# HG changeset patch
# User iuc
# Date 1674585434 0
# Node ID f3fefb6d825468daa611c90b6c45fb78bb3e2ce4

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/isoformswitchanalyzer commit 2c61e4c6151000201dd9a8323722a380bc235380

diff -r 000000000000 -r f3fefb6d8254 IsoformSwitchAnalyzeR.R
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/IsoformSwitchAnalyzeR.R	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,924 @@
+# Load the IsoformSwitchAnalyzeR library
+library(IsoformSwitchAnalyzeR,
+        quietly = TRUE,
+        warn.conflicts = FALSE)
+library(argparse, quietly = TRUE, warn.conflicts = FALSE)
+library(dplyr, quietly = TRUE, warn.conflicts = FALSE)
+
+# setup R error handling to go to stderr
+options(
+  show.error.messages = FALSE,
+  error = function() {
+    cat(geterrmessage(), file = stderr())
+    q("no", 1, FALSE)
+  }
+)
+
+# we need that to not crash galaxy with an UTF8 error on German LC settings.
+loc <- Sys.setlocale("LC_MESSAGES", "en_US.UTF-8")
+
+################################################################################
+### Input Processing
+################################################################################
+
+
+# Collect arguments from command line
+parser <- ArgumentParser(description = "IsoformSwitcheR R script")
+
+parser$add_argument("--modeSelector")
+parser$add_argument("--parentDir",  required = FALSE, help = "Parent directory")
+parser$add_argument("--readLength",
+                    required = FALSE,
+                    type = "integer",
+                    help = "Read length (required for stringtie)")
+parser$add_argument("--annotation", required = FALSE, help = "Annotation")
+parser$add_argument("--transcriptome", required = FALSE, help = "Transcriptome")
+parser$add_argument(
+  "--fixStringTieAnnotationProblem",
+  action = "store_true",
+  required = FALSE,
+  help = "Fix StringTie annotation problem"
+)
+parser$add_argument("--countFiles", required = FALSE, help = "Count files")
+parser$add_argument("--toolSource", required = FALSE, help = "Tool source")
+parser$add_argument("--rObject", required = FALSE, help = "R object")
+parser$add_argument("--IFcutoff",
+                    required = FALSE,
+                    type = "numeric",
+                    help = "IFcutoff")
+parser$add_argument(
+  "--geneExpressionCutoff",
+  required = FALSE,
+  type = "numeric",
+  help = "Gene expression cutoff"
+)
+parser$add_argument(
+  "--isoformExpressionCutoff",
+  required = FALSE,
+  type = "numeric",
+  help = "Isoform expression cutoff"
+)
+parser$add_argument("--alpha",
+                    required = FALSE,
+                    type = "numeric",
+                    help = "")
+parser$add_argument("--dIFcutoff",
+                    required = FALSE,
+                    type = "numeric",
+                    help = "dIF cutoff")
+parser$add_argument(
+  "--onlySigIsoforms",
+  required = FALSE,
+  action = "store_true",
+  help = "Only significative isoforms"
+)
+parser$add_argument(
+  "--filterForConsequences",
+  required = FALSE,
+  action = "store_true",
+  help = "Filter for consequences"
+)
+parser$add_argument(
+  "--removeSingleIsformGenes",
+  required = FALSE,
+  action = "store_true",
+  help = "Remove single isoform genes"
+)
+parser$add_argument(
+  "--keepIsoformInAllConditions",
+  required = FALSE,
+  action = "store_true",
+  help = "Keep isoform in all conditions"
+)
+parser$add_argument(
+  "--correctForConfoundingFactors",
+  required = FALSE,
+  action = "store_true",
+  help = "Correct for confunding factors"
+)
+parser$add_argument(
+  "--overwriteIFvalues",
+  required = FALSE,
+  action = "store_true",
+  help = "Overwrite IF values"
+)
+parser$add_argument(
+  "--reduceToSwitchingGenes",
+  required = FALSE,
+  action = "store_true",
+  help = "Reduce to switching genes"
+)
+parser$add_argument(
+  "--reduceFurtherToGenesWithConsequencePotential",
+  required = FALSE,
+  action = "store_true",
+  help = "Reduce further to genes with consequence potential"
+)
+parser$add_argument(
+  "--keepIsoformInAllConditions2",
+  required = FALSE,
+  action = "store_true",
+  help = "Keep isoform in ll conditions"
+)
+parser$add_argument("--minORFlength",
+                    required = FALSE,
+                    type = "integer",
+                    help = "")
+parser$add_argument("--orfMethod", required = FALSE, help = "ORF methods")
+parser$add_argument("--PTCDistance",
+                    required = FALSE,
+                    type = "integer",
+                    help = "")
+parser$add_argument(
+  "--removeShortAAseq",
+  required = FALSE,
+  action = "store_true",
+  help = "Remove short aminoacid sequences"
+)
+parser$add_argument(
+  "--removeLongAAseq",
+  required = FALSE,
+  action = "store_true",
+  help = "Remove long aminoacid sequences"
+)
+parser$add_argument(
+  "--removeORFwithStop",
+  required = FALSE,
+  action = "store_true",
+  help = "Remove ORF with stop codon"
+)
+parser$add_argument(
+  "--onlySwitchingGenes",
+  required = FALSE,
+  action = "store_true",
+  help = "Only switching genes"
+)
+parser$add_argument("--analysisMode", required = FALSE, help = "Analyze all isoforms with differential usage or single genes")
+parser$add_argument(
+  "--genesToPlot",
+  type = "integer",
+  default = 10,
+  required = FALSE,
+  help = "Number of genes to plot"
+)
+parser$add_argument("--gene", required = FALSE, help = "Gene ID to analyze")
+parser$add_argument(
+  "--sortByQvals",
+  action = "store_true",
+  required = FALSE,
+  help = "Sort genes by Q-val values"
+)
+parser$add_argument("--countGenes",
+                    action = "store_true",
+                    required = FALSE,
+                    help = "Count genes")
+parser$add_argument(
+  "--asFractionTotal",
+  action = "store_true",
+  required = FALSE,
+  help = "Plot gene expresson as fraction of total"
+)
+parser$add_argument("--plotGenes",
+                    action = "store_true",
+                    required = FALSE,
+                    help = "Plot genes instead of isoforms")
+parser$add_argument(
+  "--simplifyLocation",
+  action = "store_true",
+  required = FALSE,
+  help = "Simplify localtion"
+)
+parser$add_argument(
+  "--removeEmptyConsequences",
+  action = "store_true",
+  required = FALSE,
+  help = "Remove empty consequences"
+)
+parser$add_argument(
+  "--analysisOppositeConsequence",
+  action = "store_true",
+  required = FALSE,
+  help = "Analysi opposite consequences"
+)
+parser$add_argument("--pathToCPATresultFile",
+                    required = FALSE,
+                    help = "Path to CPAT result file")
+parser$add_argument("--pathToCPC2resultFile",
+                    required = FALSE,
+                    help = "Path to CPC2 result file")
+parser$add_argument("--pathToPFAMresultFile",
+                    required = FALSE,
+                    help = "Path to PFAM result file")
+parser$add_argument("--pathToNetSurfP2resultFile",
+                    required = FALSE,
+                    help = "Path to NetSurfP2 result file")
+parser$add_argument("--pathToSignalPresultFile",
+                    required = FALSE,
+                    help = "Path to signalP result file")
+parser$add_argument("--pathToIUPred2AresultFile",
+                    required = FALSE,
+                    help = "Path to IUPred2A result file")
+parser$add_argument("--codingCutoff",
+                    required = FALSE,
+                    type = "numeric",
+                    help = "Codding cutoff")
+parser$add_argument(
+  "--removeNoncodingORFs",
+  action = "store_true",
+  required = FALSE,
+  help = "Remove non-coding ORFs"
+)
+parser$add_argument(
+  "--minSignalPeptideProbability",
+  required = FALSE,
+  type = "numeric",
+  help = "Minimul signal peptide probability"
+)
+parser$add_argument(
+  "--smoothingWindowSize",
+  type = "integer",
+  required = FALSE,
+  help = "Smoothing windows size"
+)
+parser$add_argument(
+  "--probabilityCutoff",
+  required = FALSE,
+  type = "double",
+  help = "Probability cutoff"
+)
+parser$add_argument("--minIdrSize",
+                    required = FALSE,
+                    type = "integer",
+                    help = "Min Idr size")
+parser$add_argument(
+  "--annotateBindingSites",
+  action = "store_true",
+  required = FALSE,
+  help = "Annotate binding sites"
+)
+parser$add_argument(
+  "--minIdrBindingSize",
+  required = FALSE,
+  type = "integer",
+  help = "Minimun Idr binding size"
+)
+parser$add_argument(
+  "--minIdrBindingOverlapFrac",
+  required = FALSE,
+  type = "numeric",
+  help = ""
+)
+parser$add_argument("--ntCutoff",
+                    required = FALSE,
+                    type = "integer",
+                    help = "Nucleotide cutoff")
+parser$add_argument("--ntFracCutoff",
+                    required = FALSE,
+                    type = "numeric",
+                    help = "Nucleotide fraction cutoff")
+parser$add_argument(
+  "--ntJCsimCutoff",
+  required = FALSE,
+  type = "numeric",
+  help = "Nucleotide Jaccard simmilarity cutoff"
+)
+parser$add_argument("--AaCutoff",
+                    required = FALSE,
+                    type = "integer",
+                    help = "Aminoacid cutoff")
+parser$add_argument("--AaFracCutoff",
+                    required = FALSE,
+                    type = "numeric",
+                    help = "Aminoacid fraction cutoff")
+parser$add_argument(
+  "--AaJCsimCutoff",
+  required = FALSE,
+  type = "numeric",
+  help = "Aminoacid Jaccard similarity cutoff"
+)
+parser$add_argument(
+  "--removeNonConseqSwitches",
+  action = "store_true",
+  required = FALSE,
+  help = "Remove switches without consequences"
+)
+parser$add_argument(
+  "--rescaleTranscripts",
+  action = "store_true",
+  required = FALSE,
+  help = "Rescale transcripts"
+)
+parser$add_argument(
+  "--reverseMinus",
+  action = "store_true",
+  required = FALSE,
+  help = "Reverse minus"
+)
+parser$add_argument(
+  "--addErrorbars",
+  action = "store_true",
+  required = FALSE,
+  help = "Add error bars"
+)
+
+
+args <- parser$parse_args()
+
+# Data import
+###################
+
+if (args$modeSelector == "data_import") {
+
+  quantificationData <- importIsoformExpression(
+    parentDir = args$parentDir,
+    addIsofomIdAsColumn = TRUE,
+    readLength = args$readLength
+  )
+
+  ### Make design matrix
+  myDesign <- data.frame(
+    sampleID = colnames(quantificationData$abundance)[-1],
+    condition = gsub(
+      "[[:digit:]]+",
+      "",
+      colnames(quantificationData$abundance)[-1]
+    )
+  )
+
+  if (args$toolSource == "stringtie") {
+    SwitchList <- importRdata(
+      isoformCountMatrix   = quantificationData$counts,
+      isoformRepExpression = quantificationData$abundance,
+      designMatrix         = myDesign,
+      isoformExonAnnoation = args$annotation,
+      isoformNtFasta       = args$transcriptome,
+      showProgress = TRUE,
+      fixStringTieAnnotationProblem = args$fixStringTieAnnotationProblem
+    )
+  } else {
+    SwitchList <- importRdata(
+      isoformCountMatrix   = quantificationData$counts,
+      isoformRepExpression = quantificationData$abundance,
+      designMatrix         = myDesign,
+      isoformExonAnnoation = args$annotation,
+      isoformNtFasta       = args$transcriptome,
+      showProgress = TRUE
+    )
+  }
+
+
+  geneCountMatrix <- extractGeneExpression(
+    SwitchList,
+    extractCounts = TRUE,
+    addGeneNames = FALSE,
+    addIdsAsColumns = FALSE
+  )
+
+  if (args$countFiles == "collection") {
+
+    expressionDF <- data.frame(geneCountMatrix)
+
+    myDesign$condition[length(myDesign$condition)]
+
+    dataframe_factor1 <- expressionDF %>% select(matches(myDesign$condition[1]))
+    dataframe_factor2 <- expressionDF %>% select(matches(myDesign$condition[length(myDesign$condition)]))
+
+
+    lf1 <- as.list(as.data.frame(dataframe_factor1))
+    sampleNames1 <- colnames(as.data.frame(dataframe_factor1))
+
+    lf2 <- as.list(as.data.frame(dataframe_factor2))
+    sampleNames2 <- colnames(as.data.frame(dataframe_factor2))
+
+    geneNames <- row.names(as.data.frame(expressionDF))
+
+
+    for (index in seq_along(lf1)) {
+      tabular_expression <- data.frame(geneNames, lf1[index])
+      colnames(tabular_expression) <-
+        c("Geneid", sampleNames1[index])
+      filename <-
+        paste(sampleNames1[index], "dataset.tabular", sep = "_")
+      output_path <- paste("./count_files/factor1/", filename, sep = "")
+      write.table(
+        tabular_expression,
+        output_path,
+        sep = "\t",
+        row.names = FALSE,
+        quote = FALSE
+      )
+    }
+    for (index in seq_along(lf2)) {
+      tabular_expression <- data.frame(geneNames, lf2[index])
+      colnames(tabular_expression) <-
+        c("Geneid", sampleNames2[index])
+      filename <-
+        paste(sampleNames2[index], "dataset.tabular", sep = "_")
+      output_path <- paste("./count_files/factor2/", filename, sep = "")
+      write.table(
+        tabular_expression,
+        output_path,
+        sep = "\t",
+        row.names = FALSE,
+        quote = FALSE
+      )
+    }
+  } else if (args$countFiles == "matrix") {
+    expressionDF <- data.frame(geneCountMatrix)
+    geneNames <- row.names(expressionDF)
+
+    expressionDF <- cbind(geneNames, expressionDF)
+    write.table(
+      as.data.frame(expressionDF),
+      "./count_files/matrix.tabular",
+      sep = "\t",
+      row.names = FALSE,
+      quote = FALSE
+    )
+    write.table(
+      as.data.frame(myDesign),
+      "./count_files/samples.tabular",
+      sep = "\t",
+      row.names = FALSE,
+      quote = FALSE
+    )
+  }
+
+  save(SwitchList, file = "SwitchList.Rda")
+
+}
+
+if (args$modeSelector == "first_step") {
+
+  # First part of the analysis
+  #############################
+
+  load(file = args$rObject)
+
+  ### Filter
+  SwitchList <- preFilter(
+    SwitchList,
+    IFcutoff = args$IFcutoff,
+    geneExpressionCutoff = args$geneExpressionCutoff,
+    isoformExpressionCutoff = args$isoformExpressionCutoff,
+    removeSingleIsoformGenes = args$removeSingleIsformGenes,
+    onlySigIsoforms = args$onlySigIsoforms,
+    keepIsoformInAllConditions = args$keepIsoformInAllConditions,
+    alpha = args$alpha,
+    dIFcutoff = args$dIFcutoff,
+  )
+
+  ### Test for isoform switches
+  SwitchList <- isoformSwitchTestDEXSeq(
+    SwitchList,
+    alpha = args$alpha,
+    dIFcutoff = args$dIFcutoff,
+    correctForConfoundingFactors = args$correctForConfoundingFactors,
+    overwriteIFvalues = args$overwriteIFvalues,
+    reduceToSwitchingGenes = args$reduceToSwitchingGenes,
+    reduceFurtherToGenesWithConsequencePotential = args$reduceFurtherToGenesWithConsequencePotential,
+    onlySigIsoforms = args$onlySigIsoforms,
+    keepIsoformInAllConditions = args$keepIsoformInAllConditions2,
+    showProgress = TRUE,
+  )
+
+  SwitchList <- analyzeNovelIsoformORF(
+    SwitchList,
+    analysisAllIsoformsWithoutORF = TRUE,
+    minORFlength = args$minORFlength,
+    orfMethod = args$orfMethod,
+    PTCDistance = args$PTCDistance,
+    startCodons = "ATG",
+    stopCodons = c("TAA", "TAG", "TGA"),
+    showProgress = TRUE,
+  )
+
+  ### Extract Sequences
+  SwitchList <- extractSequence(
+    SwitchList,
+    onlySwitchingGenes = args$onlySwitchingGenes,
+    alpha = args$alpha,
+    dIFcutoff = args$dIFcutoff,
+    extractNTseq = TRUE,
+    extractAAseq = TRUE,
+    removeShortAAseq = args$removeShortAAseq,
+    removeLongAAseq = args$removeLongAAseq,
+    removeORFwithStop = args$removeORFwithStop,
+    addToSwitchAnalyzeRlist = TRUE,
+    writeToFile = TRUE,
+    pathToOutput = getwd(),
+    outputPrefix = "isoformSwitchAnalyzeR_isoform",
+    forceReExtraction = FALSE,
+    quiet = FALSE
+  )
+
+  ### Summary
+  switchSummary <- extractSwitchSummary(
+    SwitchList,
+    filterForConsequences = args$filterForConsequences,
+    alpha = args$alpha,
+    dIFcutoff = args$dIFcutoff,
+    onlySigIsoforms = args$onlySigIsoforms,
+  )
+
+  save(SwitchList, file = "SwitchList.Rda")
+  write.table(
+    switchSummary,
+    file = "switchSummary.tsv",
+    quote = FALSE,
+    sep = "\t",
+    col.names = TRUE,
+    row.names = FALSE
+  )
+
+}
+
+if (args$modeSelector == "second_step") {
+
+  # Second part of the analysis
+  #############################
+
+  load(file = args$rObject)
+
+  ### Add annotation
+  if (!is.null(args$pathToCPATresultFile)) {
+    SwitchList <- analyzeCPAT(
+      SwitchList,
+      pathToCPATresultFile = args$pathToCPATresultFile,
+      codingCutoff = args$codingCutoff,
+      removeNoncodinORFs        = args$removeNoncodingORFs
+    )
+  }
+
+  if (!is.null(args$pathToCPC2resultFile)) {
+    SwitchList <- analyzeCPC2(
+      SwitchList,
+      pathToCPC2resultFile = args$pathToCPC2resultFile,
+      removeNoncodinORFs = args$removeNoncodingORFs
+    )
+  }
+
+  if (!is.null(args$pathToPFAMresultFile)) {
+    pfamFiles <- list.files(path = args$pathToPFAMresultFile,
+                            full.names = TRUE)
+
+    SwitchList <- analyzePFAM(SwitchList,
+                              pathToPFAMresultFile =  pfamFiles,
+                              showProgress = FALSE)
+  }
+
+  if (!is.null(args$pathToNetSurfP2resultFile)) {
+    netsurfFiles <- list.files(path = args$pathToNetSurfP2resultFile,
+                               full.names = TRUE)
+
+    SwitchList <- analyzeNetSurfP2(
+      SwitchList,
+      pathToNetSurfP2resultFile =  netsurfFiles,
+      smoothingWindowSize = args$smoothingWindowSize,
+      probabilityCutoff = args$probabilityCutoff,
+      minIdrSize = args$minIdrSize,
+      showProgress = TRUE
+    )
+  }
+
+  if (!is.null(args$pathToIUPred2AresultFile)) {
+    SwitchList <- analyzeIUPred2A(
+      SwitchList,
+      pathToIUPred2AresultFile = args$pathToIUPred2AresultFile,
+      smoothingWindowSize = args$smoothingWindowSize,
+      probabilityCutoff = args$probabilityCutoff,
+      minIdrSize = args$minIdrSize,
+      annotateBindingSites = args$annotateBindingSites,
+      minIdrBindingSize = args$minIdrBindingSize,
+      minIdrBindingOverlapFrac = args$minIdrBindingOverlapFrac,
+      showProgress = TRUE,
+      quiet = FALSE
+    )
+  }
+
+  if (!is.null(args$pathToSignalPresultFile)) {
+    signalpFiles <- list.files(path = args$pathToSignalPresultFile,
+                               full.names = TRUE)
+
+    SwitchList <- analyzeSignalP(
+      SwitchList,
+      pathToSignalPresultFile = signalpFiles,
+      minSignalPeptideProbability = args$minSignalPeptideProbability
+    )
+  }
+
+  SwitchList <- analyzeAlternativeSplicing(
+    SwitchList,
+    onlySwitchingGenes = args$onlySwitchingGenes,
+    alpha = args$alpha,
+    dIFcutoff = args$dIFcutoff,
+    showProgress = TRUE
+  )
+
+  SwitchList <- analyzeIntronRetention(
+    SwitchList,
+    onlySwitchingGenes = args$onlySwitchingGenes,
+    alpha = args$alpha,
+    dIFcutoff = args$dIFcutoff,
+    showProgress = TRUE
+  )
+
+  consequences <- c(
+    "intron_retention",
+    "NMD_status",
+    "isoform_seq_similarity",
+    "ORF_genomic",
+    "tss",
+    "tts"
+  )
+
+  if (!is.null(args$pathToCPATresultFile) ||
+      !is.null(args$pathToCPC2resultFile)) {
+    updatedConsequences <- c(consequences, "coding_potential")
+    consequences <- updatedConsequences
+  }
+
+  if (!is.null(args$pathToPFAMresultFile)) {
+    updatedConsequences <- c(consequences, "domains_identified")
+    consequences <- updatedConsequences
+  }
+
+  if (!is.null(args$pathToSignalPresultFile)) {
+    updatedConsequences <- c(consequences, "signal_peptide_identified")
+    consequences <- updatedConsequences
+  }
+
+  if (!is.null(args$pathToNetSurfP2resultFile) ||
+      !is.null(args$pathToIUPred2AresultFile)) {
+    updatedConsequences <- c(consequences, "IDR_identified", "IDR_type")
+    consequences <- updatedConsequences
+  }
+
+  SwitchList <- analyzeSwitchConsequences(
+    SwitchList,
+    consequencesToAnalyze = consequences,
+    alpha = args$alpha,
+    dIFcutoff = args$dIFcutoff,
+    onlySigIsoforms = args$onlySigIsoforms,
+    ntCutoff = args$ntCutoff,
+    ntJCsimCutoff = args$ntJCsimCutoff,
+    AaCutoff = args$AaCutoff,
+    AaFracCutoff = args$AaFracCutoff,
+    AaJCsimCutoff = args$AaJCsimCutoff,
+    removeNonConseqSwitches = args$removeNonConseqSwitches,
+    showProgress = TRUE
+  )
+
+
+  ### Visual analysis
+  # Top genes
+
+  if (args$analysisMode == "single") {
+
+    outputFile <- file.path(getwd(), "single_gene.pdf")
+
+    pdf(
+      file = outputFile,
+      onefile = FALSE,
+      height = 6,
+      width = 9
+    )
+
+    switchPlot(
+      SwitchList,
+      gene = args$gene,
+      condition1 = myDesign$condition[1],
+      condition2 = myDesign$condition[length(myDesign$condition)],
+      IFcutoff = args$IFcutoff,
+      dIFcutoff = args$dIFcutoff,
+      rescaleTranscripts = args$rescaleTranscripts,
+      reverseMinus = args$reverseMinus,
+      addErrorbars = args$addErrorbars,
+      logYaxis = FALSE,
+      localTheme = theme_bw(base_size = 8)
+    )
+    dev.off()
+
+  } else {
+    mostSwitchingGene <-
+      extractTopSwitches(
+        SwitchList,
+        n = Inf,
+        filterForConsequences = args$filterForConsequences,
+        extractGenes = TRUE,
+        alpha = args$alpha,
+        dIFcutoff = args$dIFcutoff,
+        inEachComparison = FALSE,
+        sortByQvals = args$sortByQvals
+      )
+
+    write.table(
+      mostSwitchingGene,
+      file = "mostSwitchingGene.tsv",
+      quote = FALSE,
+      sep = "\t",
+      col.names = TRUE,
+      row.names = FALSE
+    )
+
+
+    switchPlotTopSwitches(
+      SwitchList,
+      alpha = args$alpha,
+      dIFcutoff = args$dIFcutoff,
+      onlySigIsoforms = args$onlySigIsoforms,
+      n = args$genesToPlot,
+      sortByQvals = args$sortByQvals,
+      pathToOutput = getwd(),
+      fileType = "pdf"
+    )
+
+    outputFile <-
+      file.path(getwd(), "extractConsequencesSummary.pdf")
+
+    pdf(
+      file = outputFile,
+      onefile = FALSE,
+      height = 6,
+      width = 9
+    )
+
+    consequenceSummary <- extractConsequenceSummary(
+      SwitchList,
+      consequencesToAnalyze = "all",
+      includeCombined = FALSE,
+      asFractionTotal = args$asFractionTotal,
+      alpha = args$alpha,
+      dIFcutoff = args$dIFcutoff,
+      plot = TRUE,
+      plotGenes = args$plotGenes,
+      simplifyLocation = args$simplifyLocation,
+      removeEmptyConsequences = args$removeEmptyConsequences,
+      returnResult = TRUE,
+      localTheme = theme_bw()
+    )
+    dev.off()
+
+    write.table(
+      consequenceSummary,
+      file = "consequencesSummary.tsv",
+      quote = FALSE,
+      sep = "\t",
+      col.names = TRUE,
+      row.names = FALSE
+    )
+
+
+    outputFile <- file.path(getwd(), "consequencesEnrichment.pdf")
+    pdf(
+      file = outputFile,
+      onefile = FALSE,
+      height = 6,
+      width = 9
+    )
+    consequenceEnrichment <- extractConsequenceEnrichment(
+      SwitchList,
+      consequencesToAnalyze = "all",
+      alpha = args$alpha,
+      dIFcutoff = args$dIFcutoff,
+      countGenes = args$countGenes,
+      analysisOppositeConsequence = args$analysisOppositeConsequence,
+      plot = TRUE,
+      localTheme = theme_bw(base_size = 12),
+      minEventsForPlotting = 10,
+      returnResult = TRUE
+    )
+    dev.off()
+
+    write.table(
+      consequenceEnrichment,
+      file = "consequencesEnrichment.tsv",
+      quote = FALSE,
+      sep = "\t",
+      col.names = TRUE,
+      row.names = FALSE
+    )
+
+
+    outputFile <- file.path(getwd(), "splicingEnrichment.pdf")
+    pdf(
+      file = outputFile,
+      onefile = FALSE,
+      height = 6,
+      width = 9
+    )
+    splicingEnrichment <- extractSplicingEnrichment(
+      SwitchList,
+      splicingToAnalyze = "all",
+      alpha = args$alpha,
+      dIFcutoff = args$dIFcutoff,
+      onlySigIsoforms = args$onlySigIsoforms,
+      countGenes = args$countGenes,
+      plot = TRUE,
+      minEventsForPlotting = 10,
+      returnResult = TRUE
+    )
+    dev.off()
+
+    write.table(
+      splicingEnrichment,
+      file = "splicingEnrichment.tsv",
+      quote = FALSE,
+      sep = "\t",
+      col.names = TRUE,
+      row.names = FALSE
+    )
+
+
+    outputFile <- file.path(getwd(), "splicingSummary.pdf")
+    pdf(
+      file = outputFile,
+      onefile = FALSE,
+      height = 6,
+      width = 9
+    )
+    splicingSummary <- extractSplicingSummary(
+      SwitchList,
+      splicingToAnalyze = "all",
+      asFractionTotal = args$asFractionTotal,
+      alpha = args$alpha,
+      dIFcutoff = args$dIFcutoff,
+      onlySigIsoforms = args$onlySigIsoforms,
+      plot = TRUE,
+      plotGenes = args$plotGenes,
+      localTheme = theme_bw(),
+      returnResult = TRUE
+    )
+    dev.off()
+
+    write.table(
+      splicingSummary,
+      file = "splicingSummary.tsv",
+      quote = FALSE,
+      sep = "\t",
+      col.names = TRUE,
+      row.names = FALSE
+    )
+
+
+    ### Volcano like plot:
+    outputFile <- file.path(getwd(), "volcanoPlot.pdf")
+    pdf(
+      file = outputFile,
+      onefile = FALSE,
+      height = 6,
+      width = 9
+    )
+    ggplot(data = SwitchList$isoformFeatures, aes(x = dIF, y = -log10(isoform_switch_q_value))) +
+      geom_point(aes(color = abs(dIF) > 0.1 &
+                       isoform_switch_q_value < 0.05), # default cutoff
+                 size = 1) +
+      geom_hline(yintercept = -log10(0.05), linetype = "dashed") + # default cutoff
+      geom_vline(xintercept = c(-0.1, 0.1), linetype = "dashed") + # default cutoff
+      facet_wrap(~ condition_2) +
+      scale_color_manual("Signficant\nIsoform Switch", values = c("black", "red")) +
+      labs(x = "dIF", y = "-Log10 ( Isoform Switch Q Value )") +
+      theme_bw()
+    dev.off()
+
+
+    ### Switch vs Gene changes:
+    outputFile <- file.path(getwd(), "switchGene.pdf")
+    pdf(
+      file = outputFile,
+      onefile = FALSE,
+      height = 6,
+      width = 9
+    )
+    ggplot(data = SwitchList$isoformFeatures,
+           aes(x = gene_log2_fold_change, y = dIF)) +
+      geom_point(aes(color = abs(dIF) > 0.1 &
+                       isoform_switch_q_value < 0.05),
+                 size = 1) +
+      facet_wrap(~ condition_2) +
+      geom_hline(yintercept = 0, linetype = "dashed") +
+      geom_vline(xintercept = 0, linetype = "dashed") +
+      scale_color_manual("Signficant\nIsoform Switch", values = c("black", "red")) +
+      labs(x = "Gene log2 fold change", y = "dIF") +
+      theme_bw()
+    dev.off()
+
+    outputFile <- file.path(getwd(), "splicingGenomewide.pdf")
+    pdf(
+      file = outputFile,
+      onefile = FALSE,
+      height = 6,
+      width = 9
+    )
+    splicingGenomeWide <- extractSplicingGenomeWide(
+      SwitchList,
+      featureToExtract = "all",
+      splicingToAnalyze = c("A3", "MES", "ATSS"),
+      plot = TRUE,
+      returnResult = TRUE
+    )
+    dev.off()
+  }
+  save(SwitchList, file = "SwitchList.Rda")
+
+}
diff -r 000000000000 -r f3fefb6d8254 isoformswitchanalyzer.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/isoformswitchanalyzer.xml	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,1030 @@
+<tool id="isoformswitchanalyzer" name="IsoformSwitchAnalyzeR" version="@TOOL_VERSION@+galaxy@SUFFIX_VERSION@">
+    <description>statistical identification of isoform switching</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro='xrefs'/>
+    <expand macro='requirements'/>
+    <stdio>
+        <regex match="Execution halted"
+           source="both"
+           level="fatal"
+           description="Execution halted." />
+        <regex match="Error in"
+           source="both"
+           level="fatal"
+           description="An undefined error occurred, please check your input carefully and contact your administrator." />
+        <regex match="Fatal error"
+           source="both"
+           level="fatal"
+           description="An undefined error occurred, please check your input carefully and contact your administrator." />
+    </stdio>
+    <command><![CDATA[
+            #if $functionMode.selector == 'data_import'
+                #if $functionMode.transcriptome.is_of_type("fasta.gz"):
+                    ln -s '${functionMode.transcriptome}' './transcriptome.fasta.gz' &&
+                    #set $transcriptome = './transcriptome.fasta.gz' 
+                #else
+                    ln -s '${functionMode.transcriptome}' './transcriptome.fasta'
+                    #set $transcriptome = './transcriptome.fasta' 
+                #end if
+                #if $functionMode.genomeAnnotation.is_of_type("gtf.gz"):
+                    ln -s '${functionMode.genomeAnnotation}' './annotation.gtf.gz' &&
+                    #set $annotation = './annotation.gtf.gz' 
+                #else
+                    ln -s '${functionMode.genomeAnnotation}' './annotation.gtf' &&
+                        #set $annotation = './annotation.gtf' 
+                #end if
+                mkdir -p 'input_files' &&
+                #if $functionMode.countFiles != 'disabled':
+                    mkdir -p "count_files/factor1/" &&
+                    mkdir -p "count_files/factor2/" &&
+                #end if
+                #if $functionMode.tool_source.selector == 'stringtie'
+                    #set $filename = 't_data.ctab'
+                #else
+                    #set $filename = 'quant.sf'
+                #end if
+
+                #for $index in range(len($functionMode.first_factor.trans_counts)):
+                    mkdir './input_files/${functionMode.first_factor.factorLevel}${index}/' &&
+                    ln -s $functionMode.first_factor.trans_counts[$index] './input_files/${functionMode.first_factor.factorLevel}${index}/${filename}' &&
+                #end for
+
+                #for $index in range(len($functionMode.second_factor.trans_counts)):
+                    mkdir './input_files/${functionMode.second_factor.factorLevel}${index}/' &&
+                    ln -s $functionMode.second_factor.trans_counts[$index] './input_files/${functionMode.second_factor.factorLevel}${index}/${filename}' &&
+                #end for
+                
+                Rscript '${__tool_directory__}/IsoformSwitchAnalyzeR.R'
+                    --modeSelector $functionMode.selector
+                    --parentDir './input_files'
+                    --annotation $annotation
+                    --transcriptome $transcriptome
+                    --toolSource $functionMode.tool_source.selector
+                    #if $functionMode.tool_source.selector == 'stringtie'
+                        --readLength $functionMode.tool_source.averageSize
+                        $functionMode.tool_source.fixStringTieAnnotationProblem
+                    #end if
+                    --countFiles $functionMode.countFiles
+            #else if $functionMode.selector == 'first_step'
+                Rscript '${__tool_directory__}/IsoformSwitchAnalyzeR.R'
+                    --modeSelector $functionMode.selector
+                    --rObject $functionMode.robject
+                    --alpha $functionMode.alpha
+                    --dIFcutoff $functionMode.dIFcutoff
+                    $functionMode.onlySigIsoforms
+                    $functionMode.filterForConsequences
+                    --geneExpressionCutoff $functionMode.prefilter.geneExpressionCutoff
+                    --isoformExpressionCutoff $functionMode.prefilter.isoformExpressionCutoff
+                    --IFcutoff $functionMode.prefilter.IFcutoff
+                    $functionMode.prefilter.removeSingleIsformGenes
+                    $functionMode.prefilter.keepIsoformInAllConditions
+                    $functionMode.dexseq.correctForConfoundingFactors
+                    $functionMode.dexseq.overwriteIFvalues
+                    $functionMode.dexseq.reduceToSwitchingGenes
+                    $functionMode.dexseq.reduceFurtherToGenesWithConsequencePotential
+                    $functionMode.dexseq.keepIsoformInAllConditions
+                    --minORFlength $functionMode.novel_isoform.minORFlength
+                    --orfMethod $functionMode.novel_isoform.orfMethod
+                    --PTCDistance $functionMode.novel_isoform.PTCDistance
+                    $functionMode.extract_sequence.removeShortAAseq
+                    $functionMode.extract_sequence.removeLongAAseq
+                    $functionMode.extract_sequence.removeORFwithStop
+                    $functionMode.extract_sequence.onlySwitchingGenes
+            #else
+                #if $functionMode.protein_domains.selector == 'enabled'
+                    mkdir -p './pfam_files' &&
+                    #for $index,$filename in enumerate($functionMode.protein_domains.analyzePFAM)
+                        ln -s $filename './pfam_files/dataset${index}.txt' &&
+                    #end for
+                #end if
+                #if $functionMode.signal_peptides.selector == 'enabled'
+                    mkdir -p './signalp_files' &&
+                    #for $index,$filename in enumerate($functionMode.signal_peptides.analyzeSignalP)
+                        ln -s $filename './signalp_files/dataset${index}.txt' &&
+                    #end for
+                #end if
+                #if $functionMode.disordered_regions.selector == 'netsurfp'
+                    mkdir -p './netsurf_files' &&
+                    #for $index,$filename in enumerate($functionMode.disordered_regions.analyzeNetSurfP2)
+                        ln -s $filename './netsurf_files/dataset${index}.txt' &&
+                    #end for
+                #end if
+                Rscript '${__tool_directory__}/IsoformSwitchAnalyzeR.R'
+                    --modeSelector $functionMode.selector
+                    --rObject $functionMode.robject
+                    --analysisMode $functionMode.analysis_mode.selector
+                    --alpha $functionMode.analysis_mode.alpha
+                    --dIFcutoff $functionMode.analysis_mode.dIFcutoff
+                    #if $functionMode.analysis_mode.selector == 'top'
+                        --genesToPlot $functionMode.analysis_mode.n
+                        $functionMode.analysis_mode.advanced_options.filterForConsequences
+                        $functionMode.analysis_mode.advanced_options.sortByQvals
+                        $functionMode.analysis_mode.advanced_options.onlySigIsoforms
+                        $functionMode.analysis_mode.advanced_options.onlySwitchingGenes
+                        $functionMode.analysis_mode.advanced_options.countGenes
+                        $functionMode.analysis_mode.advanced_options.asFractionTotal
+                        $functionMode.analysis_mode.advanced_options.plotGenes
+                        $functionMode.analysis_mode.advanced_options.simplifyLocation
+                        $functionMode.analysis_mode.advanced_options.removeEmptyConsequences
+                        $functionMode.analysis_mode.advanced_options.removeEmptyConsequences
+                    #else
+                        --gene $functionMode.analysis_mode.gene
+                        --IFcutoff $functionMode.analysis_mode.advanced_options.IFcutoff
+                        $functionMode.analysis_mode.advanced_options.rescaleTranscripts
+                        $functionMode.analysis_mode.advanced_options.reverseMinus
+                        $functionMode.analysis_mode.advanced_options.addErrorbars
+                        $functionMode.analysis_mode.advanced_options.onlySwitchingGenes
+                    #end if
+                    #if $functionMode.coding_potential.selector == 'cpat'
+                        --pathToCPATresultFile $functionMode.coding_potential.analyzeCPAT
+                        --codingCutoff $functionMode.coding_potential.codingCutoff
+                    #else if  $functionMode.coding_potential.selector == 'cpc2'
+                        --pathToCPC2resultFile $functionMode.coding_potential.analyzeCPC2
+                        $functionMode.coding_potential.removeNoncodingORFs
+                        --codingCutoff $functionMode.coding_potential.codingCutoff
+                    #end if
+                    #if $functionMode.protein_domains.selector == 'enabled'
+                        --pathToPFAMresultFile './pfam_files'
+                    #end if
+                    #if $functionMode.signal_peptides.selector == 'enabled'
+                        --pathToSignalPresultFile './signalp_files'
+                        --minSignalPeptideProbability $functionMode.signal_peptides.minSignalPeptideProbability
+                    #end if
+                    #if $functionMode.disordered_regions.selector == 'netsurfp'
+                        --pathToNetSurfP2resultFile './netsurf_files'
+                        --smoothingWindowSize $functionMode.disordered_regions.smoothingWindowSize
+                        --probabilityCutoff $functionMode.disordered_regions.probabilityCutoff
+                        --minIdrSize $functionMode.disordered_regions.minIdrSize
+                    #else if  $functionMode.disordered_regions.selector == 'iupred2a'
+                        --pathToIUPred2AresultFile $functionMode.disordered_regions.AanalyzeIUPred2A
+                        --smoothingWindowSize $functionMode.disordered_regions.smoothingWindowSize
+                        --probabilityCutoff $functionMode.disordered_regions.probabilityCutoff
+                        --minIdrSize $functionMode.disordered_regions.minIdrSize
+                        $functionMode.disordered_regions.annotateBindingSites
+                        --minIdrBindingSize $functionMode.disordered_regions.minIdrBindingSize
+                        --minIdrBindingOverlapFrac $functionMode.disordered_regions.minIdrBindingOverlapFrac
+                    #end if
+                    --ntCutoff $functionMode.analyzeSwitchConsequences.ntCutoff
+                    #if $functionMode.analyzeSwitchConsequences.ntFracCutoff
+                        --ntFracCutoff $functionMode.analyzeSwitchConsequences.ntFracCutoff
+                    #end if
+                    --ntJCsimCutoff $functionMode.analyzeSwitchConsequences.ntJCsimCutoff
+                    --AaCutoff $functionMode.analyzeSwitchConsequences.AaCutoff
+                    --AaFracCutoff $functionMode.analyzeSwitchConsequences.AaFracCutoff
+                    --AaJCsimCutoff $functionMode.analyzeSwitchConsequences.AaJCsimCutoff
+                    $functionMode.analyzeSwitchConsequences.removeNonConseqSwitches
+                    #if $functionMode.analysis_mode.selector == 'top'
+                        && mkdir -p './pdf_outputs/'
+                        && mv *pdf './pdf_outputs/'
+                        && mv *_vs_* gene_plots
+                    #end if
+            #end if
+    ]]></command>
+    <inputs>
+        <conditional name="functionMode">
+            <param name="selector" type="select" label="Tool function mode" 
