <option value="mitochondrial">mitochondrial</option>
373 <option value="viral">viral</option> 372 <option value="chloroplast">chloroplast</option>
374 </param> 373 <option value="viral">viral</option>
375 <param argument="-mfreq" type="text" optional="true" label="Specify a comma-separated list of frequency types for model selection" > 374 </param>
376 <sanitizer> 375 <param argument="-mfreq" type="text" optional="true" label="Specify a comma-separated list of frequency types for model selection" >
377 <valid initial="string.ascii_uppercase,string.digits,x,string.punctuation" /> 376 <sanitizer>
378 </sanitizer> 377 <valid initial="string.ascii_uppercase,string.digits,x,string.punctuation" />
379 </param> 378 </sanitizer>
380 <param argument="-mrate" type="text" optional="true" label="Specify a comma-separated list of rate heterogeneity types for model selection"> 379 </param>
381 <sanitizer> 380 <param argument="-mrate" type="text" optional="true" label="Specify a comma-separated list of rate heterogeneity types for model selection">
382 <valid initial="string.ascii_uppercase,string.punctuation" /> 381 <sanitizer>
383 </sanitizer> 382 <valid initial="string.ascii_uppercase,string.punctuation" />
384 </param> 383 </sanitizer>
385 <param argument="-cmin" type="integer" value="2" optional="true" label="Specify minimum number of categories for FreeRate model"/> 384 </param>
386 <param argument="-cmax" type="integer" value="10" optional="true" label="Specify maximum number of categories for FreeRate model"/> 385 <param argument="-cmin" type="integer" value="2" optional="true" label="Specify minimum number of categories for FreeRate model"/>
387 <param argument="-merit" type="select" label="Specify either AIC, AICc or BIC for the optimality criterion to apply for new procedure" help=""> 386 <param argument="-cmax" type="integer" value="10" optional="true" label="Specify maximum number of categories for FreeRate model"/>
388 <option value="AIC">AIC</option> 387 <param argument="-merit" type="select" label="Specify either AIC, AICc or BIC for the optimality criterion to apply for new procedure" help="">
389 <option value="AICc">AICc</option> 388 <option value="AIC">AIC</option>
390 <option value="BIC">BIC</option> 389 <option value="AICc">AICc</option>
391 </param> 390 <option value="BIC">BIC</option>
392 <param argument="-mtree" type="boolean" truevalue="-mtree" falsevalue="" checked="false" label="Turn on full tree search for each model considered, to obtain more accurate result"/> 391 </param>
393 <param argument="-madd" type="text" optional="true" label="Specify a comma-separated list of mixture models to additionally consider for model selection" help="For example, -madd LG4M,LG4X to additionally include these two protein mixture models."> 392 <param argument="-mtree" type="boolean" truevalue="-mtree" falsevalue="" checked="false" label="Turn on full tree search for each model considered, to obtain more accurate result"/>
394 <sanitizer> 393 <param argument="-madd" type="text" optional="true" label="Specify a comma-separated list of mixture models to additionally consider for model selection" help="For example, -madd LG4M,LG4X to additionally include these two protein mixture models.">
395 <valid initial="string.ascii_uppercase,string.digits,string.punctuation" /> 394 <sanitizer>
396 </sanitizer> 395 <valid initial="string.ascii_uppercase,string.digits,string.punctuation" />
397 </param> 396 </sanitizer>
398 <param argument="-mdef" type="data" format="txt" optional="true" label="Specify a NEXUS model file to define new models."/> 397 </param>
399 </section> 398 <param argument="-mdef" type="data" format="txt" optional="true" label="Specify a NEXUS model file to define new models."/>
400 <section name="specifying_substitution" expanded="False" title="Specifying substitution models"> 399 </section>
401 <param argument="-mwopt" type="boolean" truevalue="-mwopt" falsevalue="" checked="false" label="Turn on optimizing weights of mixture models" help="Note that for models like LG+C20+F+G this mode is automatically turned on, but not for LG+C20+G."/> 400 <section name="specifying_substitution" expanded="False" title="Specifying substitution models">
402 </section> 401 <param argument="-mwopt" type="boolean" truevalue="-mwopt" falsevalue="" checked="false" label="Turn on optimizing weights of mixture models" help="Note that for models like LG+C20+F+G this mode is automatically turned on, but not for LG+C20+G."/>
403 <section name="rate_heterogeneity" expanded="False" title="Rate heterogeneity"> 402 </section>
404 <param argument="-a" type="text" optional="true" label="Specify the Gamma shape parameter (default: estimate)"> 403 <section name="rate_heterogeneity" expanded="False" title="Rate heterogeneity">
405 <sanitizer> 404 <param argument="-a" type="text" optional="true" label="Specify the Gamma shape parameter (default: estimate)">
406 <valid initial="string.printable" /> 405 <sanitizer>
407 </sanitizer> 406 <valid initial="string.printable" />
408 </param> 407 </sanitizer>
409 <param argument="-gmedian" type="boolean" truevalue="-gmedian" falsevalue="" checked="false" label="Perform the median approximation for Gamma rate heterogeneity instead of the default mean approximation (Yang, 1994)"/> 408 </param>
410 <param argument="-i" type="text" optional="true" label="Specify the proportion of invariable sites (default: estimate)"> 409 <param argument="-gmedian" type="boolean" truevalue="-gmedian" falsevalue="" checked="false" label="Perform the median approximation for Gamma rate heterogeneity instead of the default mean approximation (Yang, 1994)"/>
411 <sanitizer> 410 <param argument="-i" type="text" optional="true" label="Specify the proportion of invariable sites (default: estimate)">
412 <valid initial="string.printable" /> 411 <sanitizer>
413 </sanitizer> 412 <valid initial="string.printable" />
414 </param> 413 </sanitizer>
415 <param argument="--opt_gamma_inv" type="boolean" truevalue="--opt-gamma-inv" falsevalue="" checked="false" label="Perform more thorough estimation for +I+G model parameters"/> 414 </param>
416 <param argument="-wsr" type="boolean" truevalue="-wsr" falsevalue="" checked="false" label="Write per-site rates to .rate file"/> 415 <param argument="--opt_gamma_inv" type="boolean" truevalue="--opt-gamma-inv" falsevalue="" checked="false" label="Perform more thorough estimation for +I+G model parameters"/>
417 </section> 416 <param argument="-wsr" type="boolean" truevalue="-wsr" falsevalue="" checked="false" label="Write per-site rates to .rate file"/>
418 <section name="partition_model" expanded="False" title="Partition model options"> 417 </section>
419 <param argument="-q" type="data" format="txt" optional="true" label="Specify partition file for edge-equal partition model" help="That means, all partitions share the same set of branch lengths (like -q option of RAxML)."/> 418 <section name="partition_model" expanded="False" title="Partition model options">
420 <param argument="-spp" type="boolean" truevalue="-spp" falsevalue="" checked="false" label="Like -q but allowing partitions to have different evolutionary speeds (edge-proportional partition model)."/> 419 <param argument="-q" type="data" format="txt" optional="true" label="Specify partition file for edge-equal partition model" help="That means, all partitions share the same set of branch lengths (like -q option of RAxML)."/>
421 <param argument="-sp" type="data" format="txt" optional="true" label="Specify partition file for edge-unlinked partition model" help="That means, each partition has its own set of branch lengths (like -M option of RAxML). This is the most parameter-rich partition model to accomodate heterotachy."/> 420 <param argument="-spp" type="boolean" truevalue="-spp" falsevalue="" checked="false" label="Like -q but allowing partitions to have different evolutionary speeds (edge-proportional partition model)."/>
422 </section> 421 <param argument="-sp" type="data" format="txt" optional="true" label="Specify partition file for edge-unlinked partition model" help="That means, each partition has its own set of branch lengths (like -M option of RAxML). This is the most parameter-rich partition model to accomodate heterotachy."/>
423 <section name="site_specific_frequency" expanded="False" title="Site-specific frequency model options"> 422 </section>
424 <param argument="-ft" type="data" format="nhx" optional="true" label="Specify a guide tree to infer site frequency profiles."/> 423 <section name="site_specific_frequency" expanded="False" title="Site-specific frequency model options">
425 <param argument="-fs" type="float" optional="true" label="Specify a site frequency file, e.g" help="the .sitefreq file obtained from -ft run. This will save memory used for the first phase of the analysis."/> 424 <param argument="-ft" type="data" format="nhx" optional="true" label="Specify a guide tree to infer site frequency profiles."/>
426 <param argument="-fmax" type="boolean" truevalue="-fmax" falsevalue="" checked="false" label="Switch to posterior maximum mode for obtaining site-specific profiles" help="Default: posterior mean."/> 425 <param argument="-fs" type="float" optional="true" label="Specify a site frequency file, e.g" help="the .sitefreq file obtained from -ft run. This will save memory used for the first phase of the analysis."/>
427 </section> 426 <param argument="-fmax" type="boolean" truevalue="-fmax" falsevalue="" checked="false" label="Switch to posterior maximum mode for obtaining site-specific profiles" help="Default: posterior mean."/>
428 </section> 427 </section>
429 <section name="tree_parameters" title="Tree Parameters"> 428 </section>
430 <section name="tree_search" expanded="False" title="Tree search parameters"> 429 <section name="tree_parameters" title="Tree Parameters">
431 <param argument="-n" type="integer" optional="true" label="Skip subsequent tree search (n = 0), useful when you only want to assess the phylogenetic information of the alignment. Otherwise specify number of iterations to stop (this option overrides -nstop criterion)." /> 430 <section name="tree_search" expanded="False" title="Tree search parameters">
432 <param argument="-ninit" type="integer" value="100" optional="true" label="Specify number of initial parsimony trees"/> 431 <param argument="-n" type="integer" optional="true" label="Skip subsequent tree search (n = 0), useful when you only want to assess the phylogenetic information of the alignment. Otherwise specify number of iterations to stop (this option overrides -nstop criterion)." />
433 <param argument="-ntop" type="integer" value="20" optional="true" label="Specify number of top initial parsimony trees to optimize with ML nearest neighbor interchange (NNI) search to initialize the candidate set"/> 432 <param argument="-ninit" type="integer" value="100" optional="true" label="Specify number of initial parsimony trees"/>
434 <param argument="-nbest" type="integer" value="5" optional="true" label="Specify number of trees in the candidate set to maintain during ML tree search"/> 433 <param argument="-ntop" type="integer" value="20" optional="true" label="Specify number of top initial parsimony trees to optimize with ML nearest neighbor interchange (NNI) search to initialize the candidate set"/>