+                help="The first step of a IsoformSwitchAnalyzeR workflow is to import and integrate the isoform quantification 
+                    with its basic annotation. Once you have all the relevant data imported into R (IsoformSwitchAnalyzeR will 
+                    also help you with that), the workflow for identification and analysis of isoform switches with functional 
+                    consequences can be divided into two parts.">
+                <option value="data_import">Import data</option>
+                <option value="first_step">Analysis part one: Extract isoform switches and their sequences</option>
+                <option value="second_step">Analysis part two: Plot all isoform switches and their annotation</option>
+            </param>
+            <when value="data_import">
+                <section name="first_factor" title="1: Factor level" expanded="true">
+                    <param name="factorLevel" type="text" value="FactorLevel" label="Specify a factor level, typical values could be 'tumor' or 'treated'"
+                        help="Only letters, numbers and underscores will be retained in this field">
+                        <sanitizer>
+                            <valid initial="string.letters,string.digits"><add value="_" /></valid>
+                        </sanitizer>
+                    </param>
+                    <param name="trans_counts" type="data" format="tabular" multiple="true" label="Transcript-level expression measurements"/> 
+                </section>
+                <section name="second_factor" title="2: Factor level" expanded="true">
+                    <param name="factorLevel" type="text" value="FactorLevel" label="Specify a factor level, typical values could be 'tumor' or 'treated'"
+                        help="Only letters, numbers and underscores will be retained in this field">
+                        <sanitizer>
+                            <valid initial="string.letters,string.digits"><add value="_" /></valid>
+                        </sanitizer>
+                    </param>
+                    <param name="trans_counts" type="data" format="tabular" multiple="true" label="Transcript-level expression measurements"/> 
+                </section>
+                <conditional name="tool_source">
+                    <param name="selector" type="select" label="Quantification data source"  help="IsoformSwitchAnalyzeR has different functions for importing data from different sources.">
+                        <option value="stringtie">StringTie</option>
+                        <option value="salmon">Salmon/Kallisto</option>
+                    </param>
+                    <when value="salmon"/>
+                    <when value="stringtie">
+                        <param name="averageSize" type="integer" min="0" value="150" label="Average read length" help="Must be the number of base pairs sequenced. e.g. if the data 
+                        quantified is 75 bp paired ends the the user should supply readLength=75" />
+                        <param argument="fixStringTieAnnotationProblem" type="boolean" truevalue="--fixStringTieAnnotationProblem" falsevalue="" checked="true" 
+                            label="Fix StringTie annotation problem" help="This option will automatically try and correct some of the annoation problems created when 
+                                doing transcript assembly (unassigned transcripts and merged genes)" />
+                    </when>
+                </conditional>
+                <param name="genomeAnnotation" type="data" format="gtf,gtf.gz" label="Genome annotation (GTF)" 
+                    help="It is used to integrate the coding sequence (CDS) regions from in the GTF file as the ORF regions used by IsoformSwitchAnalyzeR." />
+                <param name="transcriptome" type="data" format="fasta,fasta.gz" label="Transcriptome" 
+                    help="Please note this different from a fasta file with the sequences of the entire genome." />
+                <param name="countFiles" type="select" label="Generate count matrix files" help="If IsoformSwitchAnalyzeR is used for fixing Stringtie annotation
+                    problem, it can generate count files for analyzing differential expression with DESeq2 (when selecting collection) or CEMiTool (when secting the expression matrix format).">
+                    <option value="disabled">Disabled</option>
+                    <option value="collection">Collection of count files</option>
+                    <option value="matrix">Expression matrix</option>
+                </param>
+            </when>
+
+            <!--WRAPPER FIRST STEP SECTION-->
+
+            <when value="first_step">
+                <param name="robject" type="data" format="rdata" label="IsoformSwitchAnalyzeR R object" help="It is generated when running the analysis part 1." />
+                <expand macro="macro_alpha_difcutoff"/> 
+                <expand macro="macro_onlysigisoforms1"/>
+                <param argument="filterForConsequences" type="boolean" truevalue="--filterForConsequences" falsevalue="" checked="false" 
+                    label="Filter for consquences" help="Filter for genes with functional consequences. The output will then be the number of significant genes 
+                    and isoforms originating from genes with predicted consequences" />
+                <section name="prefilter" title="Pre-filter parameters" help="SwitchAnalyzeR will remove genes/isoforms with the aim of allowing faster
+                    processing time as well as more trustworthy results.">
+                    <param argument="geneExpressionCutoff" type="float" min="0" value="1" label="Gene expression cutoff" help="The expression cutoff (most 
+                        likely in TPM/RPKM/FPKM) which the average expression in BOTH condisions must be higher than." />
+                    <param argument="isoformExpressionCutoff" type="float" min="0" value="0" label="Isoform expresion cutoff" help="The expression cutoff (most 
+                        likely in RPKM/FPKM) which isoforms must be expressed more than, in at least one conditions of a comparison. Default is 0 (which removes 
+                        completely unused isoforms)." /> 
+                    <expand macro="macro_ifcutoff" value="0.01" help="The cutoff on isoform usage (measured as Isoform Fraction) which isoforms must be used more 
+                        than in at least one conditions of a comparison" />
+                    <param argument="removeSingleIsformGenes" type="boolean" truevalue="--removeSingleIsformGenes" falsevalue="" checked="true" label="Remove single isoform genes" 
+                        help="Only keep genes containing more than one isoform (in any comparison, after the other filters have been applied)" />
+                    <expand macro="macro_keeisoforminall" checked="false"/>
+                </section>
+                <section name="dexseq" title="DEXseq parameters" help="DEXSeq is used to test isoforms (isoform resolution) for differential isoform usage.">
+                    <param argument="correctForConfoundingFactors" type="boolean" truevalue="--correctForConfoundingFactors" falsevalue="" checked="true" label="Correct for confounding factors" 
+                        help="A logic indicating whether IsoformSwitchAnalyzeR to use limma to correct for any confounding effects (e.g. batch effects) as indicated in the
+                         design matrix (as additional columns (apart from the two default columns)) " />
+                    <param argument="overwriteIFvalues" type="boolean" truevalue="--overwriteIFvalues" falsevalue="" checked="true" label="Overwrite IF values" help="It indicates 
+                        whether to overwrite the IF and dIF stored in the switchAnalyzeRlist with the corrected IF and dIF values - if no confounding effects are
+                        present in the design matrix this will not change anything" />
+                    <param argument="reduceToSwitchingGenes" type="boolean" truevalue="--reduceToSwitchingGenes" falsevalue="" checked="true" label="Reduce to switch genes" help="Reduced to the
+                        genes which contains at least one isoform significantly differential used (as indicated by the alpha and dIFcutoff parameters" />
+                    <param argument="reduceFurtherToGenesWithConsequencePotential" type="boolean" truevalue="--reduceFurtherToGenesWithConsequencePotential" falsevalue="" checked="false" 
+                        label="Reduce to genes with consequence potential" help="This argument is a more strict version of reduceToSwitchingGenes
+                            as it not only requires that at least one isoform is significantly differential used (as indicated by the alpha and dIFcutoff parameters) but also that there is an isoform 
+                            with the opposite effect size (e.g. used less if the first isoform is used more). The minimum effect size of the opposing isoform usage is also controlled by dIFcutoff. 
+                            The existence of such an opposing isoform means a switch pair can be formed" />
+                    <expand macro="macro_keeisoforminall" checked="true"/>
+                </section>    
+                <section name="novel_isoform" title="Novel isoform analysis parameters" help="For the subset of isoforms not already annotated with ORFs this 
+                    function predicts the most likely Open Reading Frame (ORF) and the NMD sensitivity. This function is made to help annotate
+                    isoforms if you have performed (guided) de-novo isoform reconstruction (isoform deconvolution).">
+                    <param argument="minORFlength" type="integer" min="0" value="100" label="Minimum ORF length" help="The minimum size (in nucleotides) an 
+                        ORF must be to be considered (and reported). Default is 100 nucleotides, which around 97.5% of Gencode coding isoforms in both human and mouse have." />
+                    <param argument="orfMethod" type="select" label="ORF identification method" help="More information in the help section">
+                        <option value="longest.AnnotatedWhenPossible">Longest and annotated when possible</option>
+                        <option value="longest">Longest</option>
+                        <option value="mostUpstream">Most upstream</option>
+                        <option value="longestAnnotated">Longest annotated</option>
+                        <option value="mostUpstreamAnnoated">Most upstream annotated</option>
+                    </param>
+                    <param argument="PTCDistance" type="integer" min="0" value="50" label="Maximal allowed premature termination codon-distance" help="The minimum 
+                        distance (number of nucleotides) from the STOP codon to the final exon-exon junction. If the distance from the STOP to the final exon-exon
+                        junction is larger than this the isoform to be marked as NMD-sensitive. " />
+                </section>         
+                <section name="extract_sequence" title="Sequence extraction parameters" help="switchAnalyzeR will extracts the nucleotide (NT) sequence of transcripts by 
+                    extracting and concatenating the sequences of a reference genome corresponding to the genomic coordinates of the isoforms. ">
+                    <expand macro="macro_onlyswitching"/>
+                    <param argument="removeShortAAseq" type="boolean" truevalue="--removeShortAAseq" falsevalue="" checked="true" label="Remove short aminoacid sequences" help="This 
+                        option exist to allows for easier usage of the Pfam and SignalP web servers which both currently have restrictions on allowed sequence lengths. If 
+                        enabled AA sequences are filtered to be > 5 AA. This will only affect the sequences written to the FASTA file not the sequences added to the switchAnalyzeRlist" />
+                    <param argument="removeLongAAseq" type="boolean" truevalue="--removeLongAAseq" falsevalue="" checked="false" label="Remove long aminoacid sequences" help="A 
+                        logical indicating whether to removesequences based on their length. This option exist to allows for easier usage of the Pfam and SignalP web servers
+                        which both currently have restrictions on allowed sequence lengths. If enabled AA sequences are filtered to be smaller 1000 AA. This will only affect the 
+                        sequences written to the fasta file (if writeToFile=TRUE) not the sequences added to the switchAnalyzeRlist. " />
+                    <param argument="removeORFwithStop" type="boolean" truevalue="--removeORFwithStop" falsevalue="" checked="true" label="Remove ORFs containint STOP codons" help="ORFs 
+                        containing stop codons, defined as * when the ORF nucleotide sequences is translated to the amino acid sequence, should be A) removed from the ORF 
+                        annotation in the switchAnalyzeRlist and B) removed from the sequences added to the switchAnalyzeRlist and/or written to FASTA files. This is only 
+                        necessary if you are analyzing quantified known annotated data where you supplied a GTF file to the import function" />
+                </section>
+                <param name="outputs_first" type="select" display="checkboxes" multiple="true" label="Outputs selector">
+                    <option value="nt" selected="true">Nucleotide sequences</option>
+                    <option value="aa" selected="true">Aminoacid sequences</option>
+                    <option value="summary" selected="true">Gene switch summary</option>
+                </param>
+            </when>
+
+            <!-- WRAPPER SECOND STEP SECTION-->
+
+            <when value="second_step">
+                <param name="robject" type="data" format="rdata" label="IsoformSwitchAnalyzeR R object" help="It is generated when running the analysis part 2." />
+                <conditional name="analysis_mode">
+                    <param name="selector" type="select" label="Analysis mode" help="This selector allows so specify if you want to analyze a specific gene or 
+                        the (top) switching genes/isoforms ">
+                        <option value="top" selected="true">Full analysis</option>
+                        <option value="single">Analyze specific gene</option>
+                    </param>
+                    <when value="top">
+                        <expand macro="macro_alpha_difcutoff"/>
+                        <param argument="n" type="integer" min="1" value="10" label="Number of top switching features (genes/isoforms) to plot"
+                            help="This parameters allows to specify the number of top genes/isoforms to plot"/>
+                        <section name="advanced_options" title="Full analysis advanced options">
+                            <param argument="filterForConsequences" type="boolean" truevalue="--filterForConsequences" falsevalue="" checked="false" label="Filter genes with functional consequences" 
+                            help="The output will then be the number of significant genes and isoforms originating from genes with predicted consequences"/>
+                            <param argument="sortByQvals" type="boolean" truevalue="--sortByQvals" falsevalue="" checked="true" label="Sorting mode" help="A logic indicating 
+                                whether to the top n features are sorted by decreasing significance (increasing q-values) (if enabled) or decreasing switch size 
+                                (absolute dIF, which are still significant as defined by alpha) (if disabled). The dIF values for genes are considered as the total 
+                                change within the gene calculated as sum(abs(dIF)) for each gene" />
+                            <expand macro="macro_onlysigisoforms2"/>
+                            <expand macro="macro_onlyswitching"/>
+                            <param argument="countGenes" type="boolean" truevalue="--countGenes" falsevalue="" checked="true" label="Number genes or isoform switches counts" help="This parameter indicates 
+                                whether it is the number of genes (if enabled) or isoform switches (if disabled) which primary result in gain/loss that are counted" />
+                            <param argument="asFractionTotal" type="boolean" truevalue="--asFractionTotal" falsevalue="" checked="false" label="Summary as numbers of as fraction" help="The consequences/splicing events 
+                                should be summarized calculated as numbers (if disabled) or as a fraction of the total number of switches/genes" />
+                            <param argument="plotGenes" type="boolean" truevalue="--plotGenes" falsevalue="" checked="false" label="Plot number/fraction of genes or isoforms" help="Plot the number/fraction of genes with 
+                                (if enabled) or isoforms (if disabled) involved with isoform switches with functional consequences  (both filtered via alpha and dIFcutoff)" />
+                            <param argument="simplifyLocation" type="boolean" truevalue="--simplifyLocation" falsevalue="" checked="true" label="Simplify location" help="Simplify the switches involved in changes 
+                                in subcellular localizations (due the the hundreds of possible combinations)" />
+                            <param argument="removeEmptyConsequences" type="boolean" truevalue="--removeEmptyConsequences" falsevalue="" checked="false" label="Remove empty consequences" help="Remove consequenses analyzed 
+                                but where no differences was found (those showing zero in the plot)" />
+                            <param argument="analysisOppositeConsequence" type="boolean" truevalue="--analysisOppositeConsequence" falsevalue="" checked="false" 
+                                label="Analysis opposite consequences in enrichment analysis" help="Reverse the analysis meaning if 'Domain gains' are analyze will case the analysis to be performed on 'Domain loss'. 
+                                    The main effect is for the visual appearance of plot which will be mirrored (around the 0.5 fraction)" />
+                        </section>
+                    </when>
+                    <when value="single">
+                        <param argument="gene" type="text" value="" label="Gene name" help="Either the gene_id or the gene name of the gene to plot">
+                            <sanitizer invalid_char="">
+                                <valid initial="string.letters,string.digits">
+                                    <add value="_" />
+                                    <add value="-" />
+                                </valid>
+                            </sanitizer>
+                            <validator type="regex">[0-9a-zA-Z_-]+</validator>
+                        </param>
+                        <expand macro="macro_alpha_difcutoff"/> 
+                        <section name="advanced_options" title="Single gene mode advanced options">
+                            <expand macro="macro_ifcutoff" value="0.05" help="The cutoff used for the minimum contribution to gene expression (in at least one 
+                                condition) for an isoforms must have to be plotted (measured as Isoform Fraction (IF) values)" />
+                            <param argument="rescaleTranscripts" type="boolean" truevalue="--rescaleTranscripts" falsevalue="" checked="true" label="Rescale transcripts" 
+                                help="All the isoforms should be resealed to the square root of their original sizes. This feature is implemented because 
+                                    introns usually are much larger than exons making it difficult to see structural changes. This is very useful for structural 
+                                    visualization but the scaling might distort actual intron and exon sizes" />
+                            <param argument="reverseMinus" type="boolean" truevalue="--reverseMinus" falsevalue="" checked="true" label="Isoforms on minus strand 
+                                should be inverted" help="Isoforms on minus strand should be inverted so they are visualized as going from left to right 
+                                instead of right to left" />
+                            <param argument="addErrorbars" type="boolean" truevalue="--addErrorbars" falsevalue="" checked="true" label="Add error bars" help="Error 
+                                bars should be added to the expression plots to show uncertainty in estimates" />
+                            <expand macro="macro_onlyswitching"/>
+                        </section>
+                    </when>
+                </conditional>
+                <conditional name="coding_potential">
+                    <param name="selector" type="select" label="Include prediction of coding potential information" 
+                        help="Integrate in the analysis de output from CPAT or CPC2.">
+                        <option value="disabled">Disabled</option>
+                        <option value="cpat">CPAT</option>
+                        <option value="cpc2">CPC2</option>
+                    </param>
+                    <when value="disabled"/>
+                    <when value="cpat">
+                        <param argument="analyzeCPAT" type="data" format="txt" label="CPAT result file" 
+                            help=" Use default parameters and the nucleotide fasta file (_nt.fasta). If the webserver was used, download the tab-delimited 
+                                result file (available at the bottom of the result page). If a stand-alone version was used, just supply the path to the result file" />
+                        <param argument="codingCutoff" type="float" min="0" max="1" value="0.725" label="Coding cutoff" help="cutoff used by CPAT for distinguishing between 
+                            coding and non-coding transcripts. The cutoff is dependent on species analyzed. IsoformSwitchAnalyzerR developers suggest that the optimal cutoff 
+                            for overlapping coding and noncoding isoforms are 0.725 for human and 0.721 for mouse. However the suggested cutoffs from the CPAT develpers 
+                            derived by comparing known genes to random non-coding regions of the genome is 0.364 for human and 0.44 for mouse" />
+                    </when>
+                    <when value="cpc2">
+                        <param argument="analyzeCPC2" type="data" format="txt" label="CPC2 result file" 
+                            help="Use default parameters and if required select the most similar species. If the webserver (batch submission) was used, 
+                                download the tab-delimited result file (via the “Download the result” button). If a stand-alone version was just just supply the path to the result file" />
+                        <param argument="removeNoncodingORFs" type="boolean" truevalue="--removeNoncodingORFs" falsevalue="" checked="false" label="Remove non-coding ORFs" help="Remove ORF information 
+                            from the isoforms which the CPC2 analysis classifies as non-coding. This can be particular useful if the isoform (and ORF) was predicted de-novo but is not 
+                            recommended if ORFs was imported from a GTF file" />
+                        <param argument="codingCutoff" type="float" min="0" max="1" value="0.5" label="Coding cutoff" help="Numeric indicating the cutoff used by CPC2 for distinguishing 
+                            between coding and non-coding transcripts. The cutoff appears to be species independent." />
+                    </when>
+                </conditional>
+                <conditional name="protein_domains">
+                    <param name="selector" type="select" label="Include Pfam information" help="Pfam is a database of protein families that includes their annotations and multiple sequence 
+                        alignments generated using hidden Markov models.">
+                        <option value="disabled">Disabled</option>
+                        <option value="enabled">Enabled</option>
+                    </param>
+                    <when value="disabled"/>
+                    <when value="enabled">
+                        <param argument="analyzePFAM" type="data" format="txt" multiple="true" optional="true" label="Include Pfam results (sequence analysis of protein domains)" help="Use default 
+                            parameters and the amino acid fasta file (_AA.fasta). If the webserver is used you need to copy/paste the result part of the mail you receive into an empty plain text 
+                            document (notepad, sublimetext, TextEdit or similar (not Word)) and save that to a plain text (txt) file. The path to that file should be supplied. If a stand-alone 
+                            version was used, just supply the path to the result file" />
+                    </when>
+                </conditional>
+                <conditional name="signal_peptides">
+                    <param name="selector" type="select" label="Include SignalP results" help="Integration of the result of SignalP (external sequence analysis of signal peptides)">
+                        <option value="disabled">Disabled</option>
+                        <option value="enabled">Enabled</option>
+                    </param>
+                    <when value="disabled"/>
+                    <when value="enabled">
+                        <param argument="analyzeSignalP" type="data" format="txt" multiple="true" optional="true" label="SignalP" help="Use the amino acid fasta file (_AA.fasta). If using the webserver SignalP 
+                            should be run with the parameter 'Short output (no figures)' under 'Output format' and one should select the appropriate 'Organism group'. When 
+                            using a stand-alone version SignalP should be run with the '-f summary' option. If using the webserver the results can be downloaded using the 
+                            'Downloads' button in the top-right corner where the user should select 'Prediction summary' and supply the path to the resulting file to the 
+                            'pathToSignalPresultFile' argument. If a stand-alone version was just supply the path to the summary result file." />
+                        <param argument="minSignalPeptideProbability" type="float" min="0" max="1" value="0.5" label="Minimum probability for calling a signal peptide"/>
+                    </when>
+                </conditional>
+
+                <conditional name="disordered_regions">
+                    <param name="selector" type="select" label="Include prediction of intrinsically disordered Regions (IDR) information" 
+                        help="Integrate in the analysis de output from IUPred2A or NetSurfP-2">
+                        <option value="disabled">Disabled</option>
+                        <option value="iupred2a">IUPred2A</option>
+                        <option value="netsurfp">NetSurfP-2</option>
+                    </param>
+                    <when value="disabled"/>
+                    <when value="iupred2a">
+                        <param argument="AanalyzeIUPred2A" type="data" format="txt,gz" label="IUPred2A result file" help="Can be gziped. If
+                            multiple result files were created (multiple web-server runs) just supply all of them." />
+                        <expand macro="macro_disordered_regions"/>
+                        <param argument="annotateBindingSites" type="boolean" truevalue="--annotateBindingSites" falsevalue="" checked="true" label="Annotate binding sites" 
+                            help="Integrate the ANCHOR2 prediction of Intrinsically Disordered Binding Regions (IDBRs)" />
+                        <param argument="minIdrBindingSize" type="integer" min="0" value="15" label="Minimum IDBR binding size" help="How long a stretch of 
+                            binding site the region part of the Intrinsically Disordered Binding Regions (IDBR)" />
+                        <param argument="minIdrBindingOverlapFrac" type="float" min="0" value="0.8" label="Minimum fraction of a predicted IDBR" help="Minimum 
+                            fraction of a predicted IDBR must also be within a IDR before the IDR is considered as a an IDR with a binding region" />
+                    </when>
+                    <when value="netsurfp">
+                        <param argument="analyzeNetSurfP2" type="data" format="txt,gz" multiple="true" label="NetSurfP-2 result file" help="Can be gziped. If
+                            multiple result files were created (multiple web-server runs) just supply all of them." />
+                        <expand macro="macro_disordered_regions"/>
+                    </when>
+                </conditional>
+                <section name="analyzeSwitchConsequences" title="Analyze switch consequences parameters">
+                    <param argument="ntCutoff" type="integer" min="0" value="50" label="Nucleotide length cutoff" help="The length difference (in nucleotides) a 
+                        comparison must be larger than for reporting differences" />
+                    <param argument="ntFracCutoff" type="float" min="0" max="1" optional="true" label="Nucleotide length fraction cutoff" help="The cutoff in length 
+                        difference, measured as a fraction of the length of the downregulated isoform, a comparison must be larger than for
+                        reporting differences. For example does 0.05 mean the upregulated isoform must be 5% longer/shorter before it is reported. " />
+                    <param argument="ntJCsimCutoff" type="float" min="0" max="1" value="0.8" label="Cutoff on Jaccard similarity between the overlap of two nucloetide sequences" help=" If the
+                        measured JCsim is smaller than this cutoff the sequences are considered different and reported as such" />
+                    <param argument="AaCutoff" type="integer" min="0" value="10" label="Aminoacid lenght cutoff" help="Length difference (in AA) a comparison must be larger
+                        than for reporting differences when evaluating ’ORF_seq_similarity’, primarily implemented to avoid differences in very short AA sequences being 
+                        classified as different" />
+                    <param argument="AaFracCutoff" type="float" min="0" max="1" value="0.5" label="Aminoacid length fraction cutoff" help="Cutoff of length difference of 
+                        the protein domain or IDR. The difference is measured as a fraction of the longest region, a comparison must be larger than before reporting it" />
+                    <param argument="AaJCsimCutoff" type="float" min="0" max="1" value="0.9" label="Cutoff between the overlap of two aminoacid sequences" help="If the
+                        measured JCsim is smaller than this cutoff the sequences are considered different and reported as such" />
+                    <param argument="removeNonConseqSwitches" type="boolean" truevalue="--removeNonConseqSwitches" falsevalue="" checked="true" label="Remove the comparison of isoforms
+                         where no consequences were found" />
+                </section>
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <collection name="collection_counts_factor1" type="list" label="${tool.name} on ${on_string}: gene counts factor1">
+            <discover_datasets pattern="__designation_and_ext__" format="tabular" directory="count_files/factor1" />
+            <filter>functionMode['selector'] == 'data_import'</filter>
+            <filter>functionMode['countFiles'] == 'collection'</filter>
+        </collection>
+        <collection name="collection_counts_factor2" type="list" label="${tool.name} on ${on_string}: gene counts factor2">
+            <discover_datasets pattern="__designation_and_ext__" format="tabular" directory="count_files/factor2" />
+            <filter>functionMode['selector'] == 'data_import'</filter>
+            <filter>functionMode['countFiles'] == 'collection'</filter>
+        </collection>
+        <data name="matrix_counts" format="tabular" from_work_dir="count_files/matrix.tabular" label="${tool.name} on ${on_string}: gene counts matrix">
+            <filter>functionMode['selector'] == 'data_import'</filter>
+            <filter>functionMode['countFiles'] == 'matrix'</filter>
+        </data>
+        <data name="sample_annotation" format="tabular" from_work_dir="count_files/samples.tabular" label="${tool.name} on ${on_string}: samples annotation">
+            <filter>functionMode['selector'] == 'data_import'</filter>
+            <filter>functionMode['countFiles'] == 'matrix'</filter>
+        </data>
+        <data name="switchList" format="rdata" from_work_dir="SwitchList.Rda" label="${tool.name} on ${on_string}: SwitchList (RData)"/>
+        <data name="isoformAA" format="fasta" from_work_dir="isoformSwitchAnalyzeR_isoform_AA.fasta" label="${tool.name} on ${on_string}: aminoacid sequences">
+            <filter>functionMode['selector'] == 'first_step'</filter>
+            <filter>functionMode['outputs_first'] and 'aa' in functionMode['outputs_first']</filter>
+        </data>
+        <data name="isoformNT" format="fasta" from_work_dir="isoformSwitchAnalyzeR_isoform_nt.fasta" label="${tool.name} on ${on_string}: nucleotide sequences">
+            <filter>functionMode['selector'] == 'first_step'</filter>
+            <filter>functionMode['outputs_first'] and 'nt' in functionMode['outputs_first']</filter>
+        </data>
+        <data name="switchSummary" format="tabular" from_work_dir="switchSummary.tsv" label="${tool.name} on ${on_string}: summary">
+            <filter>functionMode['selector'] == 'first_step'</filter>
+            <filter>functionMode['outputs_first'] and 'summary' in functionMode['outputs_first']</filter>
+        </data>
+        <collection name="plots_summary" type="list" label="${tool.name} on ${on_string}: genome wide plots">
+            <discover_datasets pattern="__designation_and_ext__" format="pdf" directory="pdf_outputs" />
+            <filter>functionMode['selector'] == 'second_step'</filter>
+            <filter>functionMode['analysis_mode']['selector'] == 'top'</filter>
+        </collection>
+        <collection name="genes_consequences" type="list" label="${tool.name} on ${on_string}: isoform switches with predicted functional consequences plots">
+            <discover_datasets pattern="__designation_and_ext__" format="pdf" directory="gene_plots/with_consequences" />
+            <filter>functionMode['selector'] == 'second_step'</filter>
+            <filter>functionMode['analysis_mode']['selector'] == 'top'</filter>
+        </collection>
+        <collection name="genes_wo_consequences" type="list" label="${tool.name} on ${on_string}: isoform switches without predicted functional consequences plots">
+            <discover_datasets pattern="__designation_and_ext__" format="pdf" directory="gene_plots/without_consequences" />
+            <filter>functionMode['selector'] == 'second_step'</filter>
+            <filter>functionMode['analysis_mode']['selector'] == 'top'</filter>
+        </collection>
+        <data name="mostSwitching" format="tabular" from_work_dir="mostSwitchingGene.tsv" label="${tool.name} on ${on_string}: switching gene/isoforms">
+            <filter>functionMode['selector'] == 'second_step'</filter>
+            <filter>functionMode['analysis_mode']['selector'] == 'top'</filter>
+        </data>
+        <data name="consequencesSummary" format="tabular" from_work_dir="consequencesSummary.tsv" label="${tool.name} on ${on_string}: consequences summary">
+            <filter>functionMode['selector'] == 'second_step'</filter>
+            <filter>functionMode['analysis_mode']['selector'] == 'top'</filter>
+        </data>
+        <data name="consequencesEnrichment" format="tabular" from_work_dir="consequencesEnrichment.tsv" label="${tool.name} on ${on_string}: consequences enrichment">
+            <filter>functionMode['selector'] == 'second_step'</filter>
+            <filter>functionMode['analysis_mode']['selector'] == 'top'</filter>
+        </data>
+        <data name="splicingSummary" format="tabular" from_work_dir="splicingSummary.tsv" label="${tool.name} on ${on_string}: splicing summary">
+            <filter>functionMode['selector'] == 'second_step'</filter>
+            <filter>functionMode['analysis_mode']['selector'] == 'top'</filter>
+        </data>
+        <data name="splicingEnrichment" format="tabular" from_work_dir="splicingEnrichment.tsv" label="${tool.name} on ${on_string}: splicing enrichment">
+            <filter>functionMode['selector'] == 'second_step'</filter>
+            <filter>functionMode['analysis_mode']['selector'] == 'top'</filter>
+        </data>
+        <data name="single_gene" format="pdf" from_work_dir="single_gene.pdf" label="${tool.name} on ${on_string}: single gene analysis">
+            <filter>functionMode['selector'] == 'second_step'</filter>
+            <filter>functionMode['analysis_mode']['selector'] == 'single'</filter>
+        </data>
+    </outputs>
+    <tests>
+        <!-- Test 01: Data import mode-->
+        <test expect_num_outputs="1">
+            <conditional name="functionMode">
+                <param name="selector" value="data_import"/>
+                <param name="genomeAnnotation" value="annotation_salmon.gtf.gz"/>
+                <param name="transcriptome" value="transcriptome.fasta.gz"/>
+                <param name="countFiles" value="disabled"/>
+                <section name="first_factor">
+                    <param name="factorLevel" value="health"/>
+                    <param name="trans_counts" value="salmon_cond1_rep1.sf,salmon_cond1_rep2.sf"/>
+                </section>
+                <section name="second_factor">
+                    <param name="factorLevel" value="cancer"/>
+                    <param name="trans_counts" value="salmon_cond2_rep1.sf,salmon_cond2_rep2.sf"/>
+                </section>
+                <conditional name="tool_source">
+                    <param name="selector" value="salmon"/>
+                </conditional>
+            </conditional>
+            <output name="switchList" file="test01.RData" ftype="rdata" compare="sim_size" delta="100"/>
+        </test>
+        <!-- Test 02: Data import mode generate expression matrix-->
+        <test expect_num_outputs="3">