435 <param argument="-nstop" type="integer" value="100" optional="true" label="Specify number of unsuccessful iterations to stop"/> 434 <param argument="-nbest" type="integer" value="5" optional="true" label="Specify number of trees in the candidate set to maintain during ML tree search"/>
436 <param argument="-sprrad" type="integer" value="6" optional="true" label="Specify SPR radius for the initial parsimony tree search"/> 435 <param argument="-nstop" type="integer" value="100" optional="true" label="Specify number of unsuccessful iterations to stop"/>
437 <param argument="-pers" type="float" value="0.5" optional="true" label="Specify perturbation strength (between 0 and 1) for randomized NNI"/> 436 <param argument="-sprrad" type="integer" value="6" optional="true" label="Specify SPR radius for the initial parsimony tree search"/>
438 <param argument="-allnni" type="boolean" truevalue="-allnni" falsevalue="" checked="false" label="Turn on more thorough and slower NNI search"/> 437 <param argument="-pers" type="float" value="0.5" optional="true" label="Specify perturbation strength (between 0 and 1) for randomized NNI"/>
439 <param argument="-djc" type="boolean" truevalue="-djc" falsevalue="" checked="false" label="Avoid computing ML pairwise distances and BIONJ tree."/> 438 <param argument="-allnni" type="boolean" truevalue="-allnni" falsevalue="" checked="false" label="Turn on more thorough and slower NNI search"/>
440 <param argument="-g" type="data" format="txt" optional="true" label="Specify a topological constraint tree file in NEWICK format" help="The constraint tree can be a multifurcating tree and need not to include all taxa."/> 439 <param argument="-djc" type="boolean" truevalue="-djc" falsevalue="" checked="false" label="Avoid computing ML pairwise distances and BIONJ tree."/>
441 </section> 440 <param argument="-g" type="data" format="txt" optional="true" label="Specify a topological constraint tree file in NEWICK format" help="The constraint tree can be a multifurcating tree and need not to include all taxa."/>
442 <section name="single_branch" expanded="False" title="Single branch tests"> 441 </section>
443 <param argument="-alrt" type="integer" optional="true" label="Specify number of replicates (&gt;=1000) to perform SH-like approximate likelihood ratio test (SH-aLRT) (Guindon et al., 2010)" help="If number of replicates is set to 0 (-alrt 0), then the parametric aLRT test (Anisimova and Gascuel 2006) is performed, instead of SH-aLRT."/> 442 <section name="single_branch" expanded="False" title="Single branch tests">
444 <param argument="-abayes" type="boolean" truevalue="-abayes" falsevalue="" checked="false" label="Perform approximate Bayes test (Anisimova et al., 2011)."/> 443 <param argument="-alrt" type="integer" optional="true" label="Specify number of replicates (&gt;=1000) to perform SH-like approximate likelihood ratio test (SH-aLRT) (Guindon et al., 2010)" help="If number of replicates is set to 0 (-alrt 0), then the parametric aLRT test (Anisimova and Gascuel 2006) is performed, instead of SH-aLRT."/>
445 <param argument="-lbp" type="integer" optional="true" label="Specify number of replicates (&gt;=1000) to perform fast local bootstrap probability method (Adachi and Hasegawa, 1996)."/> 444 <param argument="-abayes" type="boolean" truevalue="-abayes" falsevalue="" checked="false" label="Perform approximate Bayes test (Anisimova et al., 2011)."/>
446 </section> 445 <param argument="-lbp" type="integer" optional="true" label="Specify number of replicates (&gt;=1000) to perform fast local bootstrap probability method (Adachi and Hasegawa, 1996)."/>
447 <section name="tree_topology" expanded="False" title="Tree topology tests"> 446 </section>
448 <param argument="-z" type="data" format="txt" optional="true" label="Specify a file containing a set of trees" help="IQ-TREE will compute the log-likelihoods of all trees."/> 447 <section name="tree_topology" expanded="False" title="Tree topology tests">
449 <param argument="-zb" type="integer" optional="true" label="Specify the number of RELL (Kishino et al., 1990) replicates (&gt;=1000) to perform several tree topology tests for all trees passed via -z" help="The tests include bootstrap proportion (BP), KH test (Kishino and Hasegawa, 1989), SH test (Shimodaira and Hasegawa, 1999) and expected likelihood weights (ELW) (Strimmer and Rambaut, 2002)."/> 448 <param argument="-z" type="data" format="txt" optional="true" label="Specify a file containing a set of trees" help="IQ-TREE will compute the log-likelihoods of all trees."/>
450 <param argument="-zw" type="boolean" truevalue="-zw" falsevalue="" checked="false" label="Used together with -zb to additionally perform the weighted-KH and weighted-SH tests."/> 449 <param argument="-zb" type="integer" optional="true" label="Specify the number of RELL (Kishino et al., 1990) replicates (&gt;=1000) to perform several tree topology tests for all trees passed via -z" help="The tests include bootstrap proportion (BP), KH test (Kishino and Hasegawa, 1989), SH test (Shimodaira and Hasegawa, 1999) and expected likelihood weights (ELW) (Strimmer and Rambaut, 2002)."/>
451 <param argument="-au" type="boolean" truevalue="-au" falsevalue="" checked="false" label="Used together with -zb to additionally perform the approximately unbiased (AU) test (Shimodaira, 2002)" help="Note that you have to specify the number of replicates for the AU test via -zb."/> 450 <param argument="-zw" type="boolean" truevalue="-zw" falsevalue="" checked="false" label="Used together with -zb to additionally perform the weighted-KH and weighted-SH tests."/>
452 </section> 451 <param argument="-au" type="boolean" truevalue="-au" falsevalue="" checked="false" label="Used together with -zb to additionally perform the approximately unbiased (AU) test (Shimodaira, 2002)" help="Note that you have to specify the number of replicates for the AU test via -zb."/>
453 <section name="constructing_consensus" expanded="False" title="Constructing consensus tree"> 452 </section>
454 <param argument="-con" type="boolean" truevalue="-con" falsevalue="" checked="false" label="Compute consensus tree of the trees passed via -t" help="Resulting consensus tree is written to .contree file."/> 453 <section name="constructing_consensus" expanded="False" title="Constructing consensus tree">
455 <param argument="-net" type="boolean" truevalue="-net" falsevalue="" checked="false" label="Compute consensus network of the trees passed via -t" help="Resulting consensus network is written to .nex file."/> 454 <param argument="-con" type="boolean" truevalue="-con" falsevalue="" checked="false" label="Compute consensus tree of the trees passed via -t" help="Resulting consensus tree is written to .contree file."/>
456 <param argument="-minsup" type="float" value="0.0" optional="true" label="Specify a minimum threshold (between 0 and 1) to keep branches in the consensus tree"/> 455 <param argument="-net" type="boolean" truevalue="-net" falsevalue="" checked="false" label="Compute consensus network of the trees passed via -t" help="Resulting consensus network is written to .nex file."/>
457 <param argument="-bi" type="integer" optional="true" label="Specify a burn-in, which is the number of beginning trees passed via -t to discard before consensus construction" help="This is useful e.g. when summarizing trees from MrBayes analysis."/> 456 <param argument="-minsup" type="float" value="0.0" optional="true" label="Specify a minimum threshold (between 0 and 1) to keep branches in the consensus tree"/>
458 <param argument="-sup" type="data" format="nhx" optional="true" label="Specify an input “target” tree file" help="That means, support values are first extracted from the trees passed via -t, and then mapped onto the target tree. Resulting tree with assigned support values is written to .suptree file. This option is useful to map and compare support values from different approaches onto a single tree."/> 457 <param argument="-bi" type="integer" optional="true" label="Specify a burn-in, which is the number of beginning trees passed via -t to discard before consensus construction" help="This is useful e.g. when summarizing trees from MrBayes analysis."/>
459 <param argument="-suptag" type="text" optional="true" label="Specify name of a node in -sup target tree" help="The corresponding node of .suptree will then be assigned with IDs of trees where this node appears. Special option -suptag ALL will assign such IDs for all nodes of the target tree."/> 458 <param argument="-sup" type="data" format="nhx" optional="true" label="Specify an input “target” tree file" help="That means, support values are first extracted from the trees passed via -t, and then mapped onto the target tree. Resulting tree with assigned support values is written to .suptree file. This option is useful to map and compare support values from different approaches onto a single tree."/>
460 </section> 459 <param argument="-suptag" type="text" optional="true" label="Specify name of a node in -sup target tree" help="The corresponding node of .suptree will then be assigned with IDs of trees where this node appears. Special option -suptag ALL will assign such IDs for all nodes of the target tree."/>
461 <section name="computing_robinson_foulds" expanded="False" title="Computing Robinson-Foulds distance"> 460 </section>
462 <param argument="-rf" type="data" format="nhx" optional="true" label="Specify a second set of trees" help="IQ-TREE computes all pairwise RF distances between two tree sets passed via -t and -rf"/> 461 <section name="computing_robinson_foulds" expanded="False" title="Computing Robinson-Foulds distance">
463 <param argument="-rf_all" type="boolean" truevalue="-rf_all" falsevalue="" checked="false" label="Compute all-to-all RF distances between all trees passed via -t"/> 462 <param argument="-rf" type="data" format="nhx" optional="true" label="Specify a second set of trees" help="IQ-TREE computes all pairwise RF distances between two tree sets passed via -t and -rf"/>
464 <param argument="-rf_adj" type="boolean" truevalue="-rf_adj" falsevalue="" checked="false" label="Compute RF distances between adjacent trees passed via -t"/> 463 <param argument="-rf_all" type="boolean" truevalue="-rf_all" falsevalue="" checked="false" label="Compute all-to-all RF distances between all trees passed via -t"/>
465 </section> 464 <param argument="-rf_adj" type="boolean" truevalue="-rf_adj" falsevalue="" checked="false" label="Compute RF distances between adjacent trees passed via -t"/>
466 <section name="generating_random" expanded="False" title="Generating random trees"> 465 </section>
467 <param argument="-r" type="integer" optional="true" label="Specify number of taxa" help="IQ-TREE will create a random tree under Yule-Harding model with specified number of taxa"/> 466 <section name="generating_random" expanded="False" title="Generating random trees">
468 <param argument="-ru" type="boolean" truevalue="-ru" falsevalue="" checked="false" label="Like -r, but a random tree is created under uniform model."/> 467 <param argument="-r" type="integer" optional="true" label="Specify number of taxa" help="IQ-TREE will create a random tree under Yule-Harding model with specified number of taxa"/>
469 <param argument="-rcat" type="boolean" truevalue="-rcat" falsevalue="" checked="false" label="Like -r, but a random caterpillar tree is created."/> 468 <param argument="-ru" type="boolean" truevalue="-ru" falsevalue="" checked="false" label="Like -r, but a random tree is created under uniform model."/>