+            <conditional name="functionMode">
+                <param name="selector" value="data_import"/>
+                <param name="genomeAnnotation" value="annotation_salmon.gtf.gz"/>
+                <param name="transcriptome" value="transcriptome.fasta.gz"/>
+                <param name="countFiles" value="matrix"/>
+                <section name="first_factor">
+                    <param name="factorLevel" value="health"/>
+                    <param name="trans_counts" value="salmon_cond1_rep1.sf,salmon_cond1_rep2.sf"/>
+                </section>
+                <section name="second_factor">
+                    <param name="factorLevel" value="cancer"/>
+                    <param name="trans_counts" value="salmon_cond2_rep1.sf,salmon_cond2_rep2.sf"/>
+                </section>
+                <conditional name="tool_source">
+                    <param name="selector" value="salmon"/>
+                </conditional>
+            </conditional>
+            <output name="switchList" ftype="rdata">
+                <assert_contents>
+                    <has_size value="652170" delta="300"/>
+                </assert_contents>
+            </output>
+            <output name="matrix_counts" file="test02_counts.tabular" ftype="tabular" lines_diff="6"/>
+            <output name="sample_annotation" file="test02_samples_annotation.tabular" ftype="tabular"/>
+        </test>
+        <!-- Test 03: Data import mode generate collection count files-->
+        <test expect_num_outputs="3">
+            <conditional name="functionMode">
+                <param name="selector" value="data_import"/>
+                <param name="genomeAnnotation" value="annotation_salmon.gtf.gz"/>
+                <param name="transcriptome" value="transcriptome.fasta.gz"/>
+                <param name="countFiles" value="collection"/>
+                <section name="first_factor">
+                    <param name="factorLevel" value="health"/>
+                    <param name="trans_counts" value="salmon_cond1_rep1.sf,salmon_cond1_rep2.sf"/>
+                </section>
+                <section name="second_factor">
+                    <param name="factorLevel" value="cancer"/>
+                    <param name="trans_counts" value="salmon_cond2_rep1.sf,salmon_cond2_rep2.sf"/>
+                </section>
+                <conditional name="tool_source">
+                    <param name="selector" value="salmon"/>
+                </conditional>
+            </conditional>
+            <output name="switchList" ftype="rdata">
+                <assert_contents>
+                    <has_size value="652170" delta="300"/>
+                </assert_contents>
+            </output>
+            <output_collection name="collection_counts_factor1" type="list" count="2">
+                <element name="cancer0_dataset" file="test03_cancer_counts.tabular" ftype="tabular" lines_diff="6"/>
+            </output_collection>
+            <output_collection name="collection_counts_factor2" type="list" count="2">
+                <element name="health0_dataset" file="test03_health_counts.tabular" ftype="tabular" lines_diff="6"/>
+            </output_collection>
+        </test>
+        <!-- Test 04: Extract isoform switches all outputs-->
+        <test expect_num_outputs="4">
+            <conditional name="functionMode">
+                <param name="selector" value="first_step"/>
+                <param name="robject" value="test01.RData"/>
+                <param name="alpha" value="0.05"/>
+                <param name="dIFcutoff" value="0.1"/>
+                <param name="onlySigIsoforms" value="false"/>
+                <param name="filterForConsequences" value="false"/>
+                <param name="outputs_first" value="nt,aa,summary"/>
+                <section name="prefilter">
+                    <param name="geneExpressionCutoff" value="1"/>
+                    <param name="isoformExpressionCutoff" value="0"/>
+                    <param name="IFcutoff" value="0.01"/>
+                    <param name="removeSingleIsformGenes" value="true"/>
+                    <param name="keepIsoformInAllConditions" value="false"/>
+                </section>
+                <section name="dexseq">
+                    <param name="correctForConfoundingFactors" value="true"/>
+                    <param name="overwriteIFvalues" value="true"/>
+                    <param name="reduceToSwitchingGenes" value="true"/>
+                    <param name="reduceFurtherToGenesWithConsequencePotential" value="false"/>
+                    <param name="keepIsoformInAllConditions" value="true"/>
+                </section>
+                <section name="novel_isoform">
+                    <param name="minORFlength" value="100"/>
+                    <param name="orfMethod" value="longest.AnnotatedWhenPossible"/>
+                    <param name="PTCDistance" value="50"/>
+                </section>
+                <section name="extract_sequence">
+                    <param name="onlySwitchingGenes" value="true"/>
+                    <param name="removeShortAAseq" value="true"/>
+                    <param name="removeLongAAseq" value="false"/>
+                    <param name="removeORFwithStop" value="true"/>
+                </section>
+            </conditional>
+            <output name="switchList" file="test04.RData" ftype="rdata" compare="sim_size" delta="100"/>
+            <output name="isoformAA" ftype="fasta">
+                <assert_contents>
+                    <has_size value="138275" delta="300"/>
+                    <has_text text=">TCONS_00000007"/>
+                    <has_text text="MLLPPGSLSRPRTFSSQPLQT"/>
+                </assert_contents>
+            </output>
+            <output name="isoformNT" ftype="fasta">
+                <assert_contents>
+                    <has_size value="780375" delta="300"/>
+                    <has_text text=">TCONS_00000007"/>
+                    <has_text text="GGGTCTCCCTCTGTTGTCCAAGGC"/>
+                </assert_contents>
+            </output>
+            <output name="switchSummary" file="test04_summary.tabular" ftype="tabular"/>
+        </test>
+        <!-- Test 05: Extract isoform switches alternative parameters-->
+        <test expect_num_outputs="1">
+            <conditional name="functionMode">
+                <param name="selector" value="first_step"/>
+                <param name="robject" value="test01.RData"/>
+                <param name="outputs_first" value=""/>
+                <section name="dexseq">
+                    <param name="correctForConfoundingFactors" value="true"/>
+                    <param name="overwriteIFvalues" value="true"/>
+                    <param name="reduceToSwitchingGenes" value="true"/>
+                    <param name="reduceFurtherToGenesWithConsequencePotential" value="true"/>
+                    <param name="keepIsoformInAllConditions" value="true"/>
+                </section>
+                <section name="novel_isoform">
+                    <param name="orfMethod" value="mostUpstream"/>
+                </section>
+            </conditional>
+            <output name="switchList" ftype="rdata">
+                <assert_contents>
+                    <has_size value="500518" delta="300"/>
+                </assert_contents>
+            </output>        
+        </test>
+        <!--Test 06: generate plots and summaries full analsys-->
+        <test expect_num_outputs="9">
+            <conditional name="functionMode">
+                <param name="selector" value="second_step"/>
+                <param name="robject" value="test04.RData"/>
+                <section name="analyzeSwitchConsequences">
+                    <param name="ntCutoff" value="50"/>
+                    <param name="ntJCsimCutoff" value="0.8"/>
+                    <param name="AaCutoff" value="10"/>
+                    <param name="AaFracCutoff" value="0.5"/>
+                    <param name="AaJCsimCutoff" value="0.9"/>
+                    <param name="removeNonConseqSwitches" value="true"/>
+                </section>
+                <conditional name="analysis_mode">
+                    <param name="selector" value="top"/>
+                    <param name="alpha" value="0.05"/>
+                    <param name="dIFcutoff" value="0.1"/>
+                    <param name="n" value="2"/>
+                    <section name="advanced_options">
+                        <param name="filterForConsequences" value="false"/>
+                        <param name="sortByQvals" value="true"/>
+                        <param name="onlySigIsoforms" value="false"/>
+                        <param name="onlySwitchingGenes" value="true"/>
+                        <param name="countGenes" value="true"/>
+                        <param name="asFractionTotal" value="false"/>
+                        <param name="plotGenes" value="false"/>
+                        <param name="simplifyLocation" value="true"/>
+                        <param name="removeEmptyConsequences" value="false"/>
+                        <param name="analysisOppositeConsequence" value="false"/>
+                    </section>
+                </conditional>
+            </conditional>
+            <output name="switchList" ftype="rdata">
+                <assert_contents>
+                    <has_size value="531580" delta="300"/>
+                </assert_contents>
+            </output>            
+            <output_collection name="plots_summary" type="list" count="7">
+                <element name="consequencesEnrichment" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="5995" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="extractConsequencesSummary" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="5681" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="splicingEnrichment" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="6361" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="splicingGenomewide" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="68069" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="splicingSummary" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="5990" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="switchGene" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="3611" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="volcanoPlot" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="3611" delta="300"/>
+                    </assert_contents>
+                </element>
+            </output_collection>
+            <output_collection name="genes_consequences" type="list" count="2">
+                <element name="1_switch_plot_NADK_aka_NADK" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="8716" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="2_switch_plot_PRKCZ_aka_PRKCZ" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="8463" delta="300"/>
+                    </assert_contents>
+                </element>
+            </output_collection>
+            <output_collection name="genes_wo_consequences" type="list" count="2">
+                <element name="1_switch_plot_CLSTN1_aka_CLSTN1" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="8039" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="2_switch_plot_ZBTB40_aka_ZBTB40" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="7506" delta="300"/>
+                    </assert_contents>
+                </element>
+            </output_collection>
+            <output name="mostSwitching" file="test06_switching.tabular" ftype="tabular" lines_diff="4"/>
+            <output name="consequencesSummary" file="test06_consequences_summary.tabular" ftype="tabular" lines_diff="4"/>
+            <output name="consequencesEnrichment" file="test06_consequences_enrichment.tabular" ftype="tabular" lines_diff="4"/>
+            <output name="splicingSummary" file="test06_splicing_summary.tabular" ftype="tabular" lines_diff="4"/>
+            <output name="splicingEnrichment" file="test06_splicing_enrichment.tabular" ftype="tabular" lines_diff="4"/>
+        </test>
+        <!--Test 07: generate plots and summaries full analsys all inputs-->
+        <test expect_num_outputs="9">
+            <conditional name="functionMode">
+                <param name="selector" value="second_step"/>
+                <param name="robject" value="test04.RData"/>
+                <section name="analyzeSwitchConsequences">
+                    <param name="ntCutoff" value="20"/>
+                    <param name="ntJCsimCutoff" value="0.5"/>
+                    <param name="AaCutoff" value="10"/>
+                    <param name="AaFracCutoff" value="0.4"/>
+                    <param name="AaJCsimCutoff" value="0.8"/>
+                    <param name="removeNonConseqSwitches" value="false"/>
+                </section>
+                <conditional name="analysis_mode">
+                    <param name="selector" value="top"/>
+                    <param name="alpha" value="0.05"/>
+                    <param name="dIFcutoff" value="0.1"/>
+                    <param name="n" value="2"/>
+                    <section name="advanced_options">
+                        <param name="filterForConsequences" value="false"/>
+                        <param name="sortByQvals" value="true"/>
+                        <param name="onlySigIsoforms" value="false"/>
+                        <param name="onlySwitchingGenes" value="true"/>
+                        <param name="countGenes" value="true"/>
+                        <param name="asFractionTotal" value="false"/>
+                        <param name="plotGenes" value="false"/>
+                        <param name="simplifyLocation" value="true"/>
+                        <param name="removeEmptyConsequences" value="false"/>
+                        <param name="analysisOppositeConsequence" value="false"/>
+                    </section>
+                </conditional>
+                <conditional name="coding_potential">
+                    <param name="selector" value="cpc2"/>
+                    <param name="analyzeCPC2" value="cpc2_result.txt"/>
+                    <param name="removeNoncodingORFs" value="false"/>
+                    <param name="codingCutoff" value="0.5"/>
+                </conditional>
+                <conditional name="protein_domains">
+                    <param name="selector" value="enabled"/>
+                    <param name="analyzePFAM" value="pfam_results.txt"/>
+                </conditional>
+                <conditional name="signal_peptides">
+                    <param name="selector" value="enabled"/>
+                    <param name="analyzeSignalP" value="signalP_results.txt"/>
+                    <param name="minSignalPeptideProbability" value="0.5"/>
+                </conditional>
+                <conditional name="disordered_regions">
+                    <param name="selector" value="iupred2a"/>
+                    <param name="AanalyzeIUPred2A" value="iupred2a_result.txt.gz"/>
+                    <param name="smoothingWindowSize" value="5"/>
+                    <param name="probabilityCutoff" value="0.5"/>
+                    <param name="minIdrSize" value="30"/>
+                    <param name="annotateBindingSites" value="true"/>
+                    <param name="minIdrBindingSize" value="15"/>
+                    <param name="minIdrBindingOverlapFrac" value="0.8"/>
+                </conditional>
+            </conditional>
+            <output name="switchList" ftype="rdata">
+                <assert_contents>
+                    <has_size value="542120" delta="300"/>
+                </assert_contents>
+            </output>
+            <output_collection name="plots_summary" type="list" count="7">
+                <element name="consequencesEnrichment" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="5995" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="extractConsequencesSummary" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="6617" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="splicingEnrichment" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="6361" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="splicingGenomewide" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="68069" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="splicingSummary" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="5990" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="switchGene" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="3611" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="volcanoPlot" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="3611" delta="300"/>
+                    </assert_contents>
+                </element>
+            </output_collection>
+            <output_collection name="genes_consequences" type="list" count="2">
+                <element name="1_switch_plot_NADK_aka_NADK" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="8716" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="2_switch_plot_PRKCZ_aka_PRKCZ" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="8463" delta="300"/>
+                    </assert_contents>
+                </element>
+            </output_collection>
+            <output_collection name="genes_wo_consequences" type="list" count="2">
+                <element name="1_switch_plot_CLSTN1_aka_CLSTN1" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="8559" delta="300"/>
+                    </assert_contents>
+                </element>
+                <element name="2_switch_plot_ZBTB40_aka_ZBTB40" ftype="pdf">
+                    <assert_contents>
+                        <has_size value="8051" delta="300"/>
+                    </assert_contents>
+                </element>
+            </output_collection>
+            <output name="mostSwitching" ftype="tabular">
+                <assert_contents>
+                    <has_size value="4062" delta="50"/>
+                    <has_text text="RPL11"/>
+                </assert_contents>
+            </output>
+            <output name="consequencesSummary" ftype="tabular">
+                <assert_contents>
+                    <has_size value="1192" delta="50"/>
+                    <has_text text="nrGenesWithConsequences"/>
+                </assert_contents>
+            </output>
+            <output name="consequencesEnrichment" ftype="tabular">
+                <assert_contents>
+                    <has_size value="1432" delta="50"/>
+                    <has_text text="NMD insensitive (paired with NMD sensitive"/>
+                </assert_contents>
+            </output>
+            <output name="splicingSummary" ftype="tabular">
+                <assert_contents>
+                    <has_size value="892" delta="50"/>
+                    <has_text text="MEE in isoform used less"/>
+                </assert_contents>
+            </output>
+            <output name="splicingEnrichment" ftype="tabular">
+                <assert_contents>
+                    <has_size value="1157" delta="50"/>
+                    <has_text text="A5 gain (paired with A5 loss)"/>
+                </assert_contents>
+            </output>
+        </test>
+        <!-- Test 08: analyze single gene-->
+        <test expect_num_outputs="2">
+            <conditional name="functionMode">
+                <param name="selector" value="second_step"/>
+                <param name="robject" value="test04.RData"/>
+                <conditional name="analysis_mode">
+                    <param name="selector" value="single"/>
+                    <param name="gene" value="NADK"/>
+                </conditional>
+            </conditional>
+            <output name="single_gene" ftype="pdf" file="test08_single_gene.pdf" compare="sim_size"/>
+            <output name="switchList" ftype="rdata">
+                <assert_contents>
+                    <has_size value="531580" delta="300"/>
+                </assert_contents>
+            </output>        
+        </test>
+    </tests>
+    <help><![CDATA[
+
+.. class:: infomark
+
+**Purpose**
+
+IsoformSwitchAnalyzeR is an easy-to use-R package that enables statistical identification of isoform switching from RNA-seq derived quantification 
+of novel and/or annotated full-length isoforms. IsoformSwitchAnalyzeR facilitates integration of many sources of (predicted) annotation such as Open 
+Reading Frame (ORF/CDS), protein domains (via Pfam), signal peptides (via SignalP), Intrinsically Disordered Regions (IDR, via NetSurfP-2 or IUPred2A), 
+coding potential (via CPAT or CPC2) and sensitivity to Non-sense Mediated Decay (NMD) and more. The combination of identified isoform switches and 
+their annotation enables IsoformSwitchAnalyzeR to predict potential functional consequences of the identified isoform switches — such as loss of 
+protein domains — thereby identifying isoform switches of particular interest. Lastly, IsoformSwitchAnalyzeR provides article-ready visualization 
+methods for isoform switches for individual genes as well as both summary statistics and visualization of the genome-wide changes/consequences of 
+isoform switches, their consequences and the associated alternative splicing.
+
+-----
+
+.. class:: infomark
+
+**Differential isoform expression (DIE) and differential isoform usage (DIU)**
+
+Differential isoform expression (DIE) and differential isoform usage (DIU) are related but distinct concepts. DIE assesses the difference of 
+absolute expression in isoform level. In contrast, DIU assesses the difference of relative expression in isoform level. For example, if the 
+expression of two isoforms of one gene are 10 and 20 in control and 50 and 100 in case, then there is DIE but no DIU because the relative 
+expression of the first isoform is 1/3 in both case and control. 
+
+-----
+
+.. class:: infomark
+
+**ORF identification methods (novel isoform analysis)**
+
+- **Longest**: Identifies the longest ORF in the transcript (after filtering via minORFlength). This approach is similar to what the CPAT tool uses in it is analysis of coding potential.
+- **LongestAnnotated**: Identifies the longest ORF (after filtering via minORFlength) downstream of an annotated translation start site (which are supplied via the cds argument).
+- **Longest.AnnotatedWhenPossible**: A merge between "longestAnnotated" and "longest". For all isoforms where CDS start positions from known isoform overlap, only these CDS starts are considered and the longest ORF is annotated (similar to "longestAnnotated"). All isoforms without any overlapping CDS start sites they will be analysed with the "longest" approach.
+- **MostUpstream**: Identifies the most upstream ORF in the transcript (after filtering via minORFlength).
+- **MostUpstreamAnnoated**: Identifies the ORF (after filtering via minORFlength) downstream of the most upstream overlapping annotated translation start site (supplied via the cds argument).
+
+    ]]></help>
+    <expand macro="citations" />
+</tool>
diff -r 000000000000 -r f3fefb6d8254 macros.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,68 @@
+<macros>
+    <token name="@TOOL_VERSION@">1.20.0</token>
+    <token name="@SUFFIX_VERSION@">0</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@TOOL_VERSION@">bioconductor-isoformswitchanalyzer</requirement>
+            <requirement type="package" version="2.2.1">r-argparse</requirement>
+            <requirement type="package" version="1.0.10">r-dplyr</requirement>
+        </requirements>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/bioinformatics/btz247</citation>
+            <citation type="doi">10.1158/1541-7786.MCR-16-0459</citation>
+        </citations>
+    </xml>
+    <xml name="xrefs">
+        <xrefs>
+          <xref type="bio.tools">IsoformSwitchAnalyzeR</xref>
+          <xref type="bioconductor">isoformswitchanalyzer</xref>
+        </xrefs>
+    </xml>
+    <xml name="macro_disordered_regions">
+        <param argument="smoothingWindowSize" type="integer" min="1" value="5" label="Smoothing window size" help="An integer indicating how 
+            large a sliding window should be used to calculate a smoothed (via mean) disordered probability score of a particular position in
+            a peptide. This has as a smoothing effect which prevents IDRs from not being detected (or from being split into sub-IDRs) by a 
+            single residue with low probability. The trade off is worse accuracy of detecting the exact edges of the IDRs. To turn it off 
+            smoothing simply set to 1." />
+        <param argument="probabilityCutoff" type="float" min="0" value="0.5" label="Probability cutoff" help="Cutoff applied to the (smoothed) 
+            disordered probability score for calling a residue as disordered. The default, 30 amino acids, is an accepted standard for long IDRs" />
+        <param argument="minIdrSize" type="integer" min="0" value="30" label="Minimum IDR size" help="How long a stretch of disordered amino acid 
+            constitute the region part of the Intrinsically Disordered Region (IDR) definition. The default, 30 amino acids, is an accepted 
+            standard for long IDRs" />
+    </xml>
+    <xml name="macro_alpha_difcutoff">
+        <param argument="alpha" type="float" min="0" max="1" value="0.05" label="Alpha value" help="The cutoff which the FDR correct p-values must be smaller 
+            than for calling significant switches." />
+        <param argument="dIFcutoff" type="float" min="0" max="1" value="0.1" label="dIFcutoff" help="The cutoff which the changes in (absolute) isoform usage 
+            must be larger than before an isoform is considered switching. This cutoff can remove cases where isoforms with (very) low dIF values are deemed 
+            significant and thereby included in the downstream analysis. This cutoff is analogous to having a cutoff on log2 fold change in a normal differential
+            expression analysis of genes to ensure the genes have a certain effect size. Default is 0.1 (10%)" />
+    </xml>
+    <xml name="macro_ifcutoff" token_value="" token_help="">
+        <param argument="IFcutoff" type="float" min="0" max="1" value="@VALUE@" label="IFcutoff" help="@HELP@" />
+    </xml>
+    <xml name="macro_onlysigisoforms1">
+        <param argument="onlySigIsoforms" type="boolean" truevalue="--onlySigIsoforms" falsevalue="" checked="false" label="Only significantly differential 
+            used isoforms" help="This parameter indicates whether both isoforms the pairs considered if reduceFurtherToGenesWithConsequenshould be significantly 
+            differential used (as indicated by the alpha and dIFcutoff parameters). Default is disabled (aka only one of the isoforms in a pair should be
+            significantly differential used)" />
+    </xml>
+    <xml name="macro_onlysigisoforms2">
+        <param argument="onlySigIsoforms" type="boolean" truevalue="--onlySigIsoforms" falsevalue="" checked="false" label="Only significantly differential 
+            used isoforms" help="This parameter indicates whether to only consider significant isoforms, meaning only analyzing genes where at least two isoforms 
+            which both have significant usage changes in opposite direction (quite strict). Naturally this only works if the isoform switch test used have isoform 
+            resolution (which the build in *isoformSwitchTestDEXSeq* has). If disabled all isoforms with an absolute dIF value larger than dIFcutoff in a gene with 
+            significant switches (defined by alpha and dIFcutoff) are included in the pairwise comparison" />
+    </xml>
+    <xml name="macro_keeisoforminall" token_checked="">
+        <param argument="keepIsoformInAllConditions" type="boolean" truevalue="--keepIsoformInAllConditions" falsevalue="" checked="@CHECKED@" label="Keep isoforms in all conditions" 
+            help="This parameter indicates whether an isoform should be kept in all comparisons even if it is only deemed significant (as defined by the 
+            alpha and dIFcutoff parameters) in one comparison" />
+    </xml>
+    <xml name="macro_onlyswitching">
+        <param argument="onlySwitchingGenes" type="boolean" truevalue="--onlySwitchingGenes" falsevalue="" checked="true" label="Only switching genes" help="Only 
+            analyze genes with isoform switches (as indicated by the alpha and dIFcutoff parameters)" />
+    </xml>
+</macros>
\ No newline at end of file
diff -r 000000000000 -r f3fefb6d8254 test-data/annotation_salmon.gtf.gz
Binary file test-data/annotation_salmon.gtf.gz has changed
diff -r 000000000000 -r f3fefb6d8254 test-data/cpc2_result.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cpc2_result.txt	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,163 @@
+#ID	peptide_length	Fickett_score	pI	ORF_integrity	coding_probability	label
+TCONS_00000007	390	0.2582	10.4859008789	1	0.95915	coding
+TCONS_00000008	390	0.25739	10.4859008789	1	0.957303	coding
+TCONS_00000009	390	0.25739	10.4859008789	1	0.957303	coding
+TCONS_00000018	25	0.31765	6.51007080078	1	0.00467786	noncoding
+TCONS_00000019	25	0.26913	6.51007080078	1	0.00858439	noncoding
+TCONS_00000020	92	0.2912	5.29876708984	1	0.189591	noncoding
+TCONS_00000045	803	0.37445	8.87176513672	1	1	coding
+TCONS_00000046	639	0.40486	8.06036376953	1	1	coding
+TCONS_00000047	639	0.37861	8.06036376953	1	1	coding
+TCONS_00000048	705	0.37861	8.63128662109	1	1	coding
+TCONS_00000049	428	0.36298	8.53863525391	1	0.999999	coding
+TCONS_00000066	635	0.44536	9.07708740234	1	1	coding
+TCONS_00000067	587	0.43101	9.26470947266	1	1	coding
+TCONS_00000068	508	0.43101	9.27154541016	1	1	coding
+TCONS_00000173	245	0.28197	7.08636474609	1	0.979227	coding
+TCONS_00000174	635	0.46597	6.21282958984	1	1	coding
+TCONS_00000175	196	0.37128	9.26434326172	1	0.958991	coding
+TCONS_00000176	293	0.45712	6.01593017578	1	0.999998	coding
+TCONS_00000190	240	0.44582	10.256652832	1	0.999427	coding
+TCONS_00000191	239	0.46696	10.256652832	1	0.999722	coding
+TCONS_00000192	176	0.32021	8.80865478516	1	0.733325	coding
+TCONS_00000219	393	0.40691	9.05352783203	1	1	coding
+TCONS_00000220	643	0.41764	9.43267822266	1	1	coding
+TCONS_00000221	1045	0.46291	6.78863525391	1	1	coding
+TCONS_00000222	1044	0.45332	6.78863525391	1	1	coding
+TCONS_00000223	1069	0.44806	6.76422119141	1	1	coding
+TCONS_00000234	1154	0.39339	8.66094970703	1	1	coding
+TCONS_00000235	1771	0.41107	5.38665771484	1	1	coding
+TCONS_00000236	1817	0.41259	5.41876220703	1	1	coding
+TCONS_00000237	1798	0.43495	5.29583740234	1	1	coding
+TCONS_00000240	1810	0.43495	5.38397216797	1	1	coding
+TCONS_00000245	139	0.34852	5.82745361328	1	0.76941	coding
+TCONS_00000246	165	0.31325	7.64581298828	1	0.703493	coding
+TCONS_00000248	123	0.33613	10.3421020508	1	0.264633	noncoding
+TCONS_00000298	758	0.45593	6.52203369141	1	1	coding
+TCONS_00000299	758	0.46041	6.52203369141	1	1	coding
+TCONS_00000312	667	0.36679	6.41033935547	1	1	coding
+TCONS_00000313	387	0.30609	6.46966552734	1	0.999993	coding
+TCONS_00000339	227	0.33385	9.29840087891	1	0.961376	coding
+TCONS_00000340	1683	0.47452	6.66705322266	1	1	coding
+TCONS_00000341	1719	0.4579	7.02398681641	1	1	coding
+TCONS_00000342	98	0.3518	4.85064697266	1	0.369301	noncoding
+TCONS_00000343	600	0.45355	4.98431396484	-1	0.998486	coding
+TCONS_00000344	1482	0.47872	6.41021728516	1	1	coding
+TCONS_00000345	116	0.30429	10.1972045898	-1	0.162618	noncoding
+TCONS_00000356	254	0.40674	5.39898681641	1	0.999957	coding
+TCONS_00000357	254	0.42462	5.39898681641	1	0.999972	coding
+TCONS_00000358	136	0.30721	10.6095581055	1	0.237752	noncoding
+TCONS_00000359	254	0.40509	5.39898681641	1	0.999955	coding
+TCONS_00000360	254	0.38471	5.39898681641	1	0.999917	coding
+TCONS_00000411	102	0.3652	10.3181762695	1	0.208176	noncoding
+TCONS_00000412	165	0.30507	8.96710205078	1	0.542238	coding
+TCONS_00000413	199	0.32603	9.98638916016	1	0.824741	coding
+TCONS_00000414	177	0.30012	12.1777954102	1	0.240739	noncoding
+TCONS_00000415	289	0.28925	6.91888427734	1	0.997798	coding
+TCONS_00000417	93	0.29021	5.77752685547	1	0.154229	noncoding
+TCONS_00000418	171	0.34593	9.22052001953	1	0.793203	coding
+TCONS_00000493	273	0.31388	5.44525146484	1	0.999661	coding
+TCONS_00000494	63	0.38578	5.38140869141	-1	0.0255393	noncoding
+TCONS_00000507	1240	0.41886	6.11456298828	1	1	coding
+TCONS_00000508	1240	0.41886	6.11456298828	1	1	coding
+TCONS_00000509	1128	0.4155	6.19488525391	1	1	coding
+TCONS_00000558	905	0.35693	11.8355102539	1	1	coding
+TCONS_00000559	917	0.37177	11.8427124023	1	1	coding
+TCONS_00000560	707	0.41144	12.0840454102	-1	0.590766	coding
+TCONS_00000561	799	0.39573	12.0907592773	-1	0.384218	noncoding
+TCONS_00003865	131	0.33101	4.31634521484	1	0.8266	coding
+TCONS_00003866	363	0.47306	4.75836181641	1	1	coding
+TCONS_00003867	349	0.43811	4.98883056641	1	1	coding
+TCONS_00003869	255	0.4393	5.52716064453	1	0.999977	coding
+TCONS_00003870	95	0.36513	5.01495361328	1	0.348122	noncoding
+TCONS_00003880	565	0.40886	5.74761962891	1	1	coding
+TCONS_00003881	760	0.41105	6.65594482422	1	1	coding
+TCONS_00003882	835	0.43697	5.69305419922	1	1	coding
+TCONS_00003901	451	0.42628	6.42291259766	1	1	coding
+TCONS_00003902	445	0.42628	6.42291259766	1	1	coding
+TCONS_00003903	342	0.434	6.46282958984	1	1	coding
+TCONS_00003904	443	0.42212	6.74627685547	1	1	coding
+TCONS_00003905	434	0.39568	6.62261962891	1	1	coding
+TCONS_00003911	299	0.29328	10.7870483398	1	0.932855	coding
+TCONS_00003912	299	0.3229	10.7870483398	1	0.983173	coding
+TCONS_00003913	227	0.29166	9.14459228516	1	0.865354	coding
+TCONS_00003914	521	0.32085	10.2689819336	1	0.999992	coding
+TCONS_00003915	299	0.37046	10.7870483398	1	0.998482	coding
+TCONS_00003916	299	0.37606	10.7870483398	1	0.998852	coding
+TCONS_00003919	88	0.32247	8.95391845703	1	0.0768122	noncoding
+TCONS_00003920	175	0.40594	5.28411865234	1	0.993375	coding
+TCONS_00003921	400	0.41262	6.09429931641	1	1	coding
+TCONS_00003937	247	0.35124	6.90704345703	1	0.998433	coding
+TCONS_00003938	200	0.27379	9.26190185547	1	0.612922	coding
+TCONS_00003939	406	0.33427	8.64654541016	1	0.999988	coding
+TCONS_00003940	406	0.36022	8.64654541016	1	0.999998	coding
+TCONS_00003941	406	0.36022	8.64654541016	1	0.999998	coding
+TCONS_00003942	255	0.44417	8.50299072266	1	0.999875	coding
+TCONS_00003943	237	0.42944	6.72222900391	1	0.999783	coding
+TCONS_00003959	247	0.35124	7.68707275391	1	0.997117	coding
+TCONS_00003962	267	0.38203	8.27752685547	1	0.99952	coding
+TCONS_00004002	1230	0.41804	6.02728271484	1	1	coding
+TCONS_00004003	1542	0.39677	5.94085693359	1	1	coding
+TCONS_00004004	461	0.42883	6.36956787109	1	1	coding
+TCONS_00004005	436	0.45545	6.78009033203	1	1	coding
+TCONS_00004006	261	0.3185	8.07342529297	1	0.992714	coding
+TCONS_00004033	330	0.48037	7.66522216797	1	1	coding
+TCONS_00004034	351	0.46903	8.57061767578	1	1	coding
+TCONS_00004035	381	0.45317	8.85467529297	1	1	coding
+TCONS_00004036	266	0.47782	7.69989013672	1	0.999977	coding
+TCONS_00004037	371	0.47753	6.83697509766	1	1	coding
+TCONS_00004042	235	0.39553	5.70355224609	1	0.999737	coding
+TCONS_00004044	193	0.3727	4.98150634766	1	0.996425	coding
+TCONS_00004046	418	0.37805	6.01275634766	1	1	coding
+TCONS_00004049	427	0.38921	6.00994873047	1	1	coding
+TCONS_00004051	182	0.29544	6.61358642578	1	0.869812	coding
+TCONS_00004066	540	0.35446	5.74041748047	1	1	coding
+TCONS_00004067	231	0.37327	4.52069091797	1	0.999796	coding
+TCONS_00004068	598	0.42983	5.16754150391	1	1	coding
+TCONS_00004102	336	0.43537	9.26934814453	1	0.999997	coding
+TCONS_00004103	271	0.41692	8.95745849609	1	0.999841	coding
+TCONS_00004104	239	0.35865	9.64447021484	1	0.988602	coding
+TCONS_00004110	982	0.44298	4.81036376953	1	1	coding
+TCONS_00004111	972	0.44298	4.82574462891	1	1	coding
+TCONS_00004112	963	0.44298	4.86297607422	1	1	coding
+TCONS_00004208	280	0.43625	8.52239990234	1	0.999963	coding
+TCONS_00004209	156	0.44836	6.21368408203	1	0.97777	coding
+TCONS_00004210	803	0.45827	7.30816650391	1	1	coding
+TCONS_00004224	1118	0.46023	4.64739990234	1	1	coding
+TCONS_00004225	421	0.45899	4.53948974609	-1	0.973057	coding
+TCONS_00004226	421	0.44359	4.57159423828	-1	0.96468	coding
+TCONS_00004227	675	0.45899	4.70831298828	-1	0.999734	coding
+TCONS_00004228	66	0.33686	6.80340576172	1	0.0354495	noncoding
+TCONS_00004229	58	0.29129	5.33721923828	1	0.0407299	noncoding
+TCONS_00004230	58	0.31538	5.33721923828	1	0.0352243	noncoding
+TCONS_00004240	290	0.33959	9.24139404297	1	0.997755	coding
+TCONS_00004241	690	0.33757	8.11077880859	1	1	coding
+TCONS_00004265	244	0.27217	10.4834594727	1	0.687188	coding
+TCONS_00004266	79	0.43829	4.32464599609	1	0.437694	noncoding
+TCONS_00004267	707	0.47238	6.42047119141	1	1	coding
+TCONS_00004269	848	0.47412	5.32684326172	1	1	coding
+TCONS_00004270	895	0.47183	5.22821044922	1	1	coding
+TCONS_00004271	893	0.44107	5.22821044922	1	1	coding
+TCONS_00004310	54	0.37557	9.51605224609	1	0.0330365	noncoding
+TCONS_00004311	79	0.32206	5.22454833984	1	0.1083	noncoding
+TCONS_00004325	213	0.34713	9.88677978516	1	0.941803	coding
+TCONS_00004326	402	0.33446	10.098449707	1	0.999891	coding
+TCONS_00004327	516	0.35013	9.76885986328	1	1	coding
+TCONS_00004328	554	0.39012	9.68572998047	1	1	coding
+TCONS_00004329	516	0.38144	9.76885986328	1	1	coding
+TCONS_00004330	554	0.44952	9.68572998047	1	1	coding
+TCONS_00004332	344	0.41511	9.41571044922	1	0.999995	coding
+TCONS_00004333	134	0.44227	4.53216552734	1	0.966241	coding
+TCONS_00004375	244	0.43202	9.56231689453	1	0.999455	coding
+TCONS_00004376	637	0.47308	8.22589111328	1	1	coding
+TCONS_00004377	634	0.47308	8.22589111328	1	1	coding
+TCONS_00004378	533	0.47513	9.19793701172	1	1	coding
+TCONS_00004379	536	0.47513	9.19793701172	1	1	coding
+TCONS_00004380	495	0.46189	9.26446533203	1	1	coding
+TCONS_00004381	596	0.45922	8.41583251953	1	1	coding
+TCONS_00004382	474	0.47513	9.34429931641	1	1	coding
+TCONS_00004439	288	0.3259	9.63568115234	1	0.993329	coding
+TCONS_00004440	243	0.32342	9.61492919922	1	0.961925	coding
+TCONS_00004441	335	0.33728	9.78558349609	1	0.999271	coding
+TCONS_00004442	335	0.33728	9.78558349609	1	0.999271	coding
+TCONS_00004443	115	0.32346	9.71331787109	1	0.190316	noncoding
diff -r 000000000000 -r f3fefb6d8254 test-data/iupred2a_result.txt.gz
Binary file test-data/iupred2a_result.txt.gz has changed
diff -r 000000000000 -r f3fefb6d8254 test-data/pfam_results.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/pfam_results.txt	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,369 @@
+# pfam_scan.pl,  run at Mon Feb  4 16:16:14 2019
+#
+# Copyright (c) 2009 Genome Research Ltd
+# Freely distributed under the GNU 
+# General Public License
+#
+# Authors: Jaina Mistry (jm14@sanger.ac.uk), John Tate (jt6@sanger.ac.uk), 
+#          Rob Finn (rdf@sanger.ac.uk)
+#
+# This is free software; you can redistribute it and/or modify it under
+# the terms of the GNU General Public License as published by the Free Software
+# Foundation; either version 2 of the License, or (at your option) any later version.