470 <param argument="-rbal" type="boolean" truevalue="-rbal" falsevalue="" checked="false" label="Like -r, but a random balanced tree is created."/> 469 <param argument="-rcat" type="boolean" truevalue="-rcat" falsevalue="" checked="false" label="Like -r, but a random caterpillar tree is created."/>
471 <param argument="-rcsg" type="boolean" truevalue="-rcsg" falsevalue="" checked="false" label="Like -r, bur a random circular split network is created."/> 470 <param argument="-rbal" type="boolean" truevalue="-rbal" falsevalue="" checked="false" label="Like -r, but a random balanced tree is created."/>
472 <param argument="-rlen" type="text" optional="true" label="Specify three numbers: minimum, mean and maximum branch lengths of the random tree"> 471 <param argument="-rcsg" type="boolean" truevalue="-rcsg" falsevalue="" checked="false" label="Like -r, bur a random circular split network is created."/>
473 <sanitizer> 472 <param argument="-rlen" type="text" optional="true" label="Specify three numbers: minimum, mean and maximum branch lengths of the random tree">
474 <valid initial="string.digits,string.whitespace" /> 473 <sanitizer>
475 </sanitizer> 474 <valid initial="string.digits,string.whitespace" />
476 </param> 475 </sanitizer>
477 </section> 476 </param>
478 </section> 477 </section>
479 <section name="bootstrap_parameters" title="Bootstrap Parameters"> 478 </section>
480 <section name="ultrafast_bootstrap" expanded="False" title="Ultrafast bootstrap parameters"> 479 <section name="bootstrap_parameters" title="Bootstrap Parameters">
481 <param argument="-bb" type="integer" optional="true" label="Specify number of bootstrap replicates (&gt;=1000)."/> 480 <section name="ultrafast_bootstrap" expanded="False" title="Ultrafast bootstrap parameters">
482 <param argument="-wbt" type="boolean" truevalue="-wbt" falsevalue="" checked="false" label="Turn on writing bootstrap trees to .ufboot file"/> 481 <param argument="-bb" type="integer" optional="true" label="Specify number of bootstrap replicates (&gt;=1000)."/>
483 <param argument="-wbtl" type="boolean" truevalue="-wbtl" falsevalue="" checked="false" label="Like -wbt but bootstrap trees written with branch lengths"/> 482 <param argument="-wbt" type="boolean" truevalue="-wbt" falsevalue="" checked="false" label="Turn on writing bootstrap trees to .ufboot file"/>
484 <param argument="-nm" type="integer" value="1000" optional="true" label="Specify maximum number of iterations to stop"/> 483 <param argument="-wbtl" type="boolean" truevalue="-wbtl" falsevalue="" checked="false" label="Like -wbt but bootstrap trees written with branch lengths"/>
485 <param argument="-bcor" type="float" value="0.99" optional="true" label="Specify minimum correlation coefficient for UFBoot convergence criterion"/> 484 <param argument="-nm" type="integer" value="1000" optional="true" label="Specify maximum number of iterations to stop"/>
486 <param argument="-nstep" type="integer" value="100" optional="true" label="Specify iteration interval checking for UFBoot convergence"/> 485 <param argument="-bcor" type="float" value="0.99" optional="true" label="Specify minimum correlation coefficient for UFBoot convergence criterion"/>
487 <param argument="-beps" type="float" value="0.5" optional="true" label="Specify a small epsilon to break tie in RELL evaluation for bootstrap trees"/> 486 <param argument="-nstep" type="integer" value="100" optional="true" label="Specify iteration interval checking for UFBoot convergence"/>
488 <param argument="-bspec" type="text" optional="true" label="Specify the resampling strategies for partitioned analysis" help="By default, IQ-TREE resamples alignment sites within partitions. With -bspec GENE IQ-TREE will resample partitions. With -bspec GENESITE IQ-TREE will resample partitions and then resample sites within resampled partitions (Gadagkar et al., 2005)."> 487 <param argument="-beps" type="float" value="0.5" optional="true" label="Specify a small epsilon to break tie in RELL evaluation for bootstrap trees"/>
489 <sanitizer> 488 <param argument="-bspec" type="text" optional="true" label="Specify the resampling strategies for partitioned analysis" help="By default, IQ-TREE resamples alignment sites within partitions. With -bspec GENE IQ-TREE will resample partitions. With -bspec GENESITE IQ-TREE will resample partitions and then resample sites within resampled partitions (Gadagkar et al., 2005).">
490 <valid initial="string.ascii_uppercase" /> 489 <sanitizer>
491 </sanitizer> 490 <valid initial="string.ascii_uppercase" />
492 </param> 491 </sanitizer>
493 <param argument="-bnni" type="boolean" truevalue="-bnni" falsevalue="" checked="false" label="Perform an additional step to further optimize UFBoot trees by nearest neighbor interchange (NNI) based directly on bootstrap alignments" help="This option is recommended in the presence of severe model violations. It increases computing time by 2-fold but reduces the risk of overestimating branch supports due to severe model violations. Introduced in IQ-TREE 1.6."/> 492 </param>
494 </section> 493 <param argument="-bnni" type="boolean" truevalue="-bnni" falsevalue="" checked="false" label="Perform an additional step to further optimize UFBoot trees by nearest neighbor interchange (NNI) based directly on bootstrap alignments" help="This option is recommended in the presence of severe model violations. It increases computing time by 2-fold but reduces the risk of overestimating branch supports due to severe model violations. Introduced in IQ-TREE 1.6."/>