+# This program is distributed in the hope that it will be useful, but WITHOUT
+# ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS
+# FOR A PARTICULAR PURPOSE. See the GNU General Public License for more
+# details.
+#
+# You should have received a copy of the GNU General Public License along with
+# this program. If not, see <http://www.gnu.org/licenses/>. 
+# = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = =
+#      query sequence file: 01_intermediary_test_data_AA.fasta
+#     cpu number specified: 20
+#        searching against: /aura-internal/software/PfamScan/datafiles//Pfam-A.hmm, with cut off --cut_ga
+#    resolve clan overlaps: on
+#     predict active sites: on
+# = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = =
+#
+# <seq id> <alignment start> <alignment end> <envelope start> <envelope end> <hmm acc> <hmm name> <type> <hmm start> <hmm end> <hmm length> <bit score> <E-value> <significance> <clan> <predicted_active_site_residues>
+
+TCONS_00000045    227    714    227    714 PF00858.19  ASC               Family     1   439   439    277.4   1.7e-82   1 No_clan  
+TCONS_00000046     63    550     63    550 PF00858.19  ASC               Family     1   439   439    278.4   8.4e-83   1 No_clan  
+TCONS_00000047     63    550     63    550 PF00858.19  ASC               Family     1   439   439    278.4   8.4e-83   1 No_clan  
+TCONS_00000048    129    616    129    616 PF00858.19  ASC               Family     1   439   439    277.9   1.2e-82   1 No_clan  
+TCONS_00000049     92    339     89    339 PF00858.19  ASC               Family   199   439   439    182.9     8e-54   1 No_clan  
+TCONS_00000066     24     94     20    102 PF12037.3   DUF3523           Family     4    73   276     64.5   7.2e-18   1 No_clan  
+TCONS_00000066    141    334    131    334 PF12037.3   DUF3523           Family    72   276   276    241.7     7e-72   1 No_clan  
+TCONS_00000066    396    522    396    523 PF00004.24  AAA               Family     1   131   132     70.7   1.3e-19   1 CL0023   
+TCONS_00000067     24    286     20    286 PF12037.3   DUF3523           Family     4   276   276    326.1   1.2e-97   1 No_clan  
+TCONS_00000067    348    474    348    475 PF00004.24  AAA               Family     1   131   132     70.8   1.1e-19   1 CL0023   
+TCONS_00000068      1    207      1    207 PF12037.3   DUF3523           Family    59   276   276    251.4   7.7e-75   1 No_clan  
+TCONS_00000068    269    395    269    396 PF00004.24  AAA               Family     1   131   132     71.2   8.8e-20   1 CL0023   
+TCONS_00000173     25     63     25     63 PF00097.20  zf-C3HC4          Domain     1    41    41     23.9   2.3e-05   1 CL0229   
+TCONS_00000174     25     63     25     63 PF00097.20  zf-C3HC4          Domain     1    41    41     22.1   8.4e-05   1 CL0229   
+TCONS_00000174     95    144     93    145 PF00643.19  zf-B_box          Domain     3    41    42     35.4   7.1e-09   1 No_clan  
+TCONS_00000190      3     86      3     88 PF05485.7   THAP              Domain     1    83    85     71.5   4.6e-20   1 No_clan  
+TCONS_00000191      3     86      3     88 PF05485.7   THAP              Domain     1    83    85     71.5   4.6e-20   1 No_clan  
+TCONS_00000192      3     86      3     88 PF05485.7   THAP              Domain     1    83    85     72.5   2.3e-20   1 No_clan  
+TCONS_00000219     46    171     46    171 PF09779.4   Ima1_N            Family     1   131   131    134.7   2.5e-39   1 No_clan  
+TCONS_00000219    192    391    191    392 PF10476.4   DUF2448           Family     2   203   204    285.0   2.7e-85   1 No_clan  
+TCONS_00000220     46    171     46    171 PF09779.4   Ima1_N            Family     1   131   131    133.5   6.1e-39   1 No_clan  
+TCONS_00000220    192    388    191    392 PF10476.4   DUF2448           Family     2   200   204    280.1   8.5e-84   1 No_clan  
+TCONS_00000221     31    108     31    108 PF02192.11  PI3K_p85B         Family     1    78    78    112.5   4.5e-33   1 No_clan  
+TCONS_00000221    176    281    175    281 PF00794.13  PI3K_rbd          Family     2   107   107    105.5   1.2e-30   1 CL0072   
+TCONS_00000221    338    466    337    472 PF00792.19  PI3K_C2           Domain     2   136   143    120.0   6.1e-35   1 CL0154   
+TCONS_00000221    502    682    499    684 PF00613.15  PI3Ka             Family     4   183   185    184.5     1e-54   1 CL0020   
+TCONS_00000221    775    989    773    991 PF00454.22  PI3_PI4_kinase    Family     3   233   235    194.7   1.6e-57   1 No_clan  
+TCONS_00000222     31    108     31    108 PF02192.11  PI3K_p85B         Family     1    78    78    112.5   4.4e-33   1 No_clan  
+TCONS_00000222    176    281    175    281 PF00794.13  PI3K_rbd          Family     2   107   107    105.5   1.2e-30   1 CL0072   
+TCONS_00000222    338    466    337    472 PF00792.19  PI3K_C2           Domain     2   136   143    120.0   6.1e-35   1 CL0154   
+TCONS_00000222    506    681    500    683 PF00613.15  PI3Ka             Family     9   183   185    182.4   4.5e-54   1 CL0020   
+TCONS_00000222    774    988    772    990 PF00454.22  PI3_PI4_kinase    Family     3   233   235    194.7   1.6e-57   1 No_clan  
+TCONS_00000223     31    108     31    108 PF02192.11  PI3K_p85B         Family     1    78    78    112.4   4.6e-33   1 No_clan  
+TCONS_00000223    176    261    175    265 PF00794.13  PI3K_rbd          Family     2    87   107     75.7   2.2e-21   1 CL0072   
+TCONS_00000223    303    431    302    437 PF00792.19  PI3K_C2           Domain     2   136   143    120.0   6.3e-35   1 CL0154   
+TCONS_00000223    526    706    523    708 PF00613.15  PI3Ka             Family     4   183   185    184.4   1.1e-54   1 CL0020   
+TCONS_00000223    799   1013    797   1015 PF00454.22  PI3_PI4_kinase    Family     3   233   235    194.6   1.6e-57   1 No_clan  
+TCONS_00000234     11    348     11    348 PF00225.18  Kinesin           Domain     1   335   335    390.9  3.3e-117   1 CL0023   
+TCONS_00000234    512    581    510    581 PF00498.21  FHA               Family     3    68    68     31.3   1.6e-07   1 CL0357   
+TCONS_00000235     11    348     11    348 PF00225.18  Kinesin           Domain     1   335   335    389.8  6.9e-117   1 CL0023   
+TCONS_00000235    512    581    510    581 PF00498.21  FHA               Family     3    68    68     30.5   2.7e-07   1 CL0357   
+TCONS_00000235    799    846    799    846 PF12423.3   KIF1B             Family     1    45    45     42.1     6e-11   1 No_clan  
+TCONS_00000235   1220   1367   1220   1368 PF12473.3   DUF3694           Family     1   139   140    148.7   7.6e-44   1 No_clan  
+TCONS_00000235   1657   1750   1656   1753 PF00169.24  PH                Domain     2   101   104     50.3   2.2e-13   1 CL0266   
+TCONS_00000236     11    354     11    354 PF00225.18  Kinesin           Domain     1   335   335    388.0  2.4e-116   1 CL0023   
+TCONS_00000236    558    627    556    627 PF00498.21  FHA               Family     3    68    68     30.5   2.8e-07   1 CL0357   
+TCONS_00000236    845    892    845    892 PF12423.3   KIF1B             Family     1    45    45     42.1   6.2e-11   1 No_clan  
+TCONS_00000236   1266   1413   1266   1414 PF12473.3   DUF3694           Family     1   139   140    148.7   7.8e-44   1 No_clan  
+TCONS_00000236   1703   1796   1702   1799 PF00169.24  PH                Domain     2   101   104     50.2   2.2e-13   1 CL0266   
+TCONS_00000237     11    354     11    354 PF00225.18  Kinesin           Domain     1   335   335    388.1  2.4e-116   1 CL0023   
+TCONS_00000237    532    601    530    601 PF00498.21  FHA               Family     3    68    68     30.5   2.8e-07   1 CL0357   
+TCONS_00000237    819    866    819    866 PF12423.3   KIF1B             Family     1    45    45     42.1   6.1e-11   1 No_clan  
+TCONS_00000237   1240   1387   1240   1388 PF12473.3   DUF3694           Family     1   139   140    148.7   7.7e-44   1 No_clan  
+TCONS_00000237   1677   1770   1676   1773 PF00169.24  PH                Domain     2   101   104     50.2   2.2e-13   1 CL0266   
+TCONS_00000240     11    354     11    354 PF00225.18  Kinesin           Domain     1   335   335    388.1  2.4e-116   1 CL0023   
+TCONS_00000240    544    613    542    613 PF00498.21  FHA               Family     3    68    68     30.5   2.8e-07   1 CL0357   
+TCONS_00000240    831    878    831    878 PF12423.3   KIF1B             Family     1    45    45     42.1   6.2e-11   1 No_clan  
+TCONS_00000240   1252   1399   1252   1400 PF12473.3   DUF3694           Family     1   139   140    148.7   7.8e-44   1 No_clan  
+TCONS_00000240   1689   1782   1688   1785 PF00169.24  PH                Domain     2   101   104     50.2   2.2e-13   1 CL0266   
+TCONS_00000245     17     92     17     92 PF15630.1   CENP-S            Family     1    76    76    116.4   4.5e-34   1 CL0012   
+TCONS_00000246     17     92     17     92 PF15630.1   CENP-S            Family     1    76    76    115.8   6.9e-34   1 CL0012   
+TCONS_00000246    147    163    146    163 PF03002.10  Somatostatin      Family     2    18    18     33.4   2.2e-08   1 No_clan  
+TCONS_00000298     99    258     99    259 PF00350.18  Dynamin_N         Family     1   167   168     82.8   2.3e-23   1 CL0023   
+TCONS_00000298    586    755    586    756 PF04799.8   Fzo_mitofusin     Family     1   170   171    275.8   8.5e-83   1 No_clan  
+TCONS_00000299     99    258     99    259 PF00350.18  Dynamin_N         Family     1   167   168     82.8   2.3e-23   1 CL0023   
+TCONS_00000299    586    755    586    756 PF04799.8   Fzo_mitofusin     Family     1   170   171    275.8   8.5e-83   1 No_clan  
+TCONS_00000339     93    141     60    141 PF00856.23  SET               Family   113   162   162     29.6   7.3e-07   1 No_clan  
+TCONS_00000340     93    141     41    141 PF00856.23  SET               Family   113   162   162     25.7   1.1e-05   1 No_clan  
+TCONS_00000340    360    382    360    383 PF13894.1   zf-C2H2_4         Domain     1    23    24     16.9    0.0057   1 CL0361   
+TCONS_00000340    390    412    390    412 PF00096.21  zf-C2H2           Domain     1    23    23     17.5    0.0036   1 CL0361   
+TCONS_00000340    483    506    483    506 PF13894.1   zf-C2H2_4         Domain     1    24    24     17.7     0.003   1 CL0361   
+TCONS_00000340   1134   1156   1134   1157 PF13894.1   zf-C2H2_4         Domain     1    23    24     10.0       0.9   1 CL0361   
+TCONS_00000340   1191   1214   1191   1214 PF13894.1   zf-C2H2_4         Domain     1    24    24      9.8         1   1 CL0361   
+TCONS_00000340   1455   1473   1455   1475 PF13894.1   zf-C2H2_4         Domain     1    19    24     13.5     0.068   1 CL0361   
+TCONS_00000341     93    141     41    141 PF00856.23  SET               Family   113   162   162     25.7   1.2e-05   1 No_clan  
+TCONS_00000341    360    382    360    383 PF13894.1   zf-C2H2_4         Domain     1    23    24     16.8    0.0058   1 CL0361   
+TCONS_00000341    390    412    390    412 PF00096.21  zf-C2H2           Domain     1    23    23     17.5    0.0037   1 CL0361   
+TCONS_00000341    483    506    483    506 PF13894.1   zf-C2H2_4         Domain     1    24    24     17.7    0.0031   1 CL0361   
+TCONS_00000341   1134   1156   1134   1157 PF13894.1   zf-C2H2_4         Domain     1    23    24      9.9      0.92   1 CL0361   
+TCONS_00000341   1191   1214   1191   1214 PF13894.1   zf-C2H2_4         Domain     1    24    24      9.7       1.1   1 CL0361   
+TCONS_00000341   1455   1473   1455   1475 PF13894.1   zf-C2H2_4         Domain     1    19    24     13.4      0.07   1 CL0361   
+TCONS_00000342      9     56      2     56 PF00856.23  SET               Family   114   162   162     31.0   2.7e-07   1 No_clan  
+TCONS_00000343    117    139    117    140 PF13894.1   zf-C2H2_4         Domain     1    23    24     18.5    0.0018   1 CL0361   
+TCONS_00000343    147    169    147    169 PF00096.21  zf-C2H2           Domain     1    23    23     19.1    0.0011   1 CL0361   
+TCONS_00000343    240    263    240    263 PF13894.1   zf-C2H2_4         Domain     1    24    24     19.3   0.00093   1 CL0361   
+TCONS_00000344    159    181    159    182 PF13894.1   zf-C2H2_4         Domain     1    23    24     17.1    0.0049   1 CL0361   
+TCONS_00000344    189    211    189    211 PF00096.21  zf-C2H2           Domain     1    23    23     17.7    0.0031   1 CL0361   
+TCONS_00000344    282    305    282    305 PF13894.1   zf-C2H2_4         Domain     1    24    24     17.9    0.0026   1 CL0361   
+TCONS_00000344    933    955    933    956 PF13894.1   zf-C2H2_4         Domain     1    23    24     10.2      0.78   1 CL0361   
+TCONS_00000344    990   1013    990   1013 PF13894.1   zf-C2H2_4         Domain     1    24    24     10.0      0.91   1 CL0361   
+TCONS_00000344   1254   1272   1254   1274 PF13894.1   zf-C2H2_4         Domain     1    19    24     13.7     0.059   1 CL0361   
+TCONS_00000356      6    240      6    240 PF15345.1   TMEM51            Family     1   233   233    339.3  1.2e-101   1 No_clan  
+TCONS_00000357      6    240      6    240 PF15345.1   TMEM51            Family     1   233   233    339.3  1.2e-101   1 No_clan  
+TCONS_00000358      6    120      6    132 PF15345.1   TMEM51            Family     1   113   233    163.8   4.8e-48   1 No_clan  
+TCONS_00000359      6    240      6    240 PF15345.1   TMEM51            Family     1   233   233    339.3  1.2e-101   1 No_clan  
+TCONS_00000360      6    240      6    240 PF15345.1   TMEM51            Family     1   233   233    339.3  1.2e-101   1 No_clan  
+TCONS_00000411      2     40      1     44 PF00024.21  PAN_1             Domain    37    77    79     29.3   4.9e-07   1 CL0168   
+TCONS_00000412      2     40      1     43 PF00024.21  PAN_1             Domain    37    77    79     28.2   1.1e-06   1 CL0168   
+TCONS_00000412     47     81     47     91 PF00051.13  Kringle           Domain     1    35    79     33.7   2.8e-08   1 No_clan  
+TCONS_00000412    112    149     89    149 PF00051.13  Kringle           Domain    43    79    79     48.9   4.9e-13   1 No_clan  
+TCONS_00000413      6     42      2     42 PF00051.13  Kringle           Domain    44    79    79     47.5   1.3e-12   1 No_clan  
+TCONS_00000413     47     82     47     92 PF00051.13  Kringle           Domain     1    37    79     38.2   1.1e-09   1 No_clan  
+TCONS_00000415      2     40      1     43 PF00024.21  PAN_1             Domain    37    77    79     26.9   2.8e-06   1 CL0168   
+TCONS_00000415     47     81     47     93 PF00051.13  Kringle           Domain     1    35    79     32.6   6.3e-08   1 No_clan  
+TCONS_00000415    112    149     87    149 PF00051.13  Kringle           Domain    43    79    79     47.6   1.3e-12   1 No_clan  
+TCONS_00000415    154    231    154    231 PF00051.13  Kringle           Domain     1    79    79    101.3   2.1e-29   1 No_clan  
+TCONS_00000415    246    287    246    288 PF00051.13  Kringle           Domain     1    43    79     41.3   1.2e-10   1 No_clan  
+TCONS_00000417     41     68      2     68 PF00051.13  Kringle           Domain    53    79    79     30.6   2.6e-07   1 No_clan  
+TCONS_00000418     67    169     62    170 PF00089.21  Trypsin           Domain     9   111   220     71.8   5.8e-20   1 CL0124   
+TCONS_00000493    173    205    171    213 PF00057.13  Ldl_recept_a      Repeat     3    34    37     30.2   2.8e-07   1 No_clan  
+TCONS_00000507     18    114     14    116 PF00651.26  BTB               Domain     5   108   111     73.9   9.1e-21   1 CL0033   
+TCONS_00000507    809    830    807    830 PF13894.1   zf-C2H2_4         Domain     3    24    24     12.1      0.18   1 CL0361   
+TCONS_00000507    851    874    850    875 PF13465.1   zf-H2C2_2         Domain     2    25    26     24.1   2.9e-05   1 CL0361   
+TCONS_00000507    908    931    907    932 PF13465.1   zf-H2C2_2         Domain     2    25    26     31.7   1.1e-07   1 CL0361   
+TCONS_00000507    950    973    950    973 PF13894.1   zf-C2H2_4         Domain     1    24    24      9.4       1.4   1 CL0361   
+TCONS_00000507    978   1000    978   1000 PF00096.21  zf-C2H2           Domain     1    23    23     23.6   4.1e-05   1 CL0361   
+TCONS_00000507   1006   1029   1006   1029 PF13894.1   zf-C2H2_4         Domain     1    24    24      9.1       1.7   1 CL0361   
+TCONS_00000507   1047   1069   1046   1069 PF13894.1   zf-C2H2_4         Domain     2    24    24     11.9      0.21   1 CL0361   
+TCONS_00000507   1135   1158   1135   1158 PF13894.1   zf-C2H2_4         Domain     1    24    24     16.9    0.0055   1 CL0361   
+TCONS_00000508     18    114     14    116 PF00651.26  BTB               Domain     5   108   111     73.9   9.1e-21   1 CL0033   
+TCONS_00000508    809    830    807    830 PF13894.1   zf-C2H2_4         Domain     3    24    24     12.1      0.18   1 CL0361   
+TCONS_00000508    851    874    850    875 PF13465.1   zf-H2C2_2         Domain     2    25    26     24.1   2.9e-05   1 CL0361   
+TCONS_00000508    908    931    907    932 PF13465.1   zf-H2C2_2         Domain     2    25    26     31.7   1.1e-07   1 CL0361   
+TCONS_00000508    950    973    950    973 PF13894.1   zf-C2H2_4         Domain     1    24    24      9.4       1.4   1 CL0361   
+TCONS_00000508    978   1000    978   1000 PF00096.21  zf-C2H2           Domain     1    23    23     23.6   4.1e-05   1 CL0361   
+TCONS_00000508   1006   1029   1006   1029 PF13894.1   zf-C2H2_4         Domain     1    24    24      9.1       1.7   1 CL0361   
+TCONS_00000508   1047   1069   1046   1069 PF13894.1   zf-C2H2_4         Domain     2    24    24     11.9      0.21   1 CL0361   
+TCONS_00000508   1135   1158   1135   1158 PF13894.1   zf-C2H2_4         Domain     1    24    24     16.9    0.0055   1 CL0361   
+TCONS_00000509     18    114     14    116 PF00651.26  BTB               Domain     5   108   111     74.1     8e-21   1 CL0033   
+TCONS_00000509    697    718    695    718 PF13894.1   zf-C2H2_4         Domain     3    24    24     12.3      0.16   1 CL0361   
+TCONS_00000509    739    762    738    763 PF13465.1   zf-H2C2_2         Domain     2    25    26     24.2   2.6e-05   1 CL0361   
+TCONS_00000509    796    819    795    820 PF13465.1   zf-H2C2_2         Domain     2    25    26     31.9   9.9e-08   1 CL0361   
+TCONS_00000509    838    861    838    861 PF13894.1   zf-C2H2_4         Domain     1    24    24      9.5       1.3   1 CL0361   
+TCONS_00000509    866    888    866    888 PF00096.21  zf-C2H2           Domain     1    23    23     23.8   3.7e-05   1 CL0361   
+TCONS_00000509    894    917    894    917 PF13894.1   zf-C2H2_4         Domain     1    24    24      9.3       1.5   1 CL0361   
+TCONS_00000509    935    957    934    957 PF13894.1   zf-C2H2_4         Domain     2    24    24     12.1      0.19   1 CL0361   
+TCONS_00000509   1023   1046   1023   1046 PF13894.1   zf-C2H2_4         Domain     1    24    24     17.0    0.0049   1 CL0361   
+TCONS_00000558     45    116     45    118 PF01480.12  PWI               Family     1    75    77    104.0   3.2e-30   1 No_clan  
+TCONS_00000559     45    116     45    118 PF01480.12  PWI               Family     1    75    77    104.0   3.3e-30   1 No_clan  
+TCONS_00000560      6     77      6     79 PF01480.12  PWI               Family     1    75    77    104.4   2.3e-30   1 No_clan  
+TCONS_00000561      2     33      1     35 PF01480.12  PWI               Family    45    75    77     36.0   5.3e-09   1 No_clan  
+TCONS_00003866    103    163     97    166 PF13499.1   EF-hand_7         Domain     2    63    66     35.6   7.4e-09   1 CL0220   
+TCONS_00003866    287    305    283    307 PF13202.1   EF-hand_5         Domain     6    23    25     13.2      0.04   1 CL0220   
+TCONS_00003867    103    163     97    166 PF13499.1   EF-hand_7         Domain     2    63    66     35.7     7e-09   1 CL0220   
+TCONS_00003867    287    305    283    306 PF13202.1   EF-hand_5         Domain     6    23    25     13.6     0.031   1 CL0220   
+TCONS_00003869    103    163     93    166 PF13499.1   EF-hand_7         Domain     2    63    66     36.5   3.9e-09   1 CL0220   
+TCONS_00003880      1     92      1     93 PF00169.24  PH                Domain     3   103   104     46.7   2.9e-12   1 CL0266   
+TCONS_00003880    134    250    133    251 PF01412.13  ArfGap            Domain     2   116   117    140.2   2.3e-41   1 No_clan  
+TCONS_00003880    403    494    402    496 PF12796.2   Ank_2             Family     2    87    89     57.3   1.4e-15   1 CL0465   
+TCONS_00003881    227    320    227    321 PF00169.24  PH                Domain     1   103   104     48.5   7.9e-13   1 CL0266   
+TCONS_00003881    362    478    361    479 PF01412.13  ArfGap            Domain     2   116   117    139.6   3.6e-41   1 No_clan  
+TCONS_00003881    598    689    597    691 PF12796.2   Ank_2             Family     2    87    89     56.7   2.2e-15   1 CL0465   
+TCONS_00003882    269    362    269    363 PF00169.24  PH                Domain     1   103   104     48.3     9e-13   1 CL0266   
+TCONS_00003882    404    520    403    521 PF01412.13  ArfGap            Domain     2   116   117    139.4   4.1e-41   1 No_clan  
+TCONS_00003882    673    764    672    766 PF12796.2   Ank_2             Family     2    87    89     56.5   2.6e-15   1 CL0465   
+TCONS_00003901     38    145     33    156 PF07686.12  V-set             Domain     6   103   114     29.4   5.8e-07   1 CL0011   
+TCONS_00003901    171    277    161    291 PF07686.12  V-set             Domain     8   101   114     40.7   1.7e-10   1 CL0011   
+TCONS_00003902     38    145     33    156 PF07686.12  V-set             Domain     6   103   114     29.4   5.6e-07   1 CL0011   
+TCONS_00003902    171    277    161    291 PF07686.12  V-set             Domain     8   101   114     40.7   1.7e-10   1 CL0011   
+TCONS_00003903     70    176     59    190 PF07686.12  V-set             Domain     8   101   114     41.5     1e-10   1 CL0011   
+TCONS_00003904     38    145     33    156 PF07686.12  V-set             Domain     6   103   114     29.4   5.6e-07   1 CL0011   
+TCONS_00003904    171    277    161    291 PF07686.12  V-set             Domain     8   101   114     40.7   1.7e-10   1 CL0011   
+TCONS_00003905     29    136     24    147 PF07686.12  V-set             Domain     6   103   114     29.5   5.4e-07   1 CL0011   
+TCONS_00003905    162    268    152    282 PF07686.12  V-set             Domain     8   101   114     40.8   1.6e-10   1 CL0011   
+TCONS_00003911      5     66      1     90 PF02984.14  Cyclin_C          Domain    32    93   118     24.0   2.7e-05   1 CL0065   
+TCONS_00003912      5     66      1     90 PF02984.14  Cyclin_C          Domain    32    93   118     24.0   2.7e-05   1 CL0065   
+TCONS_00003913     72    191     54    192 PF00134.18  Cyclin_N          Domain    25   126   127     38.3   7.9e-10   1 CL0065   
+TCONS_00003914     72    191     55    192 PF00134.18  Cyclin_N          Domain    25   126   127     35.8     5e-09   1 CL0065   
+TCONS_00003914    215    288    195    312 PF02984.14  Cyclin_C          Domain    20    93   118     25.1   1.3e-05   1 CL0065   
+TCONS_00003915      5     66      1     90 PF02984.14  Cyclin_C          Domain    32    93   118     24.0   2.7e-05   1 CL0065   
+TCONS_00003916      5     66      1     90 PF02984.14  Cyclin_C          Domain    32    93   118     24.0   2.7e-05   1 CL0065   
+TCONS_00003921     45    102     31    104 PF12796.2   Ank_2             Family    30    87    89     40.5   2.5e-10   1 CL0465   
+TCONS_00003921    103    162    100    170 PF12796.2   Ank_2             Family    23    81    89     45.3     8e-12   1 CL0465   
+TCONS_00003921    182    266    181    266 PF12796.2   Ank_2             Family     2    89    89     51.5   9.5e-14   1 CL0465   
+TCONS_00003921    273    364    273    365 PF12796.2   Ank_2             Family     1    88    89     77.3   8.1e-22   1 CL0465   
+TCONS_00003937    116    193     83    198 PF00892.15  EamA              Family    27   104   126     22.5   8.8e-05   1 CL0184   
+TCONS_00003939    116    212     83    215 PF00892.15  EamA              Family    27   123   126     23.2   5.3e-05   1 CL0184   