495 <section name="nonparametric_bootstrap" expanded="False" title="Nonparametric bootstrap"> 494 </section>
496 <param argument="-b" type="integer" optional="true" label="Specify number of bootstrap replicates (recommended &gt;=100)" help="This will perform both bootstrap and analysis on original alignment and provide a consensus tree."/> 495 <section name="nonparametric_bootstrap" expanded="False" title="Nonparametric bootstrap">
497 <param argument="-bc" type="boolean" truevalue="-bc" falsevalue="" checked="false" label="Like -b but omit analysis on original alignment."/> 496 <param argument="-b" type="integer" optional="true" label="Specify number of bootstrap replicates (recommended &gt;=100)" help="This will perform both bootstrap and analysis on original alignment and provide a consensus tree."/>
498 <param argument="-bo" type="boolean" truevalue="-bo" falsevalue="" checked="false" label="Like -b but only perform bootstrap analysis (no analysis on original alignment and no consensus tree)."/> 497 <param argument="-bc" type="boolean" truevalue="-bc" falsevalue="" checked="false" label="Like -b but omit analysis on original alignment."/>
499 </section> 498 <param argument="-bo" type="boolean" truevalue="-bo" falsevalue="" checked="false" label="Like -b but only perform bootstrap analysis (no analysis on original alignment and no consensus tree)."/>
500 </section> 499 </section>
501 <section name="miscellaneous_options" expanded="False" title="Miscellaneous options"> 500 </section>
502 <param argument="-fconst" type="text" optional="true" label="Specify a list of comma-separated integer numbers" help="The number of entries should be equal to the number of states in the model (e.g. 4 for DNA and 20 for protein). IQ-TREE will then add a number of constant sites accordingly. For example, -fconst 10,20,15,40 will add 10 constant sites of all A, 20 constant sites of all C, 15 constant sites of all G and 40 constant sites of all T into the alignment."> 501 <section name="miscellaneous_options" expanded="False" title="Miscellaneous options">
503 <sanitizer> 502 <param argument="-fconst" type="text" optional="true" label="Specify a list of comma-separated integer numbers" help="The number of entries should be equal to the number of states in the model (e.g. 4 for DNA and 20 for protein). IQ-TREE will then add a number of constant sites accordingly. For example, -fconst 10,20,15,40 will add 10 constant sites of all A, 20 constant sites of all C, 15 constant sites of all G and 40 constant sites of all T into the alignment.">
504 <valid initial="string.digits,string.punctuation" /> 503 <sanitizer>
505 </sanitizer> 504 <valid initial="string.digits,string.punctuation" />
506 </param> 505 </sanitizer>
507 </section> 506 </param>
507 </section>
508 </inputs> 508 </inputs>
509 <outputs> 509 <outputs>
510 <data name='bionj' format='nhx' from_work_dir="*.bionj" label="${tool.name} on ${on_string}: BIONJ Tree" /> 510 <data name='bionj' format='nhx' from_work_dir="*.bionj" label="${tool.name} on ${on_string}: BIONJ Tree" />
511 <data name='treefile' format='nhx' from_work_dir="*.treefile" label="${tool.name} on ${on_string}: MaxLikelihood Tree" /> 511 <data name='treefile' format='nhx' from_work_dir="*.treefile" label="${tool.name} on ${on_string}: MaxLikelihood Tree" />
512 <data name='contree' format='nhx' from_work_dir="*.contree" label="${tool.name} on ${on_string}: Consensus Tree" /> 512 <data name='contree' format='nhx' from_work_dir="*.contree" label="${tool.name} on ${on_string}: Consensus Tree" />
513 <data name='mldist' format='mldist' from_work_dir="*.mldist" label="${tool.name} on ${on_string}: MaxLikelihood Distance Matrix"/> 513 <data name='mldist' format='mldist' from_work_dir="*.mldist" label="${tool.name} on ${on_string}: MaxLikelihood Distance Matrix"/>
514 <data name='splits.nex' format='nex' from_work_dir="*.splits.nex" label="${tool.name} on ${on_string}: Occurence Frequencies in Bootstrap Trees" /> 514 <data name='splits.nex' format='nex' from_work_dir="*.splits.nex" label="${tool.name} on ${on_string}: Occurence Frequencies in Bootstrap Trees" />
515 <data name='iqtree' format='iqtree' from_work_dir="*.iqtree" label="${tool.name} on ${on_string}: Report and Final Tree" /> 515 <data name='iqtree' format='iqtree' from_work_dir="*.iqtree" label="${tool.name} on ${on_string}: Report and Final Tree" />
516 </outputs> 516 </outputs>
517 <tests> 517 <tests>
518 <test> 518 <test>
519 <param name="seed" value="1257" /> 519 <param name="seed" value="1257" />
520 <param name="st" value="AA" /> 520 <param name="st" value="AA" />
521 <param name="s" value="example.phy" /> 521 <param name="s" value="example.phy" />
522 <param name="m" value="TESTNEW" /> 522 <param name="m" value="TESTNEW" />
523 <param name="msub" value="nuclear" /> 523 <param name="msub" value="nuclear" />
524 <param name="madd" value="LG4M,LG4X" /> 524 <param name="madd" value="LG4M,LG4X" />
525 <param name="merit" value="AICc" /> 525 <param name="merit" value="AICc" />
526 <param name="bb" value="2000" /> 526 <param name="bb" value="1000" />
527 <output name='bionj'> 527 <output name='bionj'>
528 <assert_contents> 528 <assert_contents>
529 <has_text_matching expression=".*Human.*Whale.*" /> 529 <has_text_matching expression=".*Human.*Whale.*" />
530 </assert_contents> 530 </assert_contents>
531 </output> 531 </output>
554 </output> 554 </output>
555 <output name='splits.nex'> 555 <output name='splits.nex'>
556 <assert_contents> 556 <assert_contents>
557 <has_line line="BEGIN Splits;" /> 557 <has_line line="BEGIN Splits;" />
558 <has_line line="END; [Splits]" /> 558 <has_line line="END; [Splits]" />
559 </assert_contents>
560 </output>
561 </test>