+TCONS_00003939    224    368    224    369 PF03151.11  TPT               Family     1   152   153    115.0   2.2e-33   1 CL0184   
+TCONS_00003940    116    212     83    215 PF00892.15  EamA              Family    27   123   126     23.2   5.3e-05   1 CL0184   
+TCONS_00003940    224    368    224    369 PF03151.11  TPT               Family     1   152   153    115.0   2.2e-33   1 CL0184   
+TCONS_00003941    116    212     83    215 PF00892.15  EamA              Family    27   123   126     23.2   5.3e-05   1 CL0184   
+TCONS_00003941    224    368    224    369 PF03151.11  TPT               Family     1   152   153    115.0   2.2e-33   1 CL0184   
+TCONS_00003942    116    212    103    215 PF00892.15  EamA              Family    27   123   126     28.0   1.8e-06   1 CL0184   
+TCONS_00003943    116    212     89    215 PF00892.15  EamA              Family    27   123   126     26.4   5.4e-06   1 CL0184   
+TCONS_00003959    116    193     83    198 PF00892.15  EamA              Family    27   104   126     22.5   8.8e-05   1 CL0184   
+TCONS_00003962    116    193     83    198 PF00892.15  EamA              Family    27   104   126     22.8   6.9e-05   1 CL0184   
+TCONS_00004002     60     95     60     95 PF14670.1   FXa_inhibition    Domain     1    36    36     41.4   1.1e-10   1 CL0001   
+TCONS_00004002    101    137    101    137 PF14670.1   FXa_inhibition    Domain     1    36    36     34.7   1.3e-08   1 CL0001   
+TCONS_00004002    180    219    180    219 PF07645.10  EGF_CA            Domain     1    42    42     41.1   1.2e-10   1 CL0001   
+TCONS_00004002    230    265    230    265 PF14670.1   FXa_inhibition    Domain     1    36    36     36.2   4.6e-09   1 CL0001   
+TCONS_00004002    311    346    311    346 PF14670.1   FXa_inhibition    Domain     1    36    36     36.9   2.8e-09   1 CL0001   
+TCONS_00004002    463    508    462    508 PF00053.19  Laminin_EGF       Family     1    49    49     20.3   0.00038   1 CL0001   
+TCONS_00004002    684    725    677    727 PF00053.19  Laminin_EGF       Family     3    47    49     13.7     0.044   1 CL0001   
+TCONS_00004002    768    812    768    814 PF00053.19  Laminin_EGF       Family     1    49    49     15.6     0.011   1 CL0001   
+TCONS_00004002    941    978    941    986 PF00053.19  Laminin_EGF       Family     1    41    49     13.7     0.043   1 CL0001   
+TCONS_00004003    165    200    165    200 PF14670.1   FXa_inhibition    Domain     1    36    36     41.1   1.4e-10   1 CL0001   
+TCONS_00004003    206    242    206    242 PF14670.1   FXa_inhibition    Domain     1    36    36     34.4   1.7e-08   1 CL0001   
+TCONS_00004003    285    324    285    324 PF07645.10  EGF_CA            Domain     1    42    42     40.8   1.6e-10   1 CL0001   
+TCONS_00004003    335    370    335    370 PF14670.1   FXa_inhibition    Domain     1    36    36     35.8     6e-09   1 CL0001   
+TCONS_00004003    416    451    416    451 PF14670.1   FXa_inhibition    Domain     1    36    36     36.5   3.7e-09   1 CL0001   
+TCONS_00004003    568    613    568    613 PF00053.19  Laminin_EGF       Family     1    49    49     19.9   0.00049   1 CL0001   
+TCONS_00004003    873    917    873    919 PF00053.19  Laminin_EGF       Family     1    49    49     15.5     0.012   1 CL0001   
+TCONS_00004003   1132   1169   1132   1174 PF00053.19  Laminin_EGF       Family     1    41    49     19.0   0.00097   1 CL0001   
+TCONS_00004003   1175   1213   1175   1221 PF00053.19  Laminin_EGF       Family     1    41    49     15.5     0.011   1 CL0001   
+TCONS_00004003   1348   1385   1347   1393 PF00053.19  Laminin_EGF       Family     1    41    49     14.5     0.024   1 CL0001   
+TCONS_00004004    225    249    223    251 PF00400.27  WD40              Repeat    13    37    39     26.2   4.9e-06   1 CL0186   
+TCONS_00004005    225    249    223    251 PF00400.27  WD40              Repeat    13    37    39     26.3   4.6e-06   1 CL0186   
+TCONS_00004033     18     98     17    100 PF03061.17  4HBT              Domain     2    77    79     54.2   1.2e-14   1 CL0050   predicted_active_site[30]
+TCONS_00004033    191    260    191    266 PF03061.17  4HBT              Domain     1    71    79     62.1   3.8e-17   1 CL0050   predicted_active_site[204,204]
+TCONS_00004034     39    119     38    121 PF03061.17  4HBT              Domain     2    77    79     54.0   1.3e-14   1 CL0050   predicted_active_site[51]
+TCONS_00004034    212    281    212    287 PF03061.17  4HBT              Domain     1    71    79     62.0   4.2e-17   1 CL0050   predicted_active_site[225,225]
+TCONS_00004035     69    149     68    151 PF03061.17  4HBT              Domain     2    77    79     53.8   1.5e-14   1 CL0050   predicted_active_site[81]
+TCONS_00004035    242    311    242    317 PF03061.17  4HBT              Domain     1    71    79     61.8   4.8e-17   1 CL0050   predicted_active_site[255,255]
+TCONS_00004036    127    196    127    203 PF03061.17  4HBT              Domain     1    71    79     62.8   2.4e-17   1 CL0050   predicted_active_site[140,140]
+TCONS_00004037     59    139     58    141 PF03061.17  4HBT              Domain     2    77    79     53.9   1.4e-14   1 CL0050   predicted_active_site[71]
+TCONS_00004037    232    301    232    307 PF03061.17  4HBT              Domain     1    71    79     61.9   4.6e-17   1 CL0050   predicted_active_site[245,245]
+TCONS_00004042    151    228    150    230 PF00531.17  Death             Domain     2    81    83     62.9   1.7e-17   1 CL0041   
+TCONS_00004044    109    186    108    188 PF00531.17  Death             Domain     2    81    83     63.5   1.1e-17   1 CL0041   
+TCONS_00004046    334    411    333    413 PF00531.17  Death             Domain     2    81    83     61.4   4.9e-17   1 CL0041   
+TCONS_00004049    343    420    342    422 PF00531.17  Death             Domain     2    81    83     61.4   5.1e-17   1 CL0041   
+TCONS_00004051     73    115     73    115 PF00020.13  TNFR_c6           Domain     1    39    39     21.4   0.00019   1 No_clan  
+TCONS_00004066     25    132     25    133 PF00651.26  BTB               Domain     1   110   111    102.0   1.6e-29   1 CL0033   
+TCONS_00004066    138    239    138    239 PF07707.10  BACK              Domain     1   103   103     83.2   9.6e-24   1 CL0033   
+TCONS_00004066    288    321    284    321 PF01344.20  Kelch_1           Repeat    14    47    47     25.3   7.9e-06   1 CL0186   
+TCONS_00004066    327    368    326    369 PF01344.20  Kelch_1           Repeat     4    46    47     38.3   6.7e-10   1 CL0186   
+TCONS_00004066    371    408    371    409 PF01344.20  Kelch_1           Repeat     1    46    47     21.6   0.00011   1 CL0186   
+TCONS_00004067      4     41      4     42 PF01344.20  Kelch_1           Repeat     1    46    47     23.2   3.6e-05   1 CL0186   
+TCONS_00004067    135    182    134    183 PF13964.1   Kelch_6           Repeat     2    49    50     38.0   1.1e-09   1 CL0186   
+TCONS_00004068     25    132     25    133 PF00651.26  BTB               Domain     1   110   111    101.8   1.9e-29   1 CL0033   
+TCONS_00004068    138    239    138    239 PF07707.10  BACK              Domain     1   103   103     82.9   1.1e-23   1 CL0033   
+TCONS_00004068    288    321    284    321 PF01344.20  Kelch_1           Repeat    14    47    47     25.1     9e-06   1 CL0186   
+TCONS_00004068    327    368    326    369 PF01344.20  Kelch_1           Repeat     4    46    47     38.1   7.6e-10   1 CL0186   
+TCONS_00004068    371    408    371    409 PF01344.20  Kelch_1           Repeat     1    46    47     21.4   0.00013   1 CL0186   
+TCONS_00004068    502    549    501    550 PF13964.1   Kelch_6           Repeat     2    49    50     36.1   4.4e-09   1 CL0186   
+TCONS_00004102     18    236     13    274 PF00002.19  7tm_2             Family     8   211   243     53.1   2.2e-14   1 CL0192   
+TCONS_00004103     18    177     13    225 PF00002.19  7tm_2             Family     8   162   243     48.6   5.3e-13   1 CL0192   
+TCONS_00004104     18    177     13    208 PF00002.19  7tm_2             Family     8   162   243     50.8   1.1e-13   1 CL0192   
+TCONS_00004110    169    257    169    258 PF00028.12  Cadherin          Family     1    92    93     34.6   1.6e-08   1 CL0159   
+TCONS_00004110    363    551    360    554 PF13385.1   Laminin_G_3       Domain     4   153   157     45.5   8.5e-12   1 CL0004   
+TCONS_00004111    159    247    159    248 PF00028.12  Cadherin          Family     1    92    93     34.7   1.6e-08   1 CL0159   
+TCONS_00004111    353    541    350    544 PF13385.1   Laminin_G_3       Domain     4   153   157     45.5   8.4e-12   1 CL0004   
+TCONS_00004112    169    257    169    258 PF00028.12  Cadherin          Family     1    92    93     34.7   1.5e-08   1 CL0159   
+TCONS_00004112    363    532    360    535 PF13385.1   Laminin_G_3       Domain     4   153   157     48.2   1.3e-12   1 CL0004   
+TCONS_00004208    203    249    200    249 PF14604.1   SH3_9             Domain     5    49    49     34.1   1.4e-08   1 CL0010   
+TCONS_00004209     79    125     76    125 PF14604.1   SH3_9             Domain     5    49    49     35.5     5e-09   1 CL0010   
+TCONS_00004210    383    558    380    559 PF00621.15  RhoGEF            Domain     4   179   180    118.3   3.2e-34   1 No_clan  
+TCONS_00004210    726    772    723    772 PF14604.1   SH3_9             Domain     5    49    49     32.1   5.9e-08   1 CL0010   
+TCONS_00004224    180    243    180    243 PF06758.8   DUF1220           Domain     1    67    67     82.9   9.8e-24   1 No_clan  
+TCONS_00004224    451    514    451    514 PF06758.8   DUF1220           Domain     1    67    67     85.4   1.6e-24   1 No_clan  
+TCONS_00004224    722    782    722    784 PF06758.8   DUF1220           Domain     1    64    67     88.1   2.3e-25   1 No_clan  
+TCONS_00004224    808    870    808    871 PF06758.8   DUF1220           Domain     1    66    67     86.6   6.7e-25   1 No_clan  
+TCONS_00004224    880    946    880    946 PF06758.8   DUF1220           Domain     1    67    67    102.9   5.7e-30   1 No_clan  
+TCONS_00004224    955   1021    955   1021 PF06758.8   DUF1220           Domain     1    67    67    113.0     4e-33   1 No_clan  
+TCONS_00004224   1028   1094   1028   1094 PF06758.8   DUF1220           Domain     1    67    67    119.7   3.2e-35   1 No_clan  
+TCONS_00004225    180    240    180    242 PF06758.8   DUF1220           Domain     1    64    67     89.9   6.4e-26   1 No_clan  
+TCONS_00004225    266    328    266    329 PF06758.8   DUF1220           Domain     1    66    67     88.4   1.8e-25   1 No_clan  
+TCONS_00004225    338    404    338    404 PF06758.8   DUF1220           Domain     1    67    67    104.7   1.5e-30   1 No_clan  
+TCONS_00004226    180    240    180    242 PF06758.8   DUF1220           Domain     1    64    67     89.9   6.4e-26   1 No_clan  
+TCONS_00004226    266    328    266    329 PF06758.8   DUF1220           Domain     1    66    67     88.4   1.8e-25   1 No_clan  
+TCONS_00004226    338    404    338    404 PF06758.8   DUF1220           Domain     1    67    67    104.7   1.5e-30   1 No_clan  
+TCONS_00004227    180    243    180    243 PF06758.8   DUF1220           Domain     1    67    67     86.3   8.5e-25   1 No_clan  
+TCONS_00004227    451    511    451    513 PF06758.8   DUF1220           Domain     1    64    67     89.0   1.2e-25   1 No_clan  
+TCONS_00004227    537    599    537    600 PF06758.8   DUF1220           Domain     1    66    67     87.5   3.5e-25   1 No_clan  
+TCONS_00004227    609    674    609    674 PF06758.8   DUF1220           Domain     1    66    67    101.6   1.4e-29   1 No_clan  
+TCONS_00004240     67    282     62    282 PF00089.21  Trypsin           Domain     9   220   220    156.0     1e-45   1 CL0124   
+TCONS_00004241     30    108     19    110 PF00024.21  PAN_1             Domain     3    77    79     40.5   1.6e-10   1 CL0168   
+TCONS_00004241    119    156     75    156 PF00051.13  Kringle           Domain    43    79    79     46.3   3.3e-12   1 No_clan  
+TCONS_00004241    161    238    161    238 PF00051.13  Kringle           Domain     1    79    79     99.4   8.6e-29   1 No_clan  
+TCONS_00004241    253    345    253    345 PF00051.13  Kringle           Domain     1    79    79     31.3   1.5e-07   1 No_clan  
+TCONS_00004241    354    390    354    415 PF00051.13  Kringle           Domain     1    37    79     36.6   3.5e-09   1 No_clan  
+TCONS_00004241    437    464    425    464 PF00051.13  Kringle           Domain    53    79    79     26.6   4.5e-06   1 No_clan  
+TCONS_00004241    511    682    499    682 PF00089.21  Trypsin           Domain    49   220   220     99.1   2.6e-28   1 CL0124   
+TCONS_00004266      1     58      1     58 PF13764.1   E3_UbLigase_R4    Family   746   802   802     31.9   3.3e-08   1 No_clan  
+TCONS_00004267      1    104      1    107 PF13764.1   E3_UbLigase_R4    Family    72   173   802    130.0   7.1e-38   1 No_clan  
+TCONS_00004267    113    686    105    686 PF13764.1   E3_UbLigase_R4    Family   223   802   802    753.4  2.3e-226   1 No_clan  
+TCONS_00004269     58     98     58     99 PF13764.1   E3_UbLigase_R4    Family     1    41   802     76.2   1.3e-21   1 No_clan  
+TCONS_00004269     99    827     98    827 PF13764.1   E3_UbLigase_R4    Family    69   802   802    940.4  6.8e-283   1 No_clan  
+TCONS_00004270     78    874     78    874 PF13764.1   E3_UbLigase_R4    Family     1   802   802   1100.1         0   1 No_clan  
+TCONS_00004271     76    872     76    872 PF13764.1   E3_UbLigase_R4    Family     1   802   802   1100.1         0   1 No_clan  
+TCONS_00004311      1     78      1     78 PF15170.1   CaM-KIIN          Family     1    79    79    157.6   5.4e-47   1 No_clan  
+TCONS_00004325      5     70      1     71 PF00538.14  Linker_histone    Domain     9    75    77     44.2   1.5e-11   1 No_clan  
+TCONS_00004326      7     78      5     80 PF00538.14  Linker_histone    Domain     3    75    77     58.0     7e-16   1 No_clan  
+TCONS_00004326    115    178    108    178 PF00538.14  Linker_histone    Domain    13    77    77     38.2   1.1e-09   1 No_clan  
+TCONS_00004326    194    259    189    260 PF00538.14  Linker_histone    Domain     9    75    77     42.7   4.4e-11   1 No_clan  
+TCONS_00004327    121    192    119    194 PF00538.14  Linker_histone    Domain     3    75    77     57.5     1e-15   1 No_clan  
+TCONS_00004327    229    292    222    292 PF00538.14  Linker_histone    Domain    13    77    77     37.7   1.6e-09   1 No_clan  
+TCONS_00004327    308    373    303    374 PF00538.14  Linker_histone    Domain     9    75    77     42.2   6.3e-11   1 No_clan  
+TCONS_00004328    159    230    157    232 PF00538.14  Linker_histone    Domain     3    75    77     57.4   1.1e-15   1 No_clan  
+TCONS_00004328    267    330    260    330 PF00538.14  Linker_histone    Domain    13    77    77     37.5   1.8e-09   1 No_clan  
+TCONS_00004328    346    411    341    412 PF00538.14  Linker_histone    Domain     9    75    77     42.0     7e-11   1 No_clan  
+TCONS_00004329    121    192    119    194 PF00538.14  Linker_histone    Domain     3    75    77     57.5     1e-15   1 No_clan  
+TCONS_00004329    229    292    222    292 PF00538.14  Linker_histone    Domain    13    77    77     37.7   1.6e-09   1 No_clan  
+TCONS_00004329    308    373    303    374 PF00538.14  Linker_histone    Domain     9    75    77     42.2   6.3e-11   1 No_clan  
+TCONS_00004330    159    230    157    232 PF00538.14  Linker_histone    Domain     3    75    77     57.4   1.1e-15   1 No_clan  
+TCONS_00004330    267    330    260    330 PF00538.14  Linker_histone    Domain    13    77    77     37.5   1.8e-09   1 No_clan  
+TCONS_00004330    346    411    341    412 PF00538.14  Linker_histone    Domain     9    75    77     42.0     7e-11   1 No_clan  
+TCONS_00004332    158    229    156    231 PF00538.14  Linker_histone    Domain     3    75    77     58.4   5.4e-16   1 No_clan  
+TCONS_00004332    266    326    259    327 PF00538.14  Linker_histone    Domain    13    74    77     35.7   6.7e-09   1 No_clan  
+TCONS_00004376    167    231    167    235 PF00076.17  RRM_1             Domain     1    64    70     50.8   9.4e-14   1 CL0221   
+TCONS_00004376    248    312    248    318 PF00076.17  RRM_1             Domain     1    59    70     30.4   2.1e-07   1 CL0221   
+TCONS_00004376    346    407    346    408 PF00076.17  RRM_1             Domain     1    69    70     56.1     2e-15   1 CL0221   
+TCONS_00004377    167    231    167    235 PF00076.17  RRM_1             Domain     1    64    70     50.8   9.3e-14   1 CL0221   
+TCONS_00004377    248    309    248    315 PF00076.17  RRM_1             Domain     1    59    70     35.8   4.3e-09   1 CL0221   
+TCONS_00004377    343    404    343    405 PF00076.17  RRM_1             Domain     1    69    70     56.1     2e-15   1 CL0221   
+TCONS_00004378     66    130     66    134 PF00076.17  RRM_1             Domain     1    64    70     51.1   7.3e-14   1 CL0221   
+TCONS_00004378    147    208    147    214 PF00076.17  RRM_1             Domain     1    59    70     36.2   3.4e-09   1 CL0221   
+TCONS_00004378    242    303    242    304 PF00076.17  RRM_1             Domain     1    69    70     56.5   1.6e-15   1 CL0221   
+TCONS_00004379     66    130     66    134 PF00076.17  RRM_1             Domain     1    64    70     51.1   7.4e-14   1 CL0221   
+TCONS_00004379    147    211    147    217 PF00076.17  RRM_1             Domain     1    59    70     30.8   1.6e-07   1 CL0221   
+TCONS_00004379    245    306    245    307 PF00076.17  RRM_1             Domain     1    69    70     56.4   1.6e-15   1 CL0221   
+TCONS_00004380     28     92     28     96 PF00076.17  RRM_1             Domain     1    64    70     51.3   6.6e-14   1 CL0221   
+TCONS_00004380    109    170    109    176 PF00076.17  RRM_1             Domain     1    59    70     36.3     3e-09   1 CL0221   
+TCONS_00004380    204    265    204    266 PF00076.17  RRM_1             Domain     1    69    70     56.6   1.4e-15   1 CL0221   
+TCONS_00004381    129    193    129    197 PF00076.17  RRM_1             Domain     1    64    70     50.9   8.6e-14   1 CL0221   
+TCONS_00004381    210    271    210    277 PF00076.17  RRM_1             Domain     1    59    70     35.9   3.9e-09   1 CL0221   
+TCONS_00004381    305    366    305    367 PF00076.17  RRM_1             Domain     1    69    70     56.2   1.8e-15   1 CL0221   
+TCONS_00004382     88    149     88    155 PF00076.17  RRM_1             Domain     1    59    70     36.4   2.8e-09   1 CL0221   
+TCONS_00004382    183    244    183    245 PF00076.17  RRM_1             Domain     1    69    70     56.7   1.3e-15   1 CL0221   
+TCONS_00004439     20     27     19     71 PF07004.7   SHIPPO-rpt        Repeat     2     9    37      4.8        59   1 No_clan  
+TCONS_00004439    140    159    140    171 PF07004.7   SHIPPO-rpt        Repeat     1    20    37     11.2      0.54   1 No_clan  
+TCONS_00004439    178    210    178    213 PF07004.7   SHIPPO-rpt        Repeat     1    34    37     14.6     0.047   1 No_clan  
+TCONS_00004439    220    235    219    246 PF07004.7   SHIPPO-rpt        Repeat     2    17    37     12.4      0.22   1 No_clan  
+TCONS_00004439    259    269    259    276 PF07004.7   SHIPPO-rpt        Repeat     1    11    37      9.2       2.3   1 No_clan  
+TCONS_00004440     95    114     95    126 PF07004.7   SHIPPO-rpt        Repeat     1    20    37     11.5      0.43   1 No_clan  
+TCONS_00004440    133    165    133    168 PF07004.7   SHIPPO-rpt        Repeat     1    34    37     14.9     0.036   1 No_clan  
+TCONS_00004440    175    191    174    202 PF07004.7   SHIPPO-rpt        Repeat     2    18    37     12.8      0.17   1 No_clan  
+TCONS_00004440    214    224    214    231 PF07004.7   SHIPPO-rpt        Repeat     1    11    37      9.5       1.8   1 No_clan  
+TCONS_00004441     67     74     66     93 PF07004.7   SHIPPO-rpt        Repeat     2     9    37      4.3        83   1 No_clan  
+TCONS_00004441    187    206    187    218 PF07004.7   SHIPPO-rpt        Repeat     1    20    37     10.9      0.66   1 No_clan  
+TCONS_00004441    225    257    225    260 PF07004.7   SHIPPO-rpt        Repeat     1    34    37     14.3     0.058   1 No_clan  
+TCONS_00004441    267    282    266    293 PF07004.7   SHIPPO-rpt        Repeat     2    17    37     12.2      0.27   1 No_clan  
+TCONS_00004441    306    316    306    323 PF07004.7   SHIPPO-rpt        Repeat     1    11    37      9.0       2.7   1 No_clan  
+TCONS_00004442     67     74     66     93 PF07004.7   SHIPPO-rpt        Repeat     2     9    37      4.3        83   1 No_clan  
+TCONS_00004442    187    206    187    218 PF07004.7   SHIPPO-rpt        Repeat     1    20    37     10.9      0.66   1 No_clan  
+TCONS_00004442    225    257    225    260 PF07004.7   SHIPPO-rpt        Repeat     1    34    37     14.3     0.058   1 No_clan  
+TCONS_00004442    267    282    266    293 PF07004.7   SHIPPO-rpt        Repeat     2    17    37     12.2      0.27   1 No_clan  
+TCONS_00004442    306    316    306    323 PF07004.7   SHIPPO-rpt        Repeat     1    11    37      9.0       2.7   1 No_clan  
+TCONS_00004443     15     25     15     52 PF07004.7   SHIPPO-rpt        Repeat     1    11    37      4.0   1.1e+02   1 No_clan  
+TCONS_00004443     55     74     55     86 PF07004.7   SHIPPO-rpt        Repeat     1    20    37     13.1      0.13   1 No_clan  
+TCONS_00004443     93    105     93    113 PF07004.7   SHIPPO-rpt        Repeat     1    13    37     13.6     0.094   1 No_clan  
diff -r 000000000000 -r f3fefb6d8254 test-data/salmon_cond1_rep1.sf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/salmon_cond1_rep1.sf	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,1093 @@
+Name	Length	EffectiveLength	TPM	NumReads
+TCONS_00000001	1652	1652	11.1815	11.6729
+TCONS_00000002	1488	1488	0	0
+TCONS_00000003	1595	1595	0	0
+TCONS_00000006	78	78	28475.5	0.324245
+TCONS_00000007	2750	2750	32.5198	59.1913
+TCONS_00000008	4369	4369	10.0237	29.7173
+TCONS_00000009	4272	4272	15.3493	44.4535
+TCONS_00000010	937	937	0	0
+TCONS_00000012	1584	1584	47709	47512.3
+TCONS_00000013	694	694	2748.13	1007.75
+TCONS_00000015	1023	1023	16380.9	9816.85
+TCONS_00000016	510	510	0	0
+TCONS_00000017	854	854	0	0
+TCONS_00000018	701	701	57.6706	21.4335
+TCONS_00000019	517	517	48.5659	11.7325
+TCONS_00000020	1543	1543	196.837	190.32
+TCONS_00000021	2682	2682	59.2833	105.056
+TCONS_00000022	3043	3043	0.47982	0.972736
+TCONS_00000023	490	490	4.37202	0.972736
+TCONS_00000024	2554	2554	0	0
+TCONS_00000025	2121	2121	36.5397	50.2604
+TCONS_00000026	2560	2560	144.607	243.785
+TCONS_00000027	955	955	51.7022	28.4991
+TCONS_00000028	2003	2003	112.974	145.972
+TCONS_00000029	1149	1149	56.5546	38.9299
+TCONS_00000030	2398	2398	11.0247	17.3234
+TCONS_00000031	2554	2554	16.5029	27.7514
+TCONS_00000032	2293	2293	45.2628	67.7627
+TCONS_00000033	662	662	2821.38	970.791
+TCONS_00000034	7319	7319	1948.03	9837.85
+TCONS_00000035	673	673	9.4226	3.31544
+TCONS_00000036	971	971	106.506	59.9124
+TCONS_00000037	1616	1616	0	0
+TCONS_00000041	2259	2259	0	0
+TCONS_00000042	2278	2278	0	0
+TCONS_00000043	2111	2111	0	0
+TCONS_00000044	2790	2790	1006.18	1859.87
+TCONS_00000045	3054	3054	8.45822	17.2131
+TCONS_00000046	2960	2960	21.2277	41.7893
+TCONS_00000047	2590	2590	12.0013	20.4869
+TCONS_00000048	2684	2684	4.21879	7.48206
+TCONS_00000049	2530	2530	11.4481	19.0569
+TCONS_00000050	1239	1239	847.508	637.313
+TCONS_00000051	1181	1181	139.312	99.0486
+TCONS_00000052	1932	1932	14.4788	17.981
+TCONS_00000053	2192	2192	845.357	1205.22
+TCONS_00000054	2558	2558	2.88743	4.86368
+TCONS_00000055	1747	1747	272.665	302.96
+TCONS_00000056	1594	1594	55.4717	55.6352
+TCONS_00000057	1741	1741	175.51	194.266
+TCONS_00000058	491	491	0	0
+TCONS_00000059	2141	2141	38.7529	53.8526
+TCONS_00000060	2536	2536	309.875	517.144
+TCONS_00000061	3859	3859	18.4899	48.1504
+TCONS_00000062	2432	2432	462.516	737.879
+TCONS_00000063	1939	1939	32.3298	40.3101
+TCONS_00000064	2667	2667	192.737	339.504
+TCONS_00000065	1170	1170	406.751	286.03
+TCONS_00000066	2611	2611	41.1192	70.8031
+TCONS_00000067	2467	2467	1092.68	1770.26
+TCONS_00000068	2329	2329	1496.94	2279.16
+TCONS_00000069	2616	2616	12.7511	22.0012
+TCONS_00000070	1048	1048	0	0
+TCONS_00000071	3243	3243	23.23	50.3786
+TCONS_00000072	3201	3201	230.473	492.98
+TCONS_00000073	3231	3231	0	0
+TCONS_00000074	3026	3026	71.9881	145.076
+TCONS_00000076	2930	2930	39.4169	76.761
+TCONS_00000077	2890	2890	14.8124	28.427
+TCONS_00000078	3311	3311	50.6086	112.187
+TCONS_00000079	2590	2590	35.4331	60.4861
+TCONS_00000080	2308	2308	32.0146	48.2684
+TCONS_00000081	585	585	0	0
+TCONS_00000082	1239	1239	2.05912	1.54843
+TCONS_00000083	1306	1306	0	0
+TCONS_00000084	905	905	36.2798	18.7156
+TCONS_00000085	850	850	0.00268498	0.0012807
+TCONS_00000086	906	906	68.4177	35.3429
+TCONS_00000087	848	848	0	0
+TCONS_00000088	1808	1808	45.8269	52.8948
+TCONS_00000089	921	921	18.4517	9.72736
+TCONS_00000090	1101	1101	0	0
+TCONS_00000091	1925	1925	0.786404	0.972736
+TCONS_00000092	2324	2324	0	0
+TCONS_00000093	2112	2112	26.7569	36.634
+TCONS_00000094	2032	2032	0	0
+TCONS_00000095	2009	2009	4.54047	5.88592
+TCONS_00000096	1745	1745	10.9251	12.1235
+TCONS_00000097	1212	1212	0	0
+TCONS_00000098	1849	1849	0	0
+TCONS_00000099	1859	1859	0	0
+TCONS_00000100	2089	2089	6.18632	8.36934
+TCONS_00000101	1943	1943	86.4024	107.974
+TCONS_00000102	5706	5706	1751.24	6847.09
+TCONS_00000103	3093	3093	3557.39	7337.62
+TCONS_00000104	3203	3203	170.625	365.207
+TCONS_00000105	4834	4834	1.54004	5.0719900000000004
+TCONS_00000106	3951	3951	0	0
+TCONS_00000107	3939	3939	0.667472	1.77595
+TCONS_00000108	4854	4854	0	0
+TCONS_00000109	5564	5564	2.54328	9.68858
+TCONS_00000110	2241	2241	0	0
+TCONS_00000111	722	722	77.1879	29.8331
+TCONS_00000112	1671	1671	39.8848	42.1734
+TCONS_00000113	4460	4460	41.4281	125.487
+TCONS_00000114	1704	1704	511.88	553.193
+TCONS_00000115	1561	1561	17.5428	17.1852
+TCONS_00000116	2709	2709	681.085	1219.95
+TCONS_00000117	2763	2763	9.1221	16.6875
+TCONS_00000118	2677	2677	609.452	1077.85
+TCONS_00000119	2697	2697	0	0
+TCONS_00000120	2601	2601	34.2029	58.6521
+TCONS_00000121	2598	2598	0	0
+TCONS_00000122	2571	2571	98.8097	167.346
+TCONS_00000124	8659	8659	0	0
+TCONS_00000125	8716	8716	5.56099	33.5758
+TCONS_00000126	8662	8662	0	0
+TCONS_00000127	8719	8719	1.36623	8.25186
+TCONS_00000128	8720	8720	0	0
+TCONS_00000129	2902	2902	1.98171	3.81998
+TCONS_00000130	2209	2209	6.1018	8.77263
+TCONS_00000131	2217	2217	0.0366983	0.052969
+TCONS_00000132	1403	1403	0	0
+TCONS_00000133	1817	1817	0	0
+TCONS_00000134	2425	2425	2758.18	4386.64
+TCONS_00000135	2248	2248	26.1657	38.3401
+TCONS_00000136	1904	1904	2.91602	3.56366
+TCONS_00000137	2845	2845	5.84271	11.0271
+TCONS_00000138	1585	1585	0	0
+TCONS_00000140	2728	2728	0	0
+TCONS_00000141	2673	2673	0	0
+TCONS_00000142	1091	1091	0	0
+TCONS_00000144	1894	1894	2.50409e-4	3.04254e-4
+TCONS_00000145	2174	2174	0.688434	0.972736
+TCONS_00000146	545	545	52.1031	13.6183
+TCONS_00000147	760	760	0	0
+TCONS_00000149	956	956	0	0
+TCONS_00000151	3027	3027	115.803	233.457
+TCONS_00000152	3077	3077	0	0
+TCONS_00000154	3151	3151	0	0
+TCONS_00000156	3196	3196	0	0
+TCONS_00000157	3099	3099	0	0
+TCONS_00000158	1950	1950	2.0418	2.56167
+TCONS_00000159	1279	1279	0.456947	0.356538
+TCONS_00000160	1055	1055	1.56411	0.972736
+TCONS_00000163	2070	2070	1.70363	2.28192
+TCONS_00000164	2922	2922	0.828644	1.60902
+TCONS_00000165	4625	4625	0.309231	0.972736
+TCONS_00000166	3128	3128	50.967	106.388
+TCONS_00000167	2388	2388	2.23347	3.49371
+TCONS_00000168	3171	3171	0	0
+TCONS_00000169	3129	3129	35.8884	74.9384
+TCONS_00000170	3557	3557	0	0
+TCONS_00000171	3426	3426	0	0
+TCONS_00000172	3137	3137	0	0
+TCONS_00000173	1293	1293	2.66814	2.10826
+TCONS_00000174	3963	3963	29.1429	78.0352
+TCONS_00000175	1412	1412	8.96186	7.83521
+TCONS_00000176	1421	1421	8.35107	7.35434
+TCONS_00000177	1248	1248	1.28271	0.972736
+TCONS_00000178	687	687	0	0
+TCONS_00000179	3530	3530	0.410165	0.972736
+TCONS_00000180	1883	1883	0	0
+TCONS_00000181	2698	2698	1.98972e-5	3.54847e-5
+TCONS_00000182	1936	1936	0	0
+TCONS_00000183	1293	1293	0	0
+TCONS_00000184	2364	2364	1.88599	2.91817
+TCONS_00000185	2257	2257	39.252	57.765
+TCONS_00000186	2337	2337	43.6863	66.7613
+TCONS_00000187	2265	2265	139.003	205.349
+TCONS_00000188	2483	2483	37.4921	61.165
+TCONS_00000189	3669	3669	674.265	1665.32
+TCONS_00000190	1363	1363	387.393	325.273
+TCONS_00000191	1270	1270	123.558	95.6214
+TCONS_00000192	2094	2094	43.6382	59.1915
+TCONS_00000193	722	722	2772.12	1071.42
+TCONS_00000194	8441	8441	1.96532	11.484
+TCONS_00000195	5417	5417	0.00296778	0.0109973
+TCONS_00000196	5158	5158	0	0
+TCONS_00000197	3979	3979	1.65084	4.43907
+TCONS_00000198	2204	2204	6294.2	9026.99
+TCONS_00000199	1523	1523	5.9201	5.6404
+TCONS_00000200	3524	3524	19.7324	46.713
+TCONS_00000201	3414	3414	0	0
+TCONS_00000202	6251	6251	57.3894	246.495
+TCONS_00000203	6278	6278	131.625	567.859
+TCONS_00000204	6336	6336	0	0
+TCONS_00000205	1476	1476	20.87	19.1906
+TCONS_00000206	902	902	14436.2	7416.55
+TCONS_00000207	842	842	301.681	142.192
+TCONS_00000208	960	960	7370.16	4088.6
+TCONS_00000209	2323	2323	5.65026	8.57881
+TCONS_00000210	2400	2400	115.224	181.218
+TCONS_00000211	1756	1756	75.4735	84.3394
+TCONS_00000214	9113	9113	997.925	6305.28
+TCONS_00000215	3115	3115	295.375	613.847
+TCONS_00000216	2961	2961	676.183	1331.63
+TCONS_00000217	1460	1460	333.697	303.07
+TCONS_00000218	1536	1536	15.6092	15.0152
+TCONS_00000219	3848	3848	356.342	925.199
+TCONS_00000220	3735	3735	83.0566	209.011
+TCONS_00000221	5410	5410	39.6231	146.63
+TCONS_00000222	5336	5336	110.918	404.661
+TCONS_00000223	5482	5482	16.1633	60.6367
+TCONS_00000224	3780	3780	285.907	728.579
+TCONS_00000225	654	654	20.1199	6.80915
+TCONS_00000227	5515	5515	1037.1	3914.87
+TCONS_00000228	5902	5902	40.9313	165.707
+TCONS_00000229	5548	5548	0	0
+TCONS_00000230	5400	5400	0	0
+TCONS_00000231	1035	1035	53.6395	32.6005
+TCONS_00000232	2038	2038	264.109	347.786
+TCONS_00000233	1574	1574	0	0
+TCONS_00000234	7662	7662	711.164	3763.93
+TCONS_00000235	10579	10579	135.792	998.718
+TCONS_00000236	10667	10667	0	0
+TCONS_00000237	8667	8667	0	0
+TCONS_00000240	8703	8703	24.182	145.782
+TCONS_00000241	1936	1936	16743.9	20841.5
+TCONS_00000243	1870	1870	623.48	746.967
+TCONS_00000244	2051	2051	5.47918	7.26548
+TCONS_00000245	1235	1235	156.946	117.578
+TCONS_00000246	1467	1467	24.1952	22.0942
+TCONS_00000247	1400	1400	4.79862	4.15465
+TCONS_00000248	1427	1427	548.165	485.065
+TCONS_00000249	1184	1184	7.47801	5.3326
+TCONS_00000250	309	309	503.733	47.6307
+TCONS_00000251	1132	1132	23.992	16.2268
+TCONS_00000252	1125	1125	2.3572	1.58261
+TCONS_00000253	1924	1924	1215.73	1502.92
+TCONS_00000256	1795	1795	30.3095	34.7056
+TCONS_00000258	4216	4216	3079.08	8795.48
+TCONS_00000259	4052	4052	0	0
+TCONS_00000260	2237	2237	10.6784	15.5638
+TCONS_00000261	3653	3653	397.637	977.6
+TCONS_00000262	759	759	0	0
+TCONS_00000263	5213	5213	1.09247	3.89066
+TCONS_00000264	2837	2837	1.51083e-4	2.84288e-4
+TCONS_00000265	2933	2933	12.8062	24.9661
+TCONS_00000266	781	781	32.5956	13.9577
+TCONS_00000267	3319	3319	17.4808	38.8494
+TCONS_00000268	2947	2947	109.812	215.169
+TCONS_00000269	2822	2822	215.408	403.042
+TCONS_00000270	2918	2918	12.2956	23.8402
+TCONS_00000271	2688	2688	0	0
+TCONS_00000272	1547	1547	341.057	330.73
+TCONS_00000273	1773	1773	20.6692	23.3457
+TCONS_00000274	3728	3728	10.8446	27.2366
+TCONS_00000275	1279	1279	76.6423	59.8011
+TCONS_00000276	1258	1258	18.4988	14.1593
+TCONS_00000277	1182	1182	1240.78	883.051
+TCONS_00000278	1161	1161	353.763	246.517
+TCONS_00000279	1126	1126	76.3288	51.3007
+TCONS_00000280	726	726	0	0
+TCONS_00000281	2663	2663	0	0
+TCONS_00000282	1738	1738	3.88872	4.29604
+TCONS_00000283	1202	1202	0	0
+TCONS_00000284	1077	1077	19.6523	12.5276
+TCONS_00000285	1041	1041	4.084	2.49946
+TCONS_00000286	1194	1194	50.5781	36.425
+TCONS_00000287	5643	5643	428.033	1654.49
+TCONS_00000288	5627	5627	0	0
+TCONS_00000290	837	837	19.2261	8.99394
+TCONS_00000291	957	957	0	0
+TCONS_00000292	660	660	0	0
+TCONS_00000293	467	467	0	0
+TCONS_00000295	934	934	0	0
+TCONS_00000296	3003	3003	6858.82	13710.9
+TCONS_00000297	3144	3144	89.3714	187.563
+TCONS_00000298	4676	4676	2861.06	9103.1
+TCONS_00000299	4531	4531	213.79	658.305
+TCONS_00000300	1588	1588	680.824	679.943
+TCONS_00000301	3684	3684	8.99283	22.3062
+TCONS_00000302	3593	3593	9.54117e-4	0.00230525
+TCONS_00000303	2359	2359	0	0
+TCONS_00000304	2151	2151	7.01063	9.79182
+TCONS_00000305	3674	3674	906.189	2241.34
+TCONS_00000306	3574	3574	103.982	249.836
+TCONS_00000307	3561	3561	0	0
+TCONS_00000308	16326	16326	0	0
+TCONS_00000309	16251	16251	112.839	1282.36
+TCONS_00000310	13946	13946	99.6383	969.979
+TCONS_00000311	4062	4062	0	0
+TCONS_00000312	5671	5671	98.556	382.902
+TCONS_00000313	4219	4219	5.40974	15.4646
+TCONS_00000314	152	152	0	0
+TCONS_00000315	1574	1574	0	0
+TCONS_00000316	3832	3832	0	0
+TCONS_00000317	4049	4049	0	0
+TCONS_00000318	897	897	0	0
+TCONS_00000319	1018	1018	0	0
+TCONS_00000320	1783	1783	0	0
+TCONS_00000321	1606	1606	0	0
+TCONS_00000325	1855	1855	0	0
+TCONS_00000326	1863	1863	0	0
+TCONS_00000330	1863	1863	0	0
+TCONS_00000331	1557	1557	0	0
+TCONS_00000333	2804	2804	58.3333	108.403
+TCONS_00000334	2810	2810	91.6859	170.772
+TCONS_00000335	2699	2699	0	0
+TCONS_00000339	2700	2700	21.1734	37.7906
+TCONS_00000340	7456	7456	5.62555	28.9547
+TCONS_00000341	7955	7955	20.2399	111.315
+TCONS_00000342	2129	2129	0	0
+TCONS_00000343	2020	2020	2.65997	3.46887
+TCONS_00000344	6272	6272	293.311	1264.17
+TCONS_00000345	2301	2301	13.1163	19.7105
+TCONS_00000347	4052	4052	1.95926	5.36954
+TCONS_00000348	3905	3905	19.0785	50.3037
+TCONS_00000349	3833	3833	0	0
+TCONS_00000350	6021	6021	0	0
+TCONS_00000351	3842	3842	22.3299	57.8822
+TCONS_00000352	3643	3643	24.1793	59.2744
+TCONS_00000353	3653	3653	152.275	374.372
+TCONS_00000354	3393	3393	97.0643	220.794
+TCONS_00000355	4528	4528	6.32212	19.4538
+TCONS_00000356	2015	2015	0.0089552	0.0116468
+TCONS_00000357	1942	1942	43.713	54.5958
+TCONS_00000358	1879	1879	50.7576	61.1336
+TCONS_00000359	1911	1911	205.385	252.016
+TCONS_00000360	1984	1984	259.367	331.64
+TCONS_00000361	5090	5090	2.42645	8.43043
+TCONS_00000362	3506	3506	0	0
+TCONS_00000365	1378	1378	1.14406	0.972737
+TCONS_00000367	2419	2419	2524.19	4003.78
+TCONS_00000368	899	899	2.76276e-5	1.4135e-5
+TCONS_00000369	753	753	2.3817	0.972722
+TCONS_00000371	922	922	0	0
+TCONS_00000372	2314	2314	10.1386	15.329
+TCONS_00000373	6023	6023	222.047	917.931
+TCONS_00000374	5838	5838	78.4341	313.986
+TCONS_00000375	2927	2927	2.39832	4.66544
+TCONS_00000376	1462	1462	1.7478	1.58986
+TCONS_00000377	1759	1759	229.817	257.301
+TCONS_00000379	1853	1853	277.091	328.642
+TCONS_00000380	2770	2770	184.015	337.539
+TCONS_00000381	4120	4120	2359.58	6580.07
+TCONS_00000382	3070	3070	11.3519	23.2304
+TCONS_00000383	1741	1741	0.982944	1.08799
+TCONS_00000384	1518	1518	0	0
+TCONS_00000385	3493	3493	0	0
+TCONS_00000386	3349	3349	1353.79	3037.38
+TCONS_00000388	1524	1524	8.21278	7.83056
+TCONS_00000389	2792	2792	158.774	293.709
+TCONS_00000390	12227	12227	159.562	1359.43
+TCONS_00000391	11900	11900	176.796	1465.4
+TCONS_00000393	3059	3059	0	0
+TCONS_00000395	2532	2532	0	0
+TCONS_00000396	2406	2406	0.616835	0.972735
+TCONS_00000397	2535	2535	0	0
+TCONS_00000398	903	903	0	0
+TCONS_00000399	1097	1097	0	0
+TCONS_00000401	2128	2128	2.11396	2.91821
+TCONS_00000402	1498	1498	0	0
+TCONS_00000403	3583	3583	2053.21	4946.26
+TCONS_00000404	3580	3580	2196.62	5287.08
+TCONS_00000405	3633	3633	1355.74	3313.96
+TCONS_00000406	1342	1342	0	0
+TCONS_00000407	2079	2079	3268.72	4399.08
+TCONS_00000408	2003	2003	93.8204	121.224
+TCONS_00000409	2001	2001	0	0
+TCONS_00000410	2415	2415	2.308	3.65435
+TCONS_00000411	1397	1397	0	0
+TCONS_00000412	1586	1586	0	0
+TCONS_00000413	2635	2635	5.37404	9.34474
+TCONS_00000414	1403	1403	5.41195	4.69715
+TCONS_00000415	1748	1748	1.37329	1.52684
+TCONS_00000416	2736	2736	0	0
+TCONS_00000417	2413	2413	4.05013	6.40701
+TCONS_00000418	2026	2026	0.303579	0.397185
+TCONS_00000419	1668	1668	0	0
+TCONS_00000420	6656	6656	82.3142	377.118
+TCONS_00000421	2614	2614	2.73363	4.71283
+TCONS_00000422	6137	6137	19.5749	82.4996
+TCONS_00000423	2424	2424	45.4774	72.2956
+TCONS_00000424	3847	3847	0	0
+TCONS_00000425	2600	2600	0	0
+TCONS_00000427	2455	2455	0	0
+TCONS_00000428	2086	2086	0	0
+TCONS_00000429	3186	3186	0	0
+TCONS_00000430	1551	1551	0	0
+TCONS_00000431	2265	2265	0	0
+TCONS_00000432	2347	2347	0	0
+TCONS_00000433	3667	3667	4.10342	10.129
+TCONS_00000434	4493	4493	26.4814	80.8306
+TCONS_00000435	4260	4260	154.45	445.995
+TCONS_00000436	4245	4245	90.7217	261.009
+TCONS_00000437	2011	2011	0	0
+TCONS_00000438	4599	4599	0	0
+TCONS_00000439	3481	3481	0	0
+TCONS_00000440	3691	3691	239.428	595.072
+TCONS_00000441	3075	3075	0	0
+TCONS_00000442	2261	2261	7.53435	11.1092
+TCONS_00000443	1859	1859	5.72061	6.80915
+TCONS_00000444	1943	1943	0	0
+TCONS_00000445	1884	1884	0	0
+TCONS_00000446	1111	1111	0	0
+TCONS_00000447	5055	5055	0	0
+TCONS_00000448	4093	4093	0	0
+TCONS_00000449	2259	2259	0	0
+TCONS_00000450	2253	2253	0	0
+TCONS_00000451	6052	6052	0	0
+TCONS_00000452	2272	2272	2059.34	3052.45
+TCONS_00000453	1884	1884	397.53	480.199
+TCONS_00000454	1642	1642	16.0314	16.6226
+TCONS_00000455	2254	2254	71.9504	105.733
+TCONS_00000456	1611	1611	18.6389	18.9178
+TCONS_00000457	1740	1740	145.194	160.608
+TCONS_00000458	2298	2298	118.603	177.979
+TCONS_00000459	2589	2589	1986.31	3389.33
+TCONS_00000460	2025	2025	10771	14084.5
+TCONS_00000461	2054	2054	0	0
+TCONS_00000462	2088	2088	17.8748	24.1698
+TCONS_00000463	2021	2021	3632.29	4739.44
+TCONS_00000464	1983	1983	0	0
+TCONS_00000465	6506	6506	77.8118	348.24
+TCONS_00000466	2793	2793	4.12838	7.63982
+TCONS_00000467	2581	2581	0	0
+TCONS_00000468	1893	1893	247.643	300.718
+TCONS_00000469	2719	2719	0	0
+TCONS_00000470	2971	2971	0.984354	1.94547
+TCONS_00000471	3743	3743	0	0
+TCONS_00000472	4475	4475	0	0
+TCONS_00000473	4419	4419	0	0
+TCONS_00000474	2908	2908	0	0
+TCONS_00000476	2581	2581	2.28786	3.89094
+TCONS_00000477	957	957	160.178	88.519
+TCONS_00000478	1078	1078	0	0
+TCONS_00000479	787	787	0	0
+TCONS_00000480	2659	2659	1913.64	3360.04
+TCONS_00000481	1658	1658	532.486	558.146
+TCONS_00000482	2437	2437	0.608381	0.972736
+TCONS_00000483	105	105	3343.43	1.4591
+TCONS_00000484	3765	3765	0	0
+TCONS_00000485	4294	4294	294.884	858.604
+TCONS_00000486	3729	3729	15.4403	38.7898
+TCONS_00000487	3555	3555	20.1681	48.1865
+TCONS_00000488	2595	2595	11.3727	19.4541
+TCONS_00000489	2554	2554	0	0
+TCONS_00000490	2430	2430	4.18676e-4	6.67346e-4
+TCONS_00000491	2314	2314	0	0
+TCONS_00000492	2557	2557	0	0
+TCONS_00000493	4012	4012	8.57636	23.2618
+TCONS_00000494	987	987	60.5947	34.7715
+TCONS_00000495	1001	1001	0	0
+TCONS_00000498	1100	1100	0	0
+TCONS_00000499	1036	1036	441.225	268.475
+TCONS_00000501	1512	1512	59.3426	56.0775
+TCONS_00000502	2293	2293	703.854	1053.73
+TCONS_00000503	2167	2167	0	0
+TCONS_00000504	2094	2094	9688.65	13141.8
+TCONS_00000505	2302	2302	0	0
+TCONS_00000506	2343	2343	55.1779	84.5569
+TCONS_00000507	8992	8992	9.50577	59.248
+TCONS_00000508	8704	8704	174.799	1053.91
+TCONS_00000509	8368	8368	13.2159	76.5429
+TCONS_00000510	2160	2160	6.90339	9.68596
+TCONS_00000511	1844	1844	0	0
+TCONS_00000512	4996	4996	0	0
+TCONS_00000519	4032	4032	78.441	213.866
+TCONS_00000520	4868	4868	136.277	452.094
+TCONS_00000521	4865	4865	1336.28	4430.21
+TCONS_00000522	4629	4629	0	0
+TCONS_00000523	3565	3565	23.9499	57.3914
+TCONS_00000524	3035	3035	1696.69	3430.1
+TCONS_00000525	3107	3107	574.837	1191.37
+TCONS_00000526	887	887	34.2893	17.2525
+TCONS_00000527	2815	2815	35.2688	65.8155
+TCONS_00000528	2178	2178	0	0
+TCONS_00000529	1779	1779	0	0
+TCONS_00000530	1625	1625	0	0
+TCONS_00000531	607	607	54995.8	16784.9
+TCONS_00000532	604	604	9460.49	2867.3
+TCONS_00000533	594	594	44790.6	13258.6
+TCONS_00000534	1975	1975	100.815	128.266
+TCONS_00000535	4942	4942	1291.62	4352.47
+TCONS_00000536	1620	1620	1737.9	1774.97
+TCONS_00000537	1576	1576	129.949	128.679
+TCONS_00000538	1686	1686	0	0
+TCONS_00000539	1728	1728	185.727	203.868
+TCONS_00000540	1622	1622	292.451	299.102
+TCONS_00000541	1590	1590	1129.15	1129.28
+TCONS_00000542	2412	2412	1827.09	2889.03
+TCONS_00000544	2799	2799	0	0
+TCONS_00000545	2699	2699	7.04501e-5	1.25691e-4
+TCONS_00000546	2512	2512	0.588778	0.97261
+TCONS_00000547	1814	1814	0	0
+TCONS_00000548	1732	1732	170.681	187.835
+TCONS_00000549	5425	5425	981.947	3644.21
+TCONS_00000550	5535	5535	30.7929	116.674
+TCONS_00000551	2736	2736	5.69808	10.315
+TCONS_00000552	1697	1697	193.325	207.971
+TCONS_00000553	1413	1413	43.1353	37.743
+TCONS_00000554	1269	1269	40.7521	31.5092
+TCONS_00000555	1271	1271	0.00821765	0.00636545
+TCONS_00000556	1097	1097	0	0
+TCONS_00000557	3953	3953	0	0
+TCONS_00000558	3933	3933	822.276	2184.35
+TCONS_00000559	3969	3969	657.837	1764.26
+TCONS_00000560	2393	2393	25.7104	40.3084
+TCONS_00000561	2510	2510	168.495	278.101
+TCONS_00000562	1489	1489	33.9183	31.5005
+TCONS_00003803	842	842	721.461	340.048
+TCONS_00003804	2411	2411	0	0
+TCONS_00003807	1745	1745	0	0
+TCONS_00003808	1745	1745	6.75253	7.49324
+TCONS_00003809	1768	1768	253.034	284.904
+TCONS_00003810	1636	1636	35.0432	36.1869
+TCONS_00003812	3181	3181	58.2453	123.763
+TCONS_00003813	3517	3517	0	0
+TCONS_00003814	1189	1189	0	0
+TCONS_00003816	1134	1134	0	0
+TCONS_00003817	1097	1097	0	0
+TCONS_00003818	717	717	244.282	93.5513
+TCONS_00003819	1577	1577	81.853	81.1105
+TCONS_00003820	1148	1148	15.8846	10.9231
+TCONS_00003821	1022	1022	373.474	223.554
+TCONS_00003822	806	806	51.8984	23.1406
+TCONS_00003824	1129	1129	8.65652	5.83642
+TCONS_00003825	2373	2373	10.3306	16.0501
+TCONS_00003826	1390	1390	16.0474	13.7804
+TCONS_00003827	937	937	0	0
+TCONS_00003828	4272	4272	0.552601	1.6004
+TCONS_00003829	4295	4295	33.8281	98.5202
+TCONS_00003830	4812	4812	17.4239	57.1131
+TCONS_00003831	78	78	28475.5	0.324245
+TCONS_00003833	78	78	28475.5	0.324245
+TCONS_00003835	683	683	27.5783	9.89865
+TCONS_00003836	1317	1317	38.5659	31.1276
+TCONS_00003837	1316	1316	33.7748	27.2366
+TCONS_00003838	1704	1704	4.50045	4.86368
+TCONS_00003839	496	496	8.58047	1.94547
+TCONS_00003840	436	436	0	0
+TCONS_00003841	4282	4282	78.796	228.76
+TCONS_00003842	2799	2799	958.588	1777.99
+TCONS_00003843	2814	2814	1826.67	3407.48
+TCONS_00003844	896	896	77.0351	39.2499
+TCONS_00003845	1214	1214	38.416	28.2093
+TCONS_00003846	3040	3040	0	0
+TCONS_00003847	962	962	10.4941	5.83642
+TCONS_00003848	1040	1040	0	0
+TCONS_00003849	1870	1870	0	0
+TCONS_00003850	1750	1750	31.0945	34.6153
+TCONS_00003851	1741	1741	47.7952	52.9029
+TCONS_00003852	2741	2741	0	0
+TCONS_00003853	1979	1979	1.09595	1.39747
+TCONS_00003854	2373	2373	0	0
+TCONS_00003855	2276	2276	38.0568	56.5172
+TCONS_00003856	2704	2704	21.1042	37.7268
+TCONS_00003857	2104	2104	92.5354	126.17
+TCONS_00003858	3532	3532	0	0
+TCONS_00003859	1062	1062	0	0
+TCONS_00003860	1178	1178	20.5811	14.5891
+TCONS_00003861	1199	1199	0.00263063	0.00190381
+TCONS_00003862	988	988	0	0
+TCONS_00003863	1067	1067	6.17226	3.89094
+TCONS_00003864	1700	1700	0	0
+TCONS_00003865	3539	3539	80.9116	192.403
+TCONS_00003866	2021	2021	9281.87	12111.1
+TCONS_00003867	2137	2137	619.795	859.539
+TCONS_00003869	2153	2153	61.2429	85.6252
+TCONS_00003870	771	771	124.82	52.5665
+TCONS_00003871	1036	1036	116.701	71.0097
+TCONS_00003872	2262	2262	46.6761	68.8556
+TCONS_00003873	2379	2379	64.3402	100.235
+TCONS_00003874	2306	2306	0	0
+TCONS_00003875	2258	2258	2044.64	3010.43
+TCONS_00003876	2387	2387	89.4237	139.818
+TCONS_00003877	2127	2127	84.7096	116.878
+TCONS_00003878	2380	2380	131.981	205.705
+TCONS_00003879	3517	3517	24.7057	58.3642
+TCONS_00003880	3211	3211	114.901	246.584
+TCONS_00003881	5325	5325	81.5597	296.92
+TCONS_00003882	3759	3759	924.213	2341.46
+TCONS_00003883	1946	1946	145.793	182.501
+TCONS_00003884	2880	2880	110.47	211.227
+TCONS_00003885	2135	2135	2753.11	3814.16
+TCONS_00003886	2608	2608	7.28077	12.5213
+TCONS_00003887	2510	2510	13.8782	22.906
+TCONS_00003888	1832	1832	6.23713	7.30491
+TCONS_00003891	1918	1918	54.3546	66.9645
+TCONS_00003892	2069	2069	5.25856	7.03985
+TCONS_00003893	2242	2242	98.0658	143.278
+TCONS_00003894	1570	1570	8.09893	7.98539
+TCONS_00003895	1104	1104	368.436	241.896
+TCONS_00003896	2483	2483	18.7806	30.6389
+TCONS_00003897	2182	2182	369.222	523.787
+TCONS_00003898	2193	2193	54.3547	77.5315
+TCONS_00003899	2923	2923	1558.75	3027.81
+TCONS_00003900	4402	4402	27.5594	82.348
+TCONS_00003901	2005	2005	81.8632	105.89
+TCONS_00003902	1987	1987	2573.28	3295.79
+TCONS_00003903	1996	1996	1935.88	2491.74
+TCONS_00003904	2299	2299	10727	16104.9
+TCONS_00003905	2728	2728	9.42927	17.0162
+TCONS_00003906	781	781	3497.47	1497.65
+TCONS_00003907	813	813	287.146	129.454
+TCONS_00003908	909	909	2144.31	1112.24
+TCONS_00003909	990	990	2582.12	1487.19
+TCONS_00003910	2914	2914	7.98983	15.4691
+TCONS_00003911	4362	4362	108.205	320.258
+TCONS_00003912	2868	2868	13.7309	26.1378
+TCONS_00003913	5269	5269	508.04	1829.42
+TCONS_00003914	3115	3115	335.13	696.465
+TCONS_00003915	3129	3129	9.06391	18.9263
+TCONS_00003916	3839	3839	64.5446	167.171
+TCONS_00003917	732	732	9483.65	3732.47
+TCONS_00003918	1148	1148	34.032	23.4023
+TCONS_00003919	1456	1456	125.18	113.337
+TCONS_00003920	1475	1475	0.00410762	0.00377417
+TCONS_00003921	2016	2016	29.5145	38.4065
+TCONS_00003922	1116	1116	217.941	144.938
+TCONS_00003923	1302	1302	6061.88	4828.42
+TCONS_00003924	1497	1497	3.29146	3.07545
+TCONS_00003925	2970	2970	461.378	911.54
+TCONS_00003926	1629	1629	469.614	482.618
+TCONS_00003927	2053	2053	255.8	339.556
+TCONS_00003928	1877	1877	273.568	329.105
+TCONS_00003929	2452	2452	0.0719544	0.11581
+TCONS_00003932	2431	2431	0	0
+TCONS_00003934	2499	2499	187.255	307.608
+TCONS_00003935	262	262	911.904	55.961
+TCONS_00003936	335	335	541.972	61.2015
+TCONS_00003937	2236	2236	12.4079	18.0758
+TCONS_00003938	5141	5141	436.201	1531.26
+TCONS_00003939	6420	6420	71.0861	313.817
+TCONS_00003940	6002	6002	517.017	2129.65
+TCONS_00003941	5915	5915	56.0363	227.373
+TCONS_00003942	1231	1231	307.035	229.15
+TCONS_00003943	2279	2279	24.7337	36.7839
+TCONS_00003944	1777	1777	10.1417	11.4837
+TCONS_00003945	1557	1557	9.1237	8.91194
+TCONS_00003946	1504	1504	99.1861	93.1678
+TCONS_00003947	2595	2595	308.162	527.137
+TCONS_00003948	2625	2625	1151.82	1994.71
+TCONS_00003949	1966	1966	90.1292	114.097
+TCONS_00003950	1920	1920	94.3006	116.311
+TCONS_00003951	1277	1277	70.28	54.7375
+TCONS_00003952	1108	1108	7.73054	5.09734
+TCONS_00003953	1120	1120	4.02882	2.69069
+TCONS_00003954	1150	1150	124.765	85.9719
+TCONS_00003955	887	887	80.9911	40.7502
+TCONS_00003956	704	704	0	0
+TCONS_00003957	734	734	15.2683	6.0307
+TCONS_00003958	657	657	0	0
+TCONS_00003959	2149	2149	84.9166	118.484
+TCONS_00003961	3841	3841	596.692	1546.28
+TCONS_00003962	1430	1430	369.223	327.504
+TCONS_00003963	3021	3021	0	0
+TCONS_00003964	3127	3127	0.0743201	0.155082
+TCONS_00003965	3228	3228	1271.79	2744.63
+TCONS_00003966	3152	3152	0	0
+TCONS_00003967	3646	3646	3.49931	8.58583
+TCONS_00003968	1431	1431	29.5408	26.2239
+TCONS_00003969	3127	3127	16079.2	33552.1
+TCONS_00003970	2981	2981	14.0732	27.9136
+TCONS_00003971	1118	1118	0	0
+TCONS_00003972	958	958	21.0954	11.6728
+TCONS_00003973	2097	2097	0	0
+TCONS_00003974	2755	2755	0	0
+TCONS_00003975	4710	4710	0	0
+TCONS_00003976	2572	2572	0	0
+TCONS_00003977	2145	2145	0	0
+TCONS_00003978	1954	1954	0	0
+TCONS_00003979	1253	1253	29.8724	22.7593
+TCONS_00003980	2347	2347	128.417	197.154
+TCONS_00003981	2216	2216	30.2139	43.5884
+TCONS_00003982	2266	2266	86.695	128.136
+TCONS_00003983	728	728	2926.63	1143.55
+TCONS_00003984	1641	1641	19.2688	19.9658
+TCONS_00003985	1826	1826	0	0
+TCONS_00003986	2248	2248	236.997	347.267
+TCONS_00003987	1345	1345	69.2073	57.2289
+TCONS_00003988	1530	1530	17.9186	17.1607
+TCONS_00003989	2072	2072	30.3894	40.748
+TCONS_00003990	2012	2012	1015.4	1318.43
+TCONS_00003991	2642	2642	580.134	1011.65
+TCONS_00003993	1305	1305	0	0
+TCONS_00003995	2209	2209	3.16959	4.55695
+TCONS_00003996	2303	2303	0	0
+TCONS_00003997	3322	3322	6.08777	13.5424
+TCONS_00003998	2754	2754	1.76783	3.22274
+TCONS_00003999	2902	2902	0	0
+TCONS_00004000	2222	2222	0.672289	0.972736
+TCONS_00004001	620	620	3.09402	0.972736
+TCONS_00004002	6472	6472	40.79	181.572
+TCONS_00004003	7432	7432	57.2336	293.61
+TCONS_00004004	1698	1698	461.625	496.924
+TCONS_00004005	2041	2041	121.624	160.415
+TCONS_00004006	5724	5724	17.9136	70.2675
+TCONS_00004007	3322	3322	24.9979	55.6086
+TCONS_00004008	6356	6356	248.636	1086.38
+TCONS_00004009	2648	2648	1462.4	2556.35
+TCONS_00004010	6458	6458	76.646	340.422
+TCONS_00004011	5892	5892	320.88	1296.79
+TCONS_00004012	2208	2208	104.858	150.681