562 <test>
563 <!-- bootstrap sans model -->
564 <param name="seed" value="1257" />
565 <param name="st" value="AA" />
566 <param name="s" value="example.phy" />
567 <!-- <param name="m" value="TESTONLY" /> -->
568 <param name="msub" value="nuclear" />
569 <param name="cmin" value="2" />
570 <param name="cmax" value="10" />
571 <param name="merit" value="AICc" />
572 <param name="madd" value="LG4M,LG4X" />
573 <param name="ninit" value="100" />
574 <param name="ntop" value="20" />
575 <param name="nbest" value="5" />
576 <param name="nstop" value="100" />
577 <param name="sprrad" value="6" />
578 <param name="pers" value="0.5" />
579 <param name="minsup" value="0.0" />
580 <param name="nm" value="1000" />
581 <param name="bcor" value="0.99" />
582 <param name="nstep" value="100" />
583 <param name="beps" value="0.5" />
584 <param name="b" value="2" />
585 <output name='iqtree'>
586 <assert_contents>
587 <has_text_matching expression="VT\+F\+I(\s+((-|\d|\.)+))+" />
588 </assert_contents>
589 </output>
590 <output name='treefile'>
591 <assert_contents>
592 <has_line_matching expression="\(LngfishAu:(\d|\..)+,\(LngfishSA:(\d.)+,.*" />
593 </assert_contents>
594 </output>
595 </test>
596 <test>
597 <!-- model sans bootstrap -->
598 <param name="seed" value="1257" />
599 <param name="st" value="AA" />
600 <param name="s" value="example.phy" />
601 <param name="m" value="TESTONLY" />
602 <param name="msub" value="nuclear" />
603 <param name="cmin" value="2" />
604 <param name="cmax" value="10" />
605 <param name="merit" value="AICc" />
606 <param name="madd" value="LG4M,LG4X" />
607 <param name="ninit" value="100" />
608 <param name="ntop" value="20" />
609 <param name="nbest" value="5" />
610 <param name="nstop" value="100" />
611 <param name="sprrad" value="6" />
612 <param name="pers" value="0.5" />
613 <param name="minsup" value="0.0" />
614 <param name="nm" value="1000" />
615 <param name="bcor" value="0.99" />
616 <param name="nstep" value="100" />
617 <param name="beps" value="0.5" />
618 <!-- <param name="b" value="100" /> -->
619 <output name='iqtree'>
620 <assert_contents>
621 <has_text_matching expression="VT\+F\+I(\s+((-|\d|\.)+))+" />
622 </assert_contents>
623 </output>
624 <output name='treefile'>
625 <assert_contents>
626 <has_line_matching expression="\(LngfishAu:(\d|\..)+,\(LngfishSA:(\d.)+,.*" />
559 </assert_contents> 627 </assert_contents>
560 </output> 628 </output>
561 </test> 629 </test>
562 <test> 630 <test>
563 <param name='s' value='example.phy' /> 631 <param name='s' value='example.phy' />
604 672
605 This tiny alignment contains 7 DNA sequences from several animals with the sequence length of 28 nucleotides. IQ-TREE also supports other file formats such as FASTA, NEXUS, CLUSTALW. The FASTA file for the above example may look like this: 673 This tiny alignment contains 7 DNA sequences from several animals with the sequence length of 28 nucleotides. IQ-TREE also supports other file formats such as FASTA, NEXUS, CLUSTALW. The FASTA file for the above example may look like this:
606 674
607 :: 675 ::
608 676
609 >Frog 677 >Frog
610 AAATTTGGTCCTGTGATTCAGCAGTGAT 678 AAATTTGGTCCTGTGATTCAGCAGTGAT
611 >Turtle 679 >Turtle
612 CTTCCACACCCCAGGACTCAGCAGTGAT 680 CTTCCACACCCCAGGACTCAGCAGTGAT
613 >Bird 681 >Bird
614 CTACCACACCCCAGGACTCAGCAGTAAT 682 CTACCACACCCCAGGACTCAGCAGTAAT
615 >Human 683 >Human
616 CTACCACACCCCAGGAAACAGCAGTGAT 684 CTACCACACCCCAGGAAACAGCAGTGAT
617 >Cow 685 >Cow
618 CTACCACACCCCAGGAAACAGCAGTGAC 686 CTACCACACCCCAGGAAACAGCAGTGAC
619 >Whale 687 >Whale
620 CTACCACGCCCCAGGACACAGCAGTGAT 688 CTACCACGCCCCAGGACACAGCAGTGAT
621 >Mouse 689 >Mouse
622 CTACCACACCCCAGGACTCAGCAGTGAT 690 CTACCACACCCCAGGACTCAGCAGTGAT
623 691
624 **NOTE**: If you have raw sequences, you need to first apply alignment programs like MAFFT_ or ClustalW_ to align the sequences, before feeding them into IQ-TREE. 692 **NOTE**: If you have raw sequences, you need to first apply alignment programs like MAFFT_ or ClustalW_ to align the sequences, before feeding them into IQ-TREE.
625 693
626 .. _MAFFT: http://mafft.cbrc.jp/alignment/software/ 694 .. _MAFFT: http://mafft.cbrc.jp/alignment/software/
627 .. _ClustalW: http://www.clustal.org 695 .. _ClustalW: http://www.clustal.org
628 696
654 * **-madd** provides an additional selection mixed models 722 * **-madd** provides an additional selection mixed models
655 723
656 * **-merit** asserts the type of optimality criterion 724 * **-merit** asserts the type of optimality criterion
657 725
658 * **-bb** defines the number of replicates 726 * **-bb** defines the number of replicates
659 727
660 728
661 Each of these parameters are available under the relevant sub-sections in the main tool interface. 729 Each of these parameters are available under the relevant sub-sections in the main tool interface.
662 730
663 At the end of the run IQ-TREE will write several output files including: 731 At the end of the run IQ-TREE will write several output files including:
664 732
665 * **example.phy.iqtree**: the main report file that is self-readable. You should look at this file to see the computational results. It also contains a textual representation of the final tree (see below). 733 * **example.phy.iqtree**: the main report file that is self-readable. You should look at this file to see the computational results. It also contains a textual representation of the final tree (see below).
666 734
667 * **example.phy.treefile**: the ML tree in NEWICK format, which can be visualized by any supported tree viewer programs like FigTree or iTOL. 735 * **example.phy.treefile**: the ML tree in NEWICK format, which can be visualized by any supported tree viewer programs like FigTree or iTOL.