+TCONS_00004013	1660	1660	1041.2	1092.85
+TCONS_00004014	2505	2505	3.85239	6.34475
+TCONS_00004015	847	847	0	0
+TCONS_00004016	5002	5002	104.237	355.675
+TCONS_00004017	4370	4370	9.1926	27.2597
+TCONS_00004018	3630	3630	3.72339	9.09351
+TCONS_00004020	2773	2773	0	0
+TCONS_00004021	1349	1349	3.49867	2.90301
+TCONS_00004022	6343	6343	1.72636	7.52724
+TCONS_00004023	7735	7735	2.23938	11.9677
+TCONS_00004024	9646	9646	0.720431	4.82342
+TCONS_00004025	3491	3491	0	0
+TCONS_00004026	2198	2198	0	0
+TCONS_00004027	2084	2084	5810.49	7840.36
+TCONS_00004028	2067	2067	2977.67	3982.11
+TCONS_00004029	4813	4813	2247.47	7368.48
+TCONS_00004030	4920	4920	291.742	978.565
+TCONS_00004031	2710	2710	680.205	1218.85
+TCONS_00004032	2632	2632	373.015	647.832
+TCONS_00004033	1413	1413	4383.84	3835.82
+TCONS_00004034	1429	1429	60.5811	53.6932
+TCONS_00004035	1624	1624	167.1	171.136
+TCONS_00004036	1294	1294	368.067	291.092
+TCONS_00004037	1804	1804	124.087	142.874
+TCONS_00004038	1877	1877	0	0
+TCONS_00004039	1802	1802	1615.1	1857.35
+TCONS_00004040	1200	1200	0	0
+TCONS_00004041	4259	4259	2.35862	6.80915
+TCONS_00004042	1066	1066	0.620732	0.390866
+TCONS_00004043	1559	1559	0	0
+TCONS_00004044	1448	1448	18.7761	16.8935
+TCONS_00004046	1615	1615	0	0
+TCONS_00004048	1480	1480	0	0
+TCONS_00004049	1642	1642	0	0
+TCONS_00004051	894	894	13.8451	7.03458
+TCONS_00004052	3694	3694	3.18018	7.91072
+TCONS_00004053	5038	5038	3.26393	11.2202
+TCONS_00004054	4725	4725	0	0
+TCONS_00004055	4698	4698	0	0
+TCONS_00004056	4715	4715	38.7758	124.443
+TCONS_00004058	4643	4643	8.0076	25.2911
+TCONS_00004059	4783	4783	0.00860012	0.0280137
+TCONS_00004060	4761	4761	20.8512	67.5955
+TCONS_00004061	5221	5221	0	0
+TCONS_00004062	4528	4528	2.66406	8.19757
+TCONS_00004063	1548	1548	20.504	19.8977
+TCONS_00004064	2832	2832	362.549	680.915
+TCONS_00004065	2864	2864	0	0
+TCONS_00004066	6318	6318	81.1207	352.267
+TCONS_00004067	3475	3475	541.745	1263.72
+TCONS_00004068	4486	4486	413.595	1260.39
+TCONS_00004069	1357	1357	0	0
+TCONS_00004070	3293	3293	1890.01	4165.63
+TCONS_00004071	3137	3137	29.3553	61.4627
+TCONS_00004072	3219	3219	16.2231	34.9076
+TCONS_00004074	643	643	0	0
+TCONS_00004075	647	647	0	0
+TCONS_00004076	1883	1883	1.61149	1.94547
+TCONS_00004077	3128	3128	1838.67	3838.01
+TCONS_00004078	2156	2156	35.0244	49.0427
+TCONS_00004079	6306	6306	1225.19	5310.01
+TCONS_00004080	8192	8192	19.3316	109.558
+TCONS_00004081	8007	8007	282.827	1565.88
+TCONS_00004082	2592	2592	6.16535	10.5333
+TCONS_00004083	584	584	0	0
+TCONS_00004084	2710	2710	3.76784	6.75155
+TCONS_00004085	2267	2267	156.917	232.036
+TCONS_00004086	1812	1812	41266.6	47747.9
+TCONS_00004087	1801	1801	22821.7	26228.6
+TCONS_00004088	1753	1753	0	0
+TCONS_00004089	1683	1683	0	0
+TCONS_00004090	1644	1644	0	0
+TCONS_00004091	1453	1453	20629.2	18633.7
+TCONS_00004092	1448	1448	0	0
+TCONS_00004093	1276	1276	105.569	82.148
+TCONS_00004094	1539	1539	0	0
+TCONS_00004095	2012	2012	0	0
+TCONS_00004096	1942	1942	2.80192	3.49948
+TCONS_00004097	2436	2436	0	0
+TCONS_00004098	2398	2398	11.996	18.8496
+TCONS_00004099	2411	2411	0.0151097	0.023881
+TCONS_00004100	920	920	0	0
+TCONS_00004101	1279	1279	0	0
+TCONS_00004102	1153	1153	28.1319	19.4444
+TCONS_00004103	958	958	88.9671	49.2287
+TCONS_00004104	2913	2913	1.17399	2.27214
+TCONS_00004105	2396	2396	0.660685	1.03722
+TCONS_00004106	3934	3934	55.6441	147.856
+TCONS_00004107	1822	1822	0	0
+TCONS_00004108	951	951	44.3453	24.3184
+TCONS_00004109	2235	2235	639.692	931.45
+TCONS_00004110	5191	5191	2221.12	7875.62
+TCONS_00004111	5161	5161	1737.15	6122.71
+TCONS_00004112	5134	5134	29.4655	103.291
+TCONS_00004113	2995	2995	99.3743	198.089
+TCONS_00004114	2961	2961	392.369	772.702
+TCONS_00004115	1345	1345	7.03949	5.8211
+TCONS_00004116	1500	1500	636.821	596.38
+TCONS_00004117	1440	1440	269.732	241.162
+TCONS_00004118	1383	1383	0	0
+TCONS_00004119	2036	2036	858.553	1129.35
+TCONS_00004120	3391	3391	345.309	784.994
+TCONS_00004121	7931	7931	0	0
+TCONS_00004122	4405	4405	2.49757	7.4681
+TCONS_00004123	3250	3250	5.51457	11.9866
+TCONS_00004124	2267	2267	0	0
+TCONS_00004125	2262	2262	0.00411017	0.00606323
+TCONS_00004126	2238	2238	0.662916	0.966673
+TCONS_00004127	2316	2316	0	0
+TCONS_00004128	2443	2443	15.7761	25.2911
+TCONS_00004129	720	720	0	0
+TCONS_00004130	2190	2190	0	0
+TCONS_00004132	828	828	1844.31	851.031
+TCONS_00004133	1273	1273	10771.4	8358.84
+TCONS_00004134	2805	2805	1727.59	3211.66
+TCONS_00004135	2730	2730	11.5832	20.9196
+TCONS_00004136	2689	2689	27.5409	48.9413
+TCONS_00004137	4020	4020	234.442	637.206
+TCONS_00004138	8724	8724	620.968	3752.75
+TCONS_00004139	1534	1534	48.6097	46.6911
+TCONS_00004140	1543	1543	0	0
+TCONS_00004141	1183	1183	0	0
+TCONS_00004142	1830	1830	431.496	504.757
+TCONS_00004143	1151	1151	2296.45	1584.03
+TCONS_00004144	7188	7188	154.918	768.012
+TCONS_00004145	7105	7105	294.282	1441.65
+TCONS_00004146	1411	1411	80.1649	70.0302
+TCONS_00004148	852	852	12.2016	5.83725
+TCONS_00004149	697	697	0	0
+TCONS_00004150	2339	2339	1907.91	2918.36
+TCONS_00004151	2534	2534	123.001	205.099
+TCONS_00004152	1368	1368	302.328	254.917
+TCONS_00004153	1805	1805	593.049	683.257
+TCONS_00004154	1262	1262	0	0
+TCONS_00004155	1222	1222	2.5648	1.89787
+TCONS_00004156	252	252	28.2921	1.53651
+TCONS_00004158	1002	1002	2551.5	1491.2
+TCONS_00004160	1840	1840	0	0
+TCONS_00004162	1720	1720	0	0
+TCONS_00004163	1734	1734	0	0
+TCONS_00004164	1855	1855	0	0
+TCONS_00004165	1007	1007	203.489	119.647
+TCONS_00004169	2100	2100	0	0
+TCONS_00004170	2164	2164	0	0
+TCONS_00004172	1844	1844	0	0
+TCONS_00004173	2100	2100	0	0
+TCONS_00004175	1906	1906	0	0
+TCONS_00004176	6978	6978	0	0
+TCONS_00004177	7099	7099	0	0
+TCONS_00004178	3105	3105	4.85319	10.0516
+TCONS_00004179	4316	4316	25.3677	74.2569
+TCONS_00004180	1987	1987	103.4	132.431
+TCONS_00004181	1537	1537	69.6204	67.0201
+TCONS_00004182	2045	2045	5.24381	6.93114
+TCONS_00004184	1904	1904	29.5257	36.0832
+TCONS_00004185	1798	1798	76.6549	87.9355
+TCONS_00004186	2196	2196	51.0704	72.9552
+TCONS_00004187	538	538	25761.5	6605.85
+TCONS_00004188	2732	2732	39.8257	71.9825
+TCONS_00004189	2749	2749	605.295	1101.31
+TCONS_00004190	2564	2564	7.31529	12.3531
+TCONS_00004191	2770	2770	43.1838	79.2122
+TCONS_00004192	2745	2745	0	0
+TCONS_00004193	1894	1894	21.6657	26.3244
+TCONS_00004194	1928	1928	8.38648	10.3914
+TCONS_00004196	1166	1166	30.4164	21.303
+TCONS_00004197	905	905	3.86289	1.99274
+TCONS_00004199	2892	2892	254.894	489.535
+TCONS_00004200	2877	2877	16.2374	31.0125
+TCONS_00004201	2904	2904	36.5348	70.4769
+TCONS_00004202	2907	2907	67.1553	129.687
+TCONS_00004203	2415	2415	486.625	770.493
+TCONS_00004204	892	892	7.32427	3.71105
+TCONS_00004205	1700	1700	46.1919	49.7894
+TCONS_00004206	3946	3946	1262.97	3366.64
+TCONS_00004207	1631	1631	0	0
+TCONS_00004208	2008	2008	136.313	176.609
+TCONS_00004209	1984	1984	36.5938	46.7907
+TCONS_00004210	3029	3029	2.09199	4.22037
+TCONS_00004211	1559	1559	183.966	179.956
+TCONS_00004212	2474	2474	12.3944	20.1415
+TCONS_00004213	3055	3055	19.0376	38.7564
+TCONS_00004214	2975	2975	489.73	969.284
+TCONS_00004215	2963	2963	0	0
+TCONS_00004216	3650	3650	0	0
+TCONS_00004217	2014	2014	0	0
+TCONS_00004219	5368	5368	12.0265	44.1482
+TCONS_00004220	574	574	22.4368	6.32434
+TCONS_00004221	1122	1122	12.0336	8.05377
+TCONS_00004222	2482	2482	0.741598	1.20933
+TCONS_00004223	1160	1160	1278.79	890.216
+TCONS_00004224	4268	4268	475.701	1376.34
+TCONS_00004225	1512	1512	444.215	419.774
+TCONS_00004226	1512	1512	239.585	226.402
+TCONS_00004227	2216	2216	6.43042	9.27691
+TCONS_00004228	2663	2663	92.2487	162.234
+TCONS_00004229	3026	3026	40.1795	80.9729
+TCONS_00004230	2696	2696	252.458	449.878
+TCONS_00004231	1404	1404	128.744	111.831
+TCONS_00004232	2173	2173	58.4296	82.5178
+TCONS_00004233	1966	1966	24.7015	31.2703
+TCONS_00004234	2746	2746	59.8807	108.823
+TCONS_00004235	1912	1912	69.2783	85.0566
+TCONS_00004236	2029	2029	19.5295	25.5927
+TCONS_00004237	596	596	206.37	61.3799
+TCONS_00004238	2015	2015	0	0
+TCONS_00004239	1171	1171	0	0
+TCONS_00004240	4170	4170	1.07348	3.03153
+TCONS_00004241	4395	4395	2.24461	6.69583
+TCONS_00004242	359	359	209.699	27.2366
+TCONS_00004243	1100	1100	3022.24	1975.7
+TCONS_00004244	1097	1097	600.304	391.158
+TCONS_00004245	1081	1081	56.6475	36.2708
+TCONS_00004246	1078	1078	20.6036	13.1486
+TCONS_00004247	1224	1224	220.082	163.164
+TCONS_00004248	3996	3996	173.204	467.825
+TCONS_00004249	3981	3981	224.217	603.235
+TCONS_00004250	3694	3694	28.8937	71.8735
+TCONS_00004251	1080	1080	61.2846	39.1966
+TCONS_00004252	1639	1639	0	0
+TCONS_00004253	1143	1143	5327.08	3644.36
+TCONS_00004254	4362	4362	0	0
+TCONS_00004255	4014	4014	0	0
+TCONS_00004256	1625	1625	0	0
+TCONS_00004258	3950	3950	1079.6	2880.9
+TCONS_00004259	4091	4091	190.585	527.569
+TCONS_00004260	2521	2521	0	0
+TCONS_00004261	3241	3241	54.8351	118.842
+TCONS_00004262	2368	2368	0	0
+TCONS_00004263	3381	3381	480.233	1088.32
+TCONS_00004264	5835	5835	231.207	925.072
+TCONS_00004265	3402	3402	9.93512	22.6629
+TCONS_00004266	941	941	202.307	109.513
+TCONS_00004267	2535	2535	204.725	341.517
+TCONS_00004268	2916	2916	24.9259	48.2943
+TCONS_00004269	2888	2888	16.2472	31.1576
+TCONS_00004270	3481	3481	502.897	1175.24
+TCONS_00004271	3477	3477	391.844	914.604
+TCONS_00004272	15880	15880	522.042	5795.83
+TCONS_00004273	3162	3162	4.31444	9.10958
+TCONS_00004274	3124	3124	159.431	332.344
+TCONS_00004275	2172	2172	1.59155	2.24656
+TCONS_00004276	5751	5751	6.49883	25.6162
+TCONS_00004277	2675	2675	5.95027	10.515
+TCONS_00004278	4237	4237	2054.85	5900.24
+TCONS_00004279	4234	4234	42.4189	121.711
+TCONS_00004280	4234	4234	258.099	740.553
+TCONS_00004281	4171	4171	18.6479	52.6749
+TCONS_00004282	2314	2314	10.9373	16.5365
+TCONS_00004283	2117	2117	0	0
+TCONS_00004284	1241	1241	17.4303	13.1319
+TCONS_00004285	1362	1362	3376.38	2832.57
+TCONS_00004286	1257	1257	96.5278	73.8157
+TCONS_00004287	1032	1032	6.66589	4.03719
+TCONS_00004288	1575	1575	0	0
+TCONS_00004289	2084	2084	129.553	174.812
+TCONS_00004290	1629	1629	18322.2	18829.5
+TCONS_00004291	2049	2049	6.63996	8.7953
+TCONS_00004292	2093	2093	12.9153	17.5093
+TCONS_00004293	2232	2232	0	0
+TCONS_00004294	2973	2973	514.068	1016.73
+TCONS_00004295	2401	2401	0	0
+TCONS_00004296	2281	2281	50.737	75.5276
+TCONS_00004297	1715	1715	32.53	35.4085
+TCONS_00004298	1045	1045	26.468	16.2736
+TCONS_00004299	1249	1249	0	0
+TCONS_00004301	922	922	0	0
+TCONS_00004302	999	999	9.73731e-4	5.67024e-4
+TCONS_00004303	968	968	20.8282	11.6723
+TCONS_00004304	888	888	0	0
+TCONS_00004308	1452	1452	0	0
+TCONS_00004309	2467	2467	0	0
+TCONS_00004310	1607	1607	726.874	735.696
+TCONS_00004311	2350	2350	6656.64	10233.9
+TCONS_00004312	2456	2456	1622.91	2616.66
+TCONS_00004313	2126	2126	12396.4	17095.1
+TCONS_00004314	2135	2135	0	0
+TCONS_00004315	2073	2073	0	0
+TCONS_00004316	2015	2015	19.2974	25.0975
+TCONS_00004317	1812	1812	0	0
+TCONS_00004318	1671	1671	21.1379	22.3509
+TCONS_00004319	1978	1978	3.79706	4.839
+TCONS_00004320	3776	3776	0.00195775	0.0049834
+TCONS_00004321	3773	3773	32.1432	81.7516
+TCONS_00004322	3705	3705	128.928	321.713
+TCONS_00004323	3834	3834	127.723	330.354
+TCONS_00004324	3063	3063	162.799	332.342
+TCONS_00004325	3139	3139	65.1901	136.584
+TCONS_00004326	4775	4775	121.311	394.467
+TCONS_00004327	4317	4317	161.14	471.807
+TCONS_00004328	3921	3921	1127.86	2986.55
+TCONS_00004329	3797	3797	977.66	2503.13
+TCONS_00004330	1860	1860	817.941	974.161
+TCONS_00004331	2544	2544	19.2164	32.1786
+TCONS_00004332	2537	2537	228.027	380.711
+TCONS_00004333	927	927	285.674	151.813
+TCONS_00004334	5160	5160	351.787	1239.65
+TCONS_00004335	4949	4949	53.2798	179.804
+TCONS_00004336	5786	5786	517.716	2053.48
+TCONS_00004337	5850	5850	199.863	801.782
+TCONS_00004338	6175	6175	385.109	1633.41
+TCONS_00004340	6283	6283	292.991	1265.07
+TCONS_00004342	1915	1915	0	0
+TCONS_00004343	2088	2088	28.2445	38.1914
+TCONS_00004344	5241	5241	101.151	362.236
+TCONS_00004345	5087	5087	980.268	3403.75
+TCONS_00004346	5096	5096	1001.05	3482.3
+TCONS_00004347	5000	5000	14.401	49.1184
+TCONS_00004348	5136	5136	4096.6	14366.4
+TCONS_00004349	2198	2198	14.286	20.4281
+TCONS_00004350	2326	2326	0.63978	0.972736
+TCONS_00004351	2057	2057	431.919	574.563
+TCONS_00004352	3348	3348	1.65232e-4	3.70601e-4
+TCONS_00004353	3300	3300	1.75827	3.88399
+TCONS_00004354	3333	3333	0.00295076	0.006587
+TCONS_00004355	3494	3494	0	0
+TCONS_00004356	3639	3639	41.4875	101.588
+TCONS_00004357	4462	4462	953.215	2888.66
+TCONS_00004359	4264	4264	33.9993	98.2736
+TCONS_00004360	4498	4498	0	0
+TCONS_00004361	2089	2089	0.944197	1.27738
+TCONS_00004362	2126	2126	193.146	266.355
+TCONS_00004363	2411	2411	184.813	292.099
+TCONS_00004364	3586	3586	634.332	1529.48
+TCONS_00004365	14287	14287	1616.25	16123.9
+TCONS_00004366	14290	14290	283.723	2831.04
+TCONS_00004367	846	846	0	0
+TCONS_00004368	3903	3903	0	0
+TCONS_00004369	3883	3883	0	0
+TCONS_00004370	510	510	0	0
+TCONS_00004371	8653	8653	317.993	1905.8
+TCONS_00004372	8587	8587	402.536	2393.7
+TCONS_00004373	3921	3921	0	0
+TCONS_00004374	2834	2834	0	0
+TCONS_00004375	1637	1637	0	0
+TCONS_00004376	2740	2740	381.392	691.499
+TCONS_00004377	2731	2731	1507.46	2723.58
+TCONS_00004378	2565	2565	3090.62	5221.23
+TCONS_00004379	2574	2574	716.981	1215.82
+TCONS_00004380	2451	2451	0	0
+TCONS_00004381	2617	2617	0	0
+TCONS_00004382	2388	2388	105.248	164.634
+TCONS_00004383	4314	4314	215.254	629.791
+TCONS_00004384	4492	4492	131.698	401.896
+TCONS_00004385	1586	1586	462.44	461.188
+TCONS_00004386	540	540	28.0658	7.23642
+TCONS_00004387	738	738	132.236	52.605
+TCONS_00004388	646	646	11.3049	3.76195
+TCONS_00004389	2552	2552	132.768	223.075
+TCONS_00004390	2791	2791	42.753	79.0566
+TCONS_00004391	4088	4088	56.5353	156.379
+TCONS_00004392	4129	4129	655.899	1833.26
+TCONS_00004394	1768	1768	0	0
+TCONS_00004395	697	697	0	0
+TCONS_00004396	2041	2041	0	0
+TCONS_00004397	5192	5192	88.3184	313.221
+TCONS_00004398	1287	1287	1188.4	933.981
+TCONS_00004399	1547	1547	498.386	483.295
+TCONS_00004400	1074	1074	76.6189	48.6791
+TCONS_00004401	1607	1607	23.1245	23.4052
+TCONS_00004402	1631	1631	93.0909	95.8001
+TCONS_00004403	1553	1553	60.8488	59.2645
+TCONS_00004404	1566	1566	502.092	493.633
+TCONS_00004405	1676	1676	191.708	203.386
+TCONS_00004406	1824	1824	95.2429	111.01
+TCONS_00004408	1244	1244	5.60264	4.23291
+TCONS_00004409	934	934	0	0
+TCONS_00004410	1607	1607	1433.78	1451.18
+TCONS_00004412	1394	1394	52.7327	45.4323
+TCONS_00004413	2160	2160	0	0
+TCONS_00004414	1411	1411	6.2186	5.43243
+TCONS_00004415	2054	2054	41.6408	55.3047
+TCONS_00004416	2077	2077	154.003	207.041
+TCONS_00004418	953	953	3.81388	2.09688
+TCONS_00004419	1774	1774	0	0
+TCONS_00004420	2239	2239	110.069	160.582
+TCONS_00004421	1842	1842	1279.56	1507.67
+TCONS_00004422	2924	2924	1046.74	2033.98
+TCONS_00004423	2686	2686	0	0
+TCONS_00004424	4859	4859	0	0
+TCONS_00004425	5799	5799	0	0
+TCONS_00004426	3940	3940	0	0
+TCONS_00004427	5094	5094	0	0
+TCONS_00004428	2703	2703	0	0
+TCONS_00004429	2798	2798	5.44027e-4	0.00100868
+TCONS_00004431	2725	2725	4.8564	8.75362
+TCONS_00004432	4461	4461	0	0
+TCONS_00004433	4548	4548	0	0
+TCONS_00004434	4417	4417	0	0
+TCONS_00004435	4424	4424	0	0
+TCONS_00004436	686	686	0	0
+TCONS_00004439	2497	2497	88.8612	145.849
+TCONS_00004440	2827	2827	12.5506	23.5274
+TCONS_00004441	2683	2683	156.143	276.811
+TCONS_00004442	2803	2803	0	0
+TCONS_00004443	1653	1653	16.116	16.8357
diff -r 000000000000 -r f3fefb6d8254 test-data/salmon_cond1_rep2.sf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/salmon_cond1_rep2.sf	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,1093 @@
+Name	Length	EffectiveLength	TPM	NumReads
+TCONS_00000001	1652	1652	11.6557	12.1679
+TCONS_00000002	1488	1488	0	0
+TCONS_00000003	1595	1595	8.94522	8.9779
+TCONS_00000006	78	78	0	0
+TCONS_00000007	2750	2750	26.3142	47.8961
+TCONS_00000008	4369	4369	4.96783e-4	0.00147281
+TCONS_00000009	4272	4272	11.6937	33.8664
+TCONS_00000010	937	937	0	0
+TCONS_00000012	1584	1584	89137.8	88770.3
+TCONS_00000013	694	694	46127.7	16915.3
+TCONS_00000015	1023	1023	56407.6	33804.4
+TCONS_00000016	510	510	0	0
+TCONS_00000017	854	854	0	0
+TCONS_00000018	701	701	42.3991	15.7578
+TCONS_00000019	517	517	0	0
+TCONS_00000020	1543	1543	229.739	222.133
+TCONS_00000021	2682	2682	88.533	156.888
+TCONS_00000022	3043	3043	0.67294	1.36425
+TCONS_00000023	490	490	0	0
+TCONS_00000024	2554	2554	4.41456	7.42354
+TCONS_00000025	2121	2121	36.3346	49.9782
+TCONS_00000026	2560	2560	131.115	221.04
+TCONS_00000027	955	955	43.3015	23.8685
+TCONS_00000028	2003	2003	83.1034	107.376
+TCONS_00000029	1149	1149	62.9707	43.3466
+TCONS_00000030	2398	2398	0.00110412	0.00173493
+TCONS_00000031	2554	2554	33.2725	55.9512
+TCONS_00000032	2293	2293	11.3782	17.034300000000002
+TCONS_00000033	662	662	3675.44	1264.66
+TCONS_00000034	7319	7319	3144.04	15877.9
+TCONS_00000035	673	673	2.11352	0.743665
+TCONS_00000036	971	971	21.7175	12.2167
+TCONS_00000037	1616	1616	0	0
+TCONS_00000041	2259	2259	0	0
+TCONS_00000042	2278	2278	0	0
+TCONS_00000043	2111	2111	0	0
+TCONS_00000044	2790	2790	1117.41	2065.47
+TCONS_00000045	3054	3054	9.99311	20.3367
+TCONS_00000046	2960	2960	18.4992	36.4178
+TCONS_00000047	2590	2590	22.7491	38.834
+TCONS_00000048	2684	2684	11.3619	20.1504
+TCONS_00000049	2530	2530	5.87029	9.77191
+TCONS_00000050	1239	1239	472.462	355.284
+TCONS_00000051	1181	1181	230.975	164.219
+TCONS_00000052	1932	1932	17.3332	21.526
+TCONS_00000053	2192	2192	705.236	1005.45
+TCONS_00000054	2558	2558	5.66941	9.54973
+TCONS_00000055	1747	1747	378.825	420.915
+TCONS_00000056	1594	1594	69.3695	69.5739
+TCONS_00000057	1741	1741	170.89	189.153
+TCONS_00000058	491	491	0	0
+TCONS_00000059	2141	2141	0	0
+TCONS_00000060	2536	2536	587.348	980.212
+TCONS_00000061	3859	3859	12.4376	32.3895
+TCONS_00000062	2432	2432	97.5972	155.702
+TCONS_00000063	1939	1939	58.1464	72.4992
+TCONS_00000064	2667	2667	103.662	182.599
+TCONS_00000065	1170	1170	223.198	156.954
+TCONS_00000066	2611	2611	41.3345	71.1739
+TCONS_00000067	2467	2467	525.643	851.595
+TCONS_00000068	2329	2329	899.906	1370.15
+TCONS_00000069	2616	2616	18.9562	32.7076
+TCONS_00000070	1048	1048	9.2071	6.82124
+TCONS_00000071	3243	3243	20.8321	45.1782
+TCONS_00000072	3201	3201	410.47	877.992
+TCONS_00000073	3231	3231	0	0
+TCONS_00000074	3026	3026	36.5684	73.6954
+TCONS_00000076	2930	2930	63.1376	122.955
+TCONS_00000077	2890	2890	3.6043	6.91713
+TCONS_00000078	3311	3311	61.7799	136.951
+TCONS_00000079	2590	2590	73.3486	125.21
+TCONS_00000080	2308	2308	0	0
+TCONS_00000081	585	585	30.2889	8.77319
+TCONS_00000082	1239	1239	8.79699	6.6152
+TCONS_00000083	1306	1306	0	0
+TCONS_00000084	905	905	3.52411e-4	1.81798e-4
+TCONS_00000085	850	850	4.72177	2.25222
+TCONS_00000086	906	906	100.675	52.0065
+TCONS_00000087	848	848	13.2816	6.31636
+TCONS_00000088	1808	1808	120.144	138.673
+TCONS_00000089	921	921	3.88173	2.04637
+TCONS_00000090	1101	1101	1.75278	1.36425
+TCONS_00000091	1925	1925	0	0
+TCONS_00000092	2324	2324	0	0
+TCONS_00000093	2112	2112	59.8043	81.8803
+TCONS_00000094	2032	2032	0	0
+TCONS_00000095	2009	2009	0	0
+TCONS_00000096	1745	1745	59.0124	65.4857
+TCONS_00000097	1212	1212	0	0
+TCONS_00000098	1849	1849	0	0
+TCONS_00000099	1859	1859	0	0
+TCONS_00000100	2089	2089	15.7707	21.3359
+TCONS_00000101	1943	1943	112.444	140.518
+TCONS_00000102	5706	5706	1531.34	5987.34
+TCONS_00000103	3093	3093	4019.4	8290.58
+TCONS_00000104	3203	3203	89.8929	192.407
+TCONS_00000105	4834	4834	0	0
+TCONS_00000106	3951	3951	0.0317876	0.0848471
+TCONS_00000107	3939	3939	0.48085	1.2794
+TCONS_00000108	4854	4854	0	0
+TCONS_00000109	5564	5564	0	0
+TCONS_00000110	2241	2241	0	0
+TCONS_00000111	722	722	158.78	61.3684
+TCONS_00000112	1671	1671	44.2887	46.83
+TCONS_00000113	4460	4460	49.7318	150.639
+TCONS_00000114	1704	1704	764.08	825.748
+TCONS_00000115	1561	1561	48.1342	47.1532
+TCONS_00000116	2709	2709	543.282	973.115
+TCONS_00000117	2763	2763	0	0
+TCONS_00000118	2677	2677	528.13	934.028
+TCONS_00000119	2697	2697	0	0
+TCONS_00000120	2601	2601	0	0
+TCONS_00000121	2598	2598	0	0
+TCONS_00000122	2571	2571	57.5007	97.3844
+TCONS_00000124	8659	8659	8.16647	48.9779
+TCONS_00000125	8716	8716	0	0
+TCONS_00000126	8662	8662	1.38685	8.32051
+TCONS_00000127	8719	8719	0	0
+TCONS_00000128	8720	8720	0	0
+TCONS_00000129	2902	2902	1.75071	3.3747
+TCONS_00000130	2209	2209	0	0
+TCONS_00000131	2217	2217	0	0
+TCONS_00000132	1403	1403	0	0
+TCONS_00000133	1817	1817	0.0309458	0.0359154
+TCONS_00000134	2425	2425	2560.32	4071.95
+TCONS_00000135	2248	2248	9.53494	13.9714
+TCONS_00000136	1904	1904	0	0
+TCONS_00000137	2845	2845	0	0
+TCONS_00000138	1585	1585	0	0
+TCONS_00000140	2728	2728	0	0
+TCONS_00000141	2673	2673	0	0
+TCONS_00000142	1091	1091	0	0
+TCONS_00000144	1894	1894	1.12281	1.36425
+TCONS_00000145	2174	2174	0	0
+TCONS_00000146	545	545	60.0249	15.6888
+TCONS_00000147	760	760	25.871	10.6941
+TCONS_00000149	956	956	0	0
+TCONS_00000151	3027	3027	99.8396	201.275
+TCONS_00000152	3077	3077	0	0
+TCONS_00000154	3151	3151	0	0
+TCONS_00000156	3196	3196	11.169	23.851
+TCONS_00000157	3099	3099	0.259186	0.535708
+TCONS_00000158	1950	1950	1.78236	2.23618
+TCONS_00000159	1279	1279	2.37941	1.85656
+TCONS_00000160	1055	1055	0	0
+TCONS_00000163	2070	2070	0	0
+TCONS_00000164	2922	2922	0	0
+TCONS_00000165	4625	4625	0	0
+TCONS_00000166	3128	3128	89.3643	186.538
+TCONS_00000167	2388	2388	1.57151	2.45824
+TCONS_00000168	3171	3171	0	0
+TCONS_00000169	3129	3129	24.8044	51.7938
+TCONS_00000170	3557	3557	0	0
+TCONS_00000171	3426	3426	0	0
+TCONS_00000172	3137	3137	0	0
+TCONS_00000173	1293	1293	6.40254	5.05903
+TCONS_00000174	3963	3963	40.3122	107.943
+TCONS_00000175	1412	1412	10.6159	9.28128
+TCONS_00000176	1421	1421	28.1144	24.7589
+TCONS_00000177	1248	1248	7.1959	5.45699
+TCONS_00000178	687	687	0	0
+TCONS_00000179	3530	3530	0	0
+TCONS_00000180	1883	1883	0	0
+TCONS_00000181	2698	2698	0	0
+TCONS_00000182	1936	1936	0	0
+TCONS_00000183	1293	1293	9.49601	7.50336
+TCONS_00000184	2364	2364	0	0
+TCONS_00000185	2257	2257	44.5618	65.5791
+TCONS_00000186	2337	2337	53.0018	80.9973
+TCONS_00000187	2265	2265	105.632	156.049
+TCONS_00000188	2483	2483	38.6123	62.9926
+TCONS_00000189	3669	3669	856.164	2114.58
+TCONS_00000190	1363	1363	408.69	343.154
+TCONS_00000191	1270	1270	129.745	100.41
+TCONS_00000192	2094	2094	9.33748	12.6655
+TCONS_00000193	722	722	3399.2	1313.79
+TCONS_00000194	8441	8441	5.20959	30.4413
+TCONS_00000195	5417	5417	0	0
+TCONS_00000196	5158	5158	3.06783	10.8063
+TCONS_00000197	3979	3979	0	0
+TCONS_00000198	2204	2204	7774.02	11149.3
+TCONS_00000199	1523	1523	60.0782	57.2398
+TCONS_00000200	3524	3524	15.1339	35.8269
+TCONS_00000201	3414	3414	0	0
+TCONS_00000202	6251	6251	99.3841	426.869
+TCONS_00000203	6278	6278	314.497	1356.81
+TCONS_00000204	6336	6336	15.9235	69.3504
+TCONS_00000205	1476	1476	12.8748	11.8388
+TCONS_00000206	902	902	11155.4	5731.05
+TCONS_00000207	842	842	296.047	139.536
+TCONS_00000208	960	960	8727.99	4841.85
+TCONS_00000209	2323	2323	9.03264	13.7143
+TCONS_00000210	2400	2400	167.75	263.827
+TCONS_00000211	1756	1756	61.791	69.0496
+TCONS_00000214	9113	9113	1221.87	7720.28
+TCONS_00000215	3115	3115	107.24	222.865
+TCONS_00000216	2961	2961	664.788	1309.18
+TCONS_00000217	1460	1460	178.752	162.345
+TCONS_00000218	1536	1536	0	0
+TCONS_00000219	3848	3848	156.399	406.071
+TCONS_00000220	3735	3735	63.6171	160.092
+TCONS_00000221	5410	5410	47.7372	176.657
+TCONS_00000222	5336	5336	108.56	396.06
+TCONS_00000223	5482	5482	27.5474	103.344
+TCONS_00000224	3780	3780	349.587	890.854
+TCONS_00000225	654	654	18.1401	6.13911
+TCONS_00000227	5515	5515	1187.91	4484.15
+TCONS_00000228	5902	5902	39.0163	157.954
+TCONS_00000229	5548	5548	23.2515	88.3131
+TCONS_00000230	5400	5400	0	0
+TCONS_00000231	1035	1035	87.5535	53.2124
+TCONS_00000232	2038	2038	143.564	189.049
+TCONS_00000233	1574	1574	8.00113	7.91158
+TCONS_00000234	7662	7662	1013.51	5364.12
+TCONS_00000235	10579	10579	133.035	978.442
+TCONS_00000236	10667	10667	34.3558	254.816
+TCONS_00000237	8667	8667	0	0
+TCONS_00000240	8703	8703	26.8258	161.721
+TCONS_00000241	1936	1936	10052.2	12512.2
+TCONS_00000243	1870	1870	312.078	373.889
+TCONS_00000244	2051	2051	4.31842	5.72629
+TCONS_00000245	1235	1235	41.6915	31.2335
+TCONS_00000246	1467	1467	18.7036	17.0795
+TCONS_00000247	1400	1400	0.0125835	0.0108948
+TCONS_00000248	1427	1427	490.761	434.269
+TCONS_00000249	1184	1184	18.6668	13.3114
+TCONS_00000250	309	309	437.229	41.3424
+TCONS_00000251	1132	1132	14.7744	9.99258
+TCONS_00000252	1125	1125	4.83851	3.24855
+TCONS_00000253	1924	1924	828.397	1024.09
+TCONS_00000256	1795	1795	80.8092	92.5298
+TCONS_00000258	4216	4216	2389.86	6826.7
+TCONS_00000259	4052	4052	0	0
+TCONS_00000260	2237	2237	10.2962	15.0067
+TCONS_00000261	3653	3653	264.412	650.064
+TCONS_00000262	759	759	0	0
+TCONS_00000263	5213	5213	0	0
+TCONS_00000264	2837	2837	0	0
+TCONS_00000265	2933	2933	6.11415	11.9197
+TCONS_00000266	781	781	98.8168	42.3142
+TCONS_00000267	3319	3319	20.783	46.1882
+TCONS_00000268	2947	2947	175.866	344.597
+TCONS_00000269	2822	2822	142.443	266.521
+TCONS_00000270	2918	2918	0	0
+TCONS_00000271	2688	2688	0.00965964	0.0171587
+TCONS_00000272	1547	1547	376.331	364.936
+TCONS_00000273	1773	1773	2.41569	2.7285
+TCONS_00000274	3728	3728	1.90117	4.77487
+TCONS_00000275	1279	1279	179.181	139.808
+TCONS_00000276	1258	1258	49.6131	37.9747
+TCONS_00000277	1182	1182	1375.99	979.275
+TCONS_00000278	1161	1161	381.509	265.852
+TCONS_00000279	1126	1126	0	0
+TCONS_00000280	726	726	2.65814	1.36425
+TCONS_00000281	2663	2663	0	0
+TCONS_00000282	1738	1738	14.6313	16.1639
+TCONS_00000283	1202	1202	0	0
+TCONS_00000284	1077	1077	0	0
+TCONS_00000285	1041	1041	0	0
+TCONS_00000286	1194	1194	25.9358	18.6783
+TCONS_00000287	5643	5643	599.416	2316.94
+TCONS_00000288	5627	5627	0.00672731	0.0259271
+TCONS_00000290	837	837	10.4083	4.86897
+TCONS_00000291	957	957	0	0
+TCONS_00000292	660	660	0	0
+TCONS_00000293	467	467	2.61533	0.539363
+TCONS_00000295	934	934	0	0
+TCONS_00000296	3003	3003	13633.7	27253.9
+TCONS_00000297	3144	3144	138.338	290.33
+TCONS_00000298	4676	4676	2544.62	8096.26
+TCONS_00000299	4531	4531	104.294	321.145
+TCONS_00000300	1588	1588	458.299	457.705
+TCONS_00000301	3684	3684	0	0
+TCONS_00000302	3593	3593	0	0
+TCONS_00000303	2359	2359	4.79535e-5	7.40283e-5
+TCONS_00000304	2151	2151	0.976706	1.36417
+TCONS_00000305	3674	3674	1667.79	4125.06
+TCONS_00000306	3574	3574	96.4203	231.667
+TCONS_00000307	3561	3561	0	0
+TCONS_00000308	16326	16326	0.0121737	0.138993
+TCONS_00000309	16251	16251	270.289	3071.7
+TCONS_00000310	13946	13946	89.4549	870.844
+TCONS_00000311	4062	4062	0	0
+TCONS_00000312	5671	5671	31.7774	123.459
+TCONS_00000313	4219	4219	0	0
+TCONS_00000314	152	152	6.34805	0.682124
+TCONS_00000315	1574	1574	0	0
+TCONS_00000316	3832	3832	0	0
+TCONS_00000317	4049	4049	0	0
+TCONS_00000318	897	897	0	0
+TCONS_00000319	1018	1018	0	0
+TCONS_00000320	1783	1783	0	0
+TCONS_00000321	1606	1606	0	0
+TCONS_00000325	1855	1855	0	0
+TCONS_00000326	1863	1863	0	0
+TCONS_00000330	1863	1863	0	0
+TCONS_00000331	1557	1557	0	0
+TCONS_00000333	2804	2804	21.3019	39.5861
+TCONS_00000334	2810	2810	49.7944	92.746
+TCONS_00000335	2699	2699	0	0
+TCONS_00000339	2700	2700	40.5337	72.3453
+TCONS_00000340	7456	7456	0	0
+TCONS_00000341	7955	7955	6.04786	33.2618
+TCONS_00000342	2129	2129	0	0
+TCONS_00000343	2020	2020	101.3	132.105
+TCONS_00000344	6272	6272	414.045	1784.53
+TCONS_00000345	2301	2301	37.9706	57.0603
+TCONS_00000347	4052	4052	2.66983	7.31693
+TCONS_00000348	3905	3905	0	0
+TCONS_00000349	3833	3833	0	0
+TCONS_00000350	6021	6021	4.56321	18.8577
+TCONS_00000351	3842	3842	35.4038	91.7715
+TCONS_00000352	3643	3643	0	0
+TCONS_00000353	3653	3653	246.871	606.938
+TCONS_00000354	3393	3393	320.98	730.14
+TCONS_00000355	4528	4528	22.3355	68.7285
+TCONS_00000356	2015	2015	0	0
+TCONS_00000357	1942	1942	18.7315	23.3949
+TCONS_00000358	1879	1879	94.5342	113.859
+TCONS_00000359	1911	1911	550.526	675.52
+TCONS_00000360	1984	1984	191.231	244.518
+TCONS_00000361	5090	5090	2.35258	8.17379
+TCONS_00000362	3506	3506	1.41354	3.32833
+TCONS_00000365	1378	1378	0	0
+TCONS_00000367	2419	2419	1842.31	2922.22
+TCONS_00000368	899	899	0	0
+TCONS_00000369	753	753	8.35087	3.41062
+TCONS_00000371	922	922	0	0
+TCONS_00000372	2314	2314	28.552	43.1689
+TCONS_00000373	6023	6023	345.499	1428.28
+TCONS_00000374	5838	5838	66.7003	267.013
+TCONS_00000375	2927	2927	1.60521	3.12261
+TCONS_00000376	1462	1462	0	0
+TCONS_00000377	1759	1759	382.772	428.548
+TCONS_00000379	1853	1853	465.705	552.346
+TCONS_00000380	2770	2770	285.969	524.553
+TCONS_00000381	4120	4120	2313.48	6451.53
+TCONS_00000382	3070	3070	7.2182	14.7712
+TCONS_00000383	1741	1741	8.22425	9.10315
+TCONS_00000384	1518	1518	0	0
+TCONS_00000385	3493	3493	144.296	338.433
+TCONS_00000386	3349	3349	2662.49	5973.62
+TCONS_00000388	1524	1524	14.2942	13.6289
+TCONS_00000389	2792	2792	511.263	945.762
+TCONS_00000390	12227	12227	408.203	3477.8
+TCONS_00000391	11900	11900	178.297	1477.83
+TCONS_00000393	3059	3059	0	0
+TCONS_00000395	2532	2532	0	0
+TCONS_00000396	2406	2406	0	0
+TCONS_00000397	2535	2535	0	0
+TCONS_00000398	903	903	0	0
+TCONS_00000399	1097	1097	0	0
+TCONS_00000401	2128	2128	1.48301	2.04722
+TCONS_00000402	1498	1498	533.851	499.193
+TCONS_00000403	3583	3583	1671.33	4026.3
+TCONS_00000404	3580	3580	1154.33	2778.37
+TCONS_00000405	3633	3633	1770.54	4327.87
+TCONS_00000406	1342	1342	824.687	680.201
+TCONS_00000407	2079	2079	3243.35	4364.93
+TCONS_00000408	2003	2003	109.169	141.055
+TCONS_00000409	2001	2001	0	0
+TCONS_00000410	2415	2415	0.430813	0.682124
+TCONS_00000411	1397	1397	0	0
+TCONS_00000412	1586	1586	0	0
+TCONS_00000413	2635	2635	8.0772	14.0452
+TCONS_00000414	1403	1403	0	0
+TCONS_00000415	1748	1748	2.11816	2.355
+TCONS_00000416	2736	2736	0	0
+TCONS_00000417	2413	2413	2.28847	3.62018
+TCONS_00000418	2026	2026	0.0781924	0.102302
+TCONS_00000419	1668	1668	0	0
+TCONS_00000420	6656	6656	115.594	529.588
+TCONS_00000421	2614	2614	4.96147	8.55368
+TCONS_00000422	6137	6137	13.4781	56.8043
+TCONS_00000423	2424	2424	52.98	84.2224
+TCONS_00000424	3847	3847	0	0
+TCONS_00000425	2600	2600	0	0
+TCONS_00000427	2455	2455	1.11079e-5	1.92781e-5
+TCONS_00000428	2086	2086	0.925111	1.36423
+TCONS_00000429	3186	3186	0.605715	1.36425
+TCONS_00000430	1551	1551	0	0
+TCONS_00000431	2265	2265	0	0
+TCONS_00000432	2347	2347	0	0
+TCONS_00000433	3667	3667	16.8283	41.5392
+TCONS_00000434	4493	4493	9.33472	28.4928
+TCONS_00000435	4260	4260	244.544	706.154
+TCONS_00000436	4245	4245	0.0934533	0.268868
+TCONS_00000437	2011	2011	9.2629	12.0208
+TCONS_00000438	4599	4599	0	0
+TCONS_00000439	3481	3481	0	0
+TCONS_00000440	3691	3691	515.524	1281.28
+TCONS_00000441	3075	3075	0	0
+TCONS_00000442	2261	2261	21.1525	31.1888
+TCONS_00000443	1859	1859	8.02307	9.54973
+TCONS_00000444	1943	1943	0	0
+TCONS_00000445	1884	1884	0	0
+TCONS_00000446	1111	1111	0	0
+TCONS_00000447	5055	5055	0	0
+TCONS_00000448	4093	4093	1.41447	4.09274
+TCONS_00000449	2259	2259	0	0
+TCONS_00000450	2253	2253	0	0
+TCONS_00000451	6052	6052	0	0
+TCONS_00000452	2272	2272	1224.35	1814.79
+TCONS_00000453	1884	1884	197.908	239.065
+TCONS_00000454	1642	1642	110.23	114.295
+TCONS_00000455	2254	2254	64.2302	94.3878
+TCONS_00000456	1611	1611	0	0
+TCONS_00000457	1740	1740	153.917	170.257
+TCONS_00000458	2298	2298	55.7969	83.7305
+TCONS_00000459	2589	2589	1392.15	2375.48
+TCONS_00000460	2025	2025	6539.46	8551.23
+TCONS_00000461	2054	2054	5.59896	7.43618
+TCONS_00000462	2088	2088	37.2721	50.3983
+TCONS_00000463	2021	2021	550.382	718.143
+TCONS_00000464	1983	1983	0	0
+TCONS_00000465	6506	6506	96.4793	431.784
+TCONS_00000466	2793	2793	0	0
+TCONS_00000467	2581	2581	0	0
+TCONS_00000468	1893	1893	46.0621	55.9342
+TCONS_00000469	2719	2719	0	0
+TCONS_00000470	2971	2971	0	0
+TCONS_00000471	3743	3743	0	0
+TCONS_00000472	4475	4475	0.00147721	0.00467321
+TCONS_00000473	4419	4419	1.09027	3.40595
+TCONS_00000474	2908	2908	0	0
+TCONS_00000476	2581	2581	0.802173	1.36425
+TCONS_00000477	957	957	291.3	160.981
+TCONS_00000478	1078	1078	0	0
+TCONS_00000479	787	787	0	0
+TCONS_00000480	2659	2659	2480.6	4355.52
+TCONS_00000481	1658	1658	1107.44	1160.81
+TCONS_00000482	2437	2437	5.97272	9.54973
+TCONS_00000483	105	105	18756.5	8.18549
+TCONS_00000484	3765	3765	190.433	483.261
+TCONS_00000485	4294	4294	525.055	1528.79
+TCONS_00000486	3729	3729	7.14582	17.9521
+TCONS_00000487	3555	3555	0.0949508	0.226861
+TCONS_00000488	2595	2595	92.4958	158.222
+TCONS_00000489	2554	2554	0	0
+TCONS_00000490	2430	2430	10.1188	16.1288
+TCONS_00000491	2314	2314	0	0
+TCONS_00000492	2557	2557	18.3927	30.9683
+TCONS_00000493	4012	4012	23.3348	63.2913
+TCONS_00000494	987	987	257.995	148.047
+TCONS_00000495	1001	1001	0	0
+TCONS_00000498	1100	1100	12.0618	7.88506
+TCONS_00000499	1036	1036	590.158	359.098
+TCONS_00000501	1512	1512	80.8054	76.3594
+TCONS_00000502	2293	2293	621.614	930.614
+TCONS_00000503	2167	2167	0	0
+TCONS_00000504	2094	2094	8363.04	11343.7
+TCONS_00000505	2302	2302	0	0
+TCONS_00000506	2343	2343	54.1834	83.0328
+TCONS_00000507	8992	8992	4.57863	28.5379
+TCONS_00000508	8704	8704	232.591	1402.35
+TCONS_00000509	8368	8368	0	0
+TCONS_00000510	2160	2160	19.1081	26.8101
+TCONS_00000511	1844	1844	0	0
+TCONS_00000512	4996	4996	0	0
+TCONS_00000519	4032	4032	93.8993	256.012
+TCONS_00000520	4868	4868	0	0
+TCONS_00000521	4865	4865	117.538	389.677
+TCONS_00000522	4629	4629	140.913	443.662
+TCONS_00000523	3565	3565	12.8095	30.6956
+TCONS_00000524	3035	3035	1790.32	3619.38
+TCONS_00000525	3107	3107	614.572	1273.72
+TCONS_00000526	887	887	112.74	56.7245
+TCONS_00000527	2815	2815	17.5422	32.7357
+TCONS_00000528	2178	2178	0	0
+TCONS_00000529	1779	1779	0	0
+TCONS_00000530	1625	1625	0	0
+TCONS_00000531	607	607	53812.7	16423.8
+TCONS_00000532	604	604	7163.62	2171.16
+TCONS_00000533	594	594	64834.9	19191.9
+TCONS_00000534	1975	1975	68.5918	87.2686
+TCONS_00000535	4942	4942	1163.53	3920.82
+TCONS_00000536	1620	1620	1365.94	1395.07
+TCONS_00000537	1576	1576	163.823	162.221
+TCONS_00000538	1686	1686	0	0
+TCONS_00000539	1728	1728	91.5879	100.534
+TCONS_00000540	1622	1622	198.705	203.224
+TCONS_00000541	1590	1590	457.438	457.492
+TCONS_00000542	2412	2412	1737.21	2746.91
+TCONS_00000544	2799	2799	0	0
+TCONS_00000545	2699	2699	7.37064e-5	1.315e-4
+TCONS_00000546	2512	2512	0.82578	1.36412
+TCONS_00000547	1814	1814	4.66016	5.39867
+TCONS_00000548	1732	1732	186.409	205.143
+TCONS_00000549	5425	5425	1779.49	6604.05
+TCONS_00000550	5535	5535	93.1394	352.903
+TCONS_00000551	2736	2736	9.56238	17.3105
+TCONS_00000552	1697	1697	232.342	249.944
+TCONS_00000553	1413	1413	104.904	91.7901
+TCONS_00000554	1269	1269	59.0695	45.6721
+TCONS_00000555	1271	1271	102.913	79.7173
+TCONS_00000556	1097	1097	21.1384	13.7738
+TCONS_00000557	3953	3953	0.244094	0.682124
+TCONS_00000558	3933	3933	766.825	2037.04
+TCONS_00000559	3969	3969	465.686	1248.93
+TCONS_00000560	2393	2393	30.0273	47.0764
+TCONS_00000561	2510	2510	140.06	231.169
+TCONS_00000562	1489	1489	148.967	138.348
+TCONS_00003803	842	842	389.73	183.692
+TCONS_00003804	2411	2411	0	0
+TCONS_00003807	1745	1745	6.37832	7.07798
+TCONS_00003808	1745	1745	9.41511	10.4479
+TCONS_00003809	1768	1768	72.8587	82.0354
+TCONS_00003810	1636	1636	6.27984	6.4848
+TCONS_00003812	3181	3181	28.3241	60.1845
+TCONS_00003813	3517	3517	9.29883	21.9674
+TCONS_00003814	1189	1189	0	0
+TCONS_00003816	1134	1134	0	0
+TCONS_00003817	1097	1097	108.701	70.8297
+TCONS_00003818	717	717	185.924	71.2023
+TCONS_00003819	1577	1577	70.0438	69.4085
+TCONS_00003820	1148	1148	5.69836	3.9185
+TCONS_00003821	1022	1022	0	0
+TCONS_00003822	806	806	55.2067	24.6157
+TCONS_00003824	1129	1129	0	0
+TCONS_00003825	2373	2373	16.5374	25.6933
+TCONS_00003826	1390	1390	23.2476	19.9635
+TCONS_00003827	937	937	0	0
+TCONS_00003828	4272	4272	5.47035	15.8428
+TCONS_00003829	4295	4295	42.5403	123.893
+TCONS_00003830	4812	4812	28.5482	93.5772
+TCONS_00003831	78	78	0	0
+TCONS_00003833	78	78	0	0
+TCONS_00003835	683	683	59.5078	21.3591
+TCONS_00003836	1317	1317	60.7083	48.9992
+TCONS_00003837	1316	1316	44.831	36.1526
+TCONS_00003838	1704	1704	10.0989	10.914
+TCONS_00003839	496	496	6.01699	1.36425
+TCONS_00003840	436	436	0	0
+TCONS_00003841	4282	4282	32.3187	93.8273
+TCONS_00003842	2799	2799	295.524	548.139
+TCONS_00003843	2814	2814	1082.34	2019
+TCONS_00003844	896	896	73.4242	37.4101
+TCONS_00003845	1214	1214	32.8138	24.0956
+TCONS_00003846	3040	3040	4.26944	8.64636
+TCONS_00003847	962	962	44.7182	24.8707
+TCONS_00003848	1040	1040	9.52865	5.82491
+TCONS_00003849	1870	1870	22.4842	26.9374
+TCONS_00003850	1750	1750	23.4301	26.083
+TCONS_00003851	1741	1741	60.5935	67.0689
+TCONS_00003852	2741	2741	0	0
+TCONS_00003853	1979	1979	61.1541	77.9786
+TCONS_00003854	2373	2373	11.5539	17.9508
+TCONS_00003855	2276	2276	18.3462	27.2455
+TCONS_00003856	2704	2704	18.8394	33.6781
+TCONS_00003857	2104	2104	0	0
+TCONS_00003858	3532	3532	0	0
+TCONS_00003859	1062	1062	1.5483e-4	9.70561e-5
+TCONS_00003860	1178	1178	0	0
+TCONS_00003861	1199	1199	0	0
+TCONS_00003862	988	988	9.49778	5.45689
+TCONS_00003863	1067	1067	5.41031	3.41062
+TCONS_00003864	1700	1700	0	0
+TCONS_00003865	3539	3539	62.2363	147.994
+TCONS_00003866	2021	2021	7345.21	9584.09
+TCONS_00003867	2137	2137	450.58	624.87
+TCONS_00003869	2153	2153	17.8042	24.8925
+TCONS_00003870	771	771	95.7614	40.3289
+TCONS_00003871	1036	1036	33.631	20.4637
+TCONS_00003872	2262	2262	0	0
+TCONS_00003873	2379	2379	21.3963	33.3331
+TCONS_00003874	2306	2306	7.1809	10.8165
+TCONS_00003875	2258	2258	1248.12	1837.67
+TCONS_00003876	2387	2387	62.3358	97.4648
+TCONS_00003877	2127	2127	107.22	147.936
+TCONS_00003878	2380	2380	53.1632	82.86
+TCONS_00003879	3517	3517	15.8809	37.5168
+TCONS_00003880	3211	3211	86.9683	186.639
+TCONS_00003881	5325	5325	92.8157	337.897
+TCONS_00003882	3759	3759	688.41	1744.06
+TCONS_00003883	1946	1946	115.455	144.525
+TCONS_00003884	2880	2880	128.912	246.488
+TCONS_00003885	2135	2135	1907.14	2642.15
+TCONS_00003886	2608	2608	30.905	53.1498
+TCONS_00003887	2510	2510	43.6614	72.0632
+TCONS_00003888	1832	1832	0	0
+TCONS_00003891	1918	1918	95.5243	117.685
+TCONS_00003892	2069	2069	0	0
+TCONS_00003893	2242	2242	52.6869	76.9776
+TCONS_00003894	1570	1570	0	0
+TCONS_00003895	1104	1104	465.674	305.738
+TCONS_00003896	2483	2483	8.22763	13.4226
+TCONS_00003897	2182	2182	104.362	148.051
+TCONS_00003898	2193	2193	50.4304	71.9339
+TCONS_00003899	2923	2923	979.669	1902.97
+TCONS_00003900	4402	4402	20.0274	59.8421
+TCONS_00003901	2005	2005	106.991	138.393
+TCONS_00003902	1987	1987	3577.65	4582.16
+TCONS_00003903	1996	1996	4244.01	5462.61
+TCONS_00003904	2299	2299	5256.21	7891.33
+TCONS_00003905	2728	2728	28.8363	52.0383
+TCONS_00003906	781	781	2652.13	1135.67
+TCONS_00003907	813	813	609.763	274.9
+TCONS_00003908	909	909	937.029	486.034
+TCONS_00003909	990	990	1093.8	629.986
+TCONS_00003910	2914	2914	4.67165	9.04479
+TCONS_00003911	4362	4362	125.66	371.922
+TCONS_00003912	2868	2868	35.7335	68.0216
+TCONS_00003913	5269	5269	868.503	3127.42
+TCONS_00003914	3115	3115	242.996	504.992
+TCONS_00003915	3129	3129	42.2777	88.2797
+TCONS_00003916	3839	3839	152.808	395.774
+TCONS_00003917	732	732	7464.7	2937.88
+TCONS_00003918	1148	1148	40.6891	27.98
+TCONS_00003919	1456	1456	44.2621	40.0744
+TCONS_00003920	1475	1475	0.00393203	0.00361283
+TCONS_00003921	2016	2016	1.70114	2.21365
+TCONS_00003922	1116	1116	241.04	160.299
+TCONS_00003923	1302	1302	6225.88	4959.05
+TCONS_00003924	1497	1497	4.94176	4.61746
+TCONS_00003925	2970	2970	394.015	778.451
+TCONS_00003926	1629	1629	118.663	121.949
+TCONS_00003927	2053	2053	108.116	143.516
+TCONS_00003928	1877	1877	84.5745	101.744
+TCONS_00003929	2452	2452	0	0
+TCONS_00003932	2431	2431	0	0
+TCONS_00003934	2499	2499	174.907	287.324
+TCONS_00003935	262	262	524.22	32.17
+TCONS_00003936	335	335	279.885	31.6057
+TCONS_00003937	2236	2236	3.31772	4.83326
+TCONS_00003938	5141	5141	147.04	516.177
+TCONS_00003939	6420	6420	23.518	103.823
+TCONS_00003940	6002	6002	46.6985	192.357
+TCONS_00003941	5915	5915	250.313	1015.67
+TCONS_00003942	1231	1231	431.605	322.119
+TCONS_00003943	2279	2279	26.0519	38.7443
+TCONS_00003944	1777	1777	31.0126	35.1161
+TCONS_00003945	1557	1557	335.417	327.632
+TCONS_00003946	1504	1504	57.5165	54.0265
+TCONS_00003947	2595	2595	161.524	276.3
+TCONS_00003948	2625	2625	862.766	1494.13
+TCONS_00003949	1966	1966	191.884	242.911
+TCONS_00003950	1920	1920	76.5179	94.3778
+TCONS_00003951	1277	1277	129.511	100.869
+TCONS_00003952	1108	1108	22.4483	14.8019
+TCONS_00003953	1120	1120	1.1373	0.759554
+TCONS_00003954	1150	1150	113.015	77.8747
+TCONS_00003955	887	887	142.455	71.6753
+TCONS_00003956	704	704	0	0
+TCONS_00003957	734	734	26.4992	10.4668
+TCONS_00003958	657	657	0	0
+TCONS_00003959	2149	2149	138.858	193.747
+TCONS_00003961	3841	3841	1419.51	3678.55
+TCONS_00003962	1430	1430	476.471	422.635
+TCONS_00003963	3021	3021	4.53257	9.11837
+TCONS_00003964	3127	3127	508.78	1061.66
+TCONS_00003965	3228	3228	618.528	1334.83
+TCONS_00003966	3152	3152	0	0
+TCONS_00003967	3646	3646	1.69946	4.16976
+TCONS_00003968	1431	1431	55.5119	49.2788
+TCONS_00003969	3127	3127	17124.9	35734.1
+TCONS_00003970	2981	2981	5.09328	10.1023
+TCONS_00003971	1118	1118	0	0
+TCONS_00003972	958	958	24.6549	13.6425
+TCONS_00003973	2097	2097	0	0
+TCONS_00003974	2755	2755	0	0
+TCONS_00003975	4710	4710	0	0
+TCONS_00003976	2572	2572	0	0
+TCONS_00003977	2145	2145	0	0
+TCONS_00003978	1954	1954	0	0
+TCONS_00003979	1253	1253	23.9242	18.2274
+TCONS_00003980	2347	2347	138.287	212.307
+TCONS_00003981	2216	2216	56.9174	82.1125
+TCONS_00003982	2266	2266	68.2012	100.802
+TCONS_00003983	728	728	2117.66	827.458
+TCONS_00003984	1641	1641	19.3263	20.0254
+TCONS_00003985	1826	1826	0	0
+TCONS_00003986	2248	2248	116.381	170.531
+TCONS_00003987	1345	1345	56.9632	47.104
+TCONS_00003988	1530	1530	19.6493	18.8182
+TCONS_00003989	2072	2072	14.5103	19.4563
+TCONS_00003990	2012	2012	758.764	985.214
+TCONS_00003991	2642	2642	416.203	725.78
+TCONS_00003993	1305	1305	0	0
+TCONS_00003995	2209	2209	9.40505	13.5217
+TCONS_00003996	2303	2303	0	0
+TCONS_00003997	3322	3322	13.5036	30.0391
+TCONS_00003998	2754	2754	0	0
+TCONS_00003999	2902	2902	5.07563	9.78387
+TCONS_00004000	2222	2222	0	0
+TCONS_00004001	620	620	15.1876	4.77487
+TCONS_00004002	6472	6472	142.899	636.098
+TCONS_00004003	7432	7432	72.663	372.763
+TCONS_00004004	1698	1698	336.731	362.48
+TCONS_00004005	2041	2041	74.2892	97.9835
+TCONS_00004006	5724	5724	19.4689	76.3684
+TCONS_00004007	3322	3322	47.5041	105.674
+TCONS_00004008	6356	6356	198.903	869.081
+TCONS_00004009	2648	2648	1340.01	2342.41
+TCONS_00004010	6458	6458	93.4593	415.097
+TCONS_00004011	5892	5892	287.792	1163.07
+TCONS_00004012	2208	2208	247.973	356.338
+TCONS_00004013	1660	1660	1286.24	1350.04
+TCONS_00004014	2505	2505	4.8963	8.06402
+TCONS_00004015	847	847	0	0
+TCONS_00004016	5002	5002	92.6298	316.07
+TCONS_00004017	4370	4370	8.27673	24.5438
+TCONS_00004018	3630	3630	4.21795	10.3013
+TCONS_00004020	2773	2773	0	0
+TCONS_00004021	1349	1349	3.74518	3.10756
+TCONS_00004022	6343	6343	3.15076	13.7379
+TCONS_00004023	7735	7735	0	0
+TCONS_00004024	9646	9646	0.291399	1.95097
+TCONS_00004025	3491	3491	0	0
+TCONS_00004026	2198	2198	0	0
+TCONS_00004027	2084	2084	8967.88	12100.8
+TCONS_00004028	2067	2067	1804.95	2413.81
+TCONS_00004029	4813	4813	2379.46	7801.24
+TCONS_00004030	4920	4920	278.354	933.657
+TCONS_00004031	2710	2710	312.924	560.724
+TCONS_00004032	2632	2632	161.414	280.335
+TCONS_00004033	1413	1413	1138.88	996.511
+TCONS_00004034	1429	1429	20.3048	17.9962
+TCONS_00004035	1624	1624	55.0294	56.3586
+TCONS_00004036	1294	1294	896.376	708.914
+TCONS_00004037	1804	1804	29.4384	33.8954
+TCONS_00004038	1877	1877	0	0
+TCONS_00004039	1802	1802	261.662	300.908
+TCONS_00004040	1200	1200	0.804087	0.682124
+TCONS_00004041	4259	4259	0.47256	1.36425
+TCONS_00004042	1066	1066	2.14592	1.35125
+TCONS_00004043	1559	1559	0	0
+TCONS_00004044	1448	1448	0	0
+TCONS_00004046	1615	1615	2.23269	2.27242
+TCONS_00004048	1480	1480	2.3478	2.16551
+TCONS_00004049	1642	1642	0	0
+TCONS_00004051	894	894	4.71635	2.39634
+TCONS_00004052	3694	3694	0	0
+TCONS_00004053	5038	5038	1.78897	6.1498100000000004
+TCONS_00004054	4725	4725	0	0
+TCONS_00004055	4698	4698	0	0
+TCONS_00004056	4715	4715	26.1927	84.0599
+TCONS_00004058	4643	4643	0	0
+TCONS_00004059	4783	4783	0.0107549	0.0350327
+TCONS_00004060	4761	4761	12.1928	39.5266
+TCONS_00004061	5221	5221	6.2636	22.3423
+TCONS_00004062	4528	4528	0	0
+TCONS_00004063	1548	1548	0	0
+TCONS_00004064	2832	2832	351.868	660.855
+TCONS_00004065	2864	2864	8.67754	16.4939
+TCONS_00004066	6318	6318	72.8236	316.237
+TCONS_00004067	3475	3475	655.216	1528.42
+TCONS_00004068	4486	4486	339.947	1035.96
+TCONS_00004069	1357	1357	0	0
+TCONS_00004070	3293	3293	1423.69	3137.86
+TCONS_00004071	3137	3137	31.778	66.535
+TCONS_00004072	3219	3219	55.3143	119.021
+TCONS_00004074	643	643	0	0
+TCONS_00004075	647	647	0	0
+TCONS_00004076	1883	1883	1.13004	1.36425
+TCONS_00004077	3128	3128	2611.2	5450.57
+TCONS_00004078	2156	2156	107.861	151.032
+TCONS_00004079	6306	6306	2150.1	9318.59
+TCONS_00004080	8192	8192	0	0
+TCONS_00004081	8007	8007	248.438	1375.48
+TCONS_00004082	2592	2592	98.9852	169.113
+TCONS_00004083	584	584	0	0
+TCONS_00004084	2710	2710	8.55394	15.3277
+TCONS_00004085	2267	2267	199.782	295.42
+TCONS_00004086	1812	1812	18801.7	21754.7
+TCONS_00004087	1801	1801	1410.02	1620.51
+TCONS_00004088	1753	1753	0	0
+TCONS_00004089	1683	1683	3393.8	3617.33
+TCONS_00004090	1644	1644	6660.58	6915.63
+TCONS_00004091	1453	1453	27224.7	24591.2
+TCONS_00004092	1448	1448	0	0
+TCONS_00004093	1276	1276	194.429	151.293
+TCONS_00004094	1539	1539	1.25394	1.36425
+TCONS_00004095	2012	2012	13.3987	17.3974
+TCONS_00004096	1942	1942	0	0
+TCONS_00004097	2436	2436	96.8034	154.71
+TCONS_00004098	2398	2398	0	0
+TCONS_00004099	2411	2411	111.715	176.567
+TCONS_00004100	920	920	8.86318	4.66622
+TCONS_00004101	1279	1279	0	0
+TCONS_00004102	1153	1153	20.7286	14.3274
+TCONS_00004103	958	958	53.0161	29.3357
+TCONS_00004104	2913	2913	1.6584	3.20966
+TCONS_00004105	2396	2396	1.86144	2.92229
+TCONS_00004106	3934	3934	82.404	218.962
+TCONS_00004107	1822	1822	0	0
+TCONS_00004108	951	951	75.8761	41.6096
+TCONS_00004109	2235	2235	743.025	1081.91
+TCONS_00004110	5191	5191	2912.17	10325.9
+TCONS_00004111	5161	5161	1348.52	4752.97
+TCONS_00004112	5134	5134	17.8963	62.7354
+TCONS_00004113	2995	2995	86.0232	171.475
+TCONS_00004114	2961	2961	435.606	857.849
+TCONS_00004115	1345	1345	6.32133	5.22724
+TCONS_00004116	1500	1500	645.93	604.91
+TCONS_00004117	1440	1440	437.5	391.16
+TCONS_00004118	1383	1383	14.4525	12.3393
+TCONS_00004119	2036	2036	824.41	1084.44
+TCONS_00004120	3391	3391	283.915	645.427
+TCONS_00004121	7931	7931	0.562232	3.0826
+TCONS_00004122	4405	4405	1.19485	3.57277
+TCONS_00004123	3250	3250	6.35267	13.8084
+TCONS_00004124	2267	2267	0	0
+TCONS_00004125	2262	2262	0	0
+TCONS_00004126	2238	2238	0	0
+TCONS_00004127	2316	2316	0	0
+TCONS_00004128	2443	2443	14.0413	22.5101
+TCONS_00004129	720	720	0	0
+TCONS_00004130	2190	2190	0	0
+TCONS_00004132	828	828	4056.21	1871.68
+TCONS_00004133	1273	1273	4682.54	3633.75
+TCONS_00004134	2805	2805	1459.04	2712.41
+TCONS_00004135	2730	2730	0	0
+TCONS_00004136	2689	2689	39.1828	69.6293
+TCONS_00004137	4020	4020	106.801	290.281
+TCONS_00004138	8724	8724	650.018	3928.31
+TCONS_00004139	1534	1534	95.0546	91.3029
+TCONS_00004140	1543	1543	0	0
+TCONS_00004141	1183	1183	0	0
+TCONS_00004142	1830	1830	170.964	199.99
+TCONS_00004143	1151	1151	1773.42	1223.26
+TCONS_00004144	7188	7188	388.25	1924.76
+TCONS_00004145	7105	7105	242.714	1189.02
+TCONS_00004146	1411	1411	133.884	116.958
+TCONS_00004148	852	852	22.8136	10.914
+TCONS_00004149	697	697	0	0
+TCONS_00004150	2339	2339	749.632	1146.65
+TCONS_00004151	2534	2534	94.9078	158.256
+TCONS_00004152	1368	1368	279.897	236.003
+TCONS_00004153	1805	1805	309.701	356.81
+TCONS_00004154	1262	1262	0	0
+TCONS_00004155	1222	1222	0	0
+TCONS_00004156	252	252	149.845	8.13791
+TCONS_00004158	1002	1002	1297.86	758.522
+TCONS_00004160	1840	1840	0	0
+TCONS_00004162	1720	1720	0	0
+TCONS_00004163	1734	1734	0	0
+TCONS_00004164	1855	1855	0	0
+TCONS_00004165	1007	1007	203.021	119.372
+TCONS_00004169	2100	2100	0	0
+TCONS_00004170	2164	2164	0	0
+TCONS_00004172	1844	1844	0	0
+TCONS_00004173	2100	2100	0	0
+TCONS_00004175	1906	1906	0	0
+TCONS_00004176	6978	6978	1.68656	8.11082
+TCONS_00004177	7099	7099	0	0
+TCONS_00004178	3105	3105	0.374731	0.776114
+TCONS_00004179	4316	4316	26.006	76.1253
+TCONS_00004180	1987	1987	165.238	211.632
+TCONS_00004181	1537	1537	15.4045	14.8291
+TCONS_00004182	2045	2045	14.5948	19.2911
+TCONS_00004184	1904	1904	31.8842	38.9656
+TCONS_00004185	1798	1798	0	0
+TCONS_00004186	2196	2196	34.7737	49.675
+TCONS_00004187	538	538	14920.7	3826.03
+TCONS_00004188	2732	2732	39.6268	71.623
+TCONS_00004189	2749	2749	503.537	916.164
+TCONS_00004190	2564	2564	0	0
+TCONS_00004191	2770	2770	62.8375	115.263
+TCONS_00004192	2745	2745	0	0
+TCONS_00004193	1894	1894	3.18681	3.87206
+TCONS_00004194	1928	1928	11.3755	14.0949
+TCONS_00004196	1166	1166	21.0158	14.7191
+TCONS_00004197	905	905	0	0
+TCONS_00004199	2892	2892	225.907	433.865
+TCONS_00004200	2877	2877	19.5866	37.4094
+TCONS