704 | | +---------| 772 | | +---------|
705 | | +--------Rat 773 | | +--------Rat
706 +----------| 774 +----------|
707 | +----------------Platypus 775 | +----------------Platypus
708 +---| 776 +---|
709 +-------------Opossum 777 +-------------Opossum
710 778
711 779
712 This makes sense as the mammals (**Human** to **Opossum**) form a clade, whereas the reptiles **Turtle** to **Crocodile**) and **Bird** form a separate sister clade. Here the tree is drawn at the *outgroup* Lungfish which is more accient than other species in this example. However, please note that IQ-TREE always produces an **unrooted tree** as it knows nothing about this biological background; IQ-TREE simply draws the tree this way as **LngfishAu** is the first sequence occuring in the alignment. 780 This makes sense as the mammals (**Human** to **Opossum**) form a clade, whereas the reptiles **Turtle** to **Crocodile**) and **Bird** form a separate sister clade. Here the tree is drawn at the *outgroup* Lungfish which is more accient than other species in this example. However, please note that IQ-TREE always produces an **unrooted tree** as it knows nothing about this biological background; IQ-TREE simply draws the tree this way as **LngfishAu** is the first sequence occuring in the alignment.
713 781
714 Choosing the right substitution model 782 Choosing the right substitution model
729 797
730 IQ-TREE supports a number of codon models. You need to input a protein-coding DNA alignment and specify codon data by option **-st CODON** (Otherwise, IQ-TREE applies DNA model because it detects that your alignment has DNA sequences): 798 IQ-TREE supports a number of codon models. You need to input a protein-coding DNA alignment and specify codon data by option **-st CODON** (Otherwise, IQ-TREE applies DNA model because it detects that your alignment has DNA sequences):
731 799
732 :: 800 ::
733 801
734 iqtree -s coding_gene.phy -st CODON 802 iqtree -s coding_gene.phy -st CODON
735 803
736 If your alignment length is not divisible by 3, IQ-TREE will stop with an error message. IQ-TREE will group sites 1,2,3 into codon site 1; sites 4,5,6 to codon site 2; etc. Moreover, any codon, which has at least one gap/unknown/ambiguous nucleotide, will be treated as unknown codon character. 804 If your alignment length is not divisible by 3, IQ-TREE will stop with an error message. IQ-TREE will group sites 1,2,3 into codon site 1; sites 4,5,6 to codon site 2; etc. Moreover, any codon, which has at least one gap/unknown/ambiguous nucleotide, will be treated as unknown codon character.
737 805
738 Note that the above command assumes the standard genetic code. If your sequences follow 'The Invertebrate Mitochondrial Code', then run: 806 Note that the above command assumes the standard genetic code. If your sequences follow 'The Invertebrate Mitochondrial Code', then run:
739 807
740 :: 808 ::
741 809
742 iqtree -s coding_gene.phy -st CODON5 810 iqtree -s coding_gene.phy -st CODON5
743 811
744 Note that ModelFinder works for codon alignments. IQ-TREE version >= 1.5.4 will automatically invokes ModelFinder to find the best-fit codon model. 812 Note that ModelFinder works for codon alignments. IQ-TREE version >= 1.5.4 will automatically invokes ModelFinder to find the best-fit codon model.
745 813
746 814
747 Assessing branch supports with ultrafast bootstrap approximation 815 Assessing branch supports with ultrafast bootstrap approximation
748 ---------------------------------------------------------------- 816 ----------------------------------------------------------------
749 817
750 To overcome the computational burden required by the nonparametric bootstrap, IQ-TREE introduces an ultrafast bootstrap approximation (UFBoot) ([Minh et al., 2013]) that is orders of magnitude faster than the standard procedure and provides relatively unbiased branch support values. Citation for UFBoot: 818 To overcome the computational burden required by the nonparametric bootstrap, IQ-TREE introduces an ultrafast bootstrap approximation (UFBoot) ([Minh et al., 2013]) that is orders of magnitude faster than the standard procedure and provides relatively unbiased branch support values. Citation for UFBoot:
751 819
752 B.Q. Minh, M.A.T. Nguyen, and A. von Haeseler (2013) Ultrafast approximation for phylogenetic bootstrap. _Mol. Biol. Evol., 30:1188-1195. 820 B.Q. Minh, M.A.T. Nguyen, and A. von Haeseler (2013) Ultrafast approximation for phylogenetic bootstrap. _Mol. Biol. Evol., 30:1188-1195.
753 821
754 :: 822 ::
755 823
756 iqtree -s example.phy -m TIM2+I+G -bb 1000 824 iqtree -s example.phy -m TIM2+I+G -bb 1000
757 825
786 The standard nonparametric bootstrap is invoked by the **-b** option: 854 The standard nonparametric bootstrap is invoked by the **-b** option:
787 855
788 iqtree -s example.phy -m TIM2+I+G -b 100 856 iqtree -s example.phy -m TIM2+I+G -b 100
789 857
790 **-b** specifies the number of bootstrap replicates where 100 858 **-b** specifies the number of bootstrap replicates where 100
791 is the minimum recommended number. The output files are similar to those produced by the UFBoot procedure. 859 is the minimum recommended number. The output files are similar to those produced by the UFBoot procedure.
792 860
793 861
794 862
795 Assessing branch supports with single branch tests 863 Assessing branch supports with single branch tests
796 -------------------------------------------------- 864 --------------------------------------------------
799 867
800 :: 868 ::
801 869
802 iqtree -s example.phy -m TIM2+I+G -alrt 1000 870 iqtree -s example.phy -m TIM2+I+G -alrt 1000
803 871
804 **-alrt** specifies the number of bootstrap replicates for SH-aLRT where 1000 is the minimum number recommended. 872 **-alrt** specifies the number of bootstrap replicates for SH-aLRT where 1000 is the minimum number recommended.
805 873
806 IQ-TREE also supports other tests such as the aBayes test (Anisimova et al., 2011) and the local bootstrap test (Adachi and Hasegawa, 1996). 874 IQ-TREE also supports other tests such as the aBayes test (Anisimova et al., 2011) and the local bootstrap test (Adachi and Hasegawa, 1996).
807 875
808 You can also perform both SH-aLRT and the ultrafast bootstrap within one single run: 876 You can also perform both SH-aLRT and the ultrafast bootstrap within one single run:
809 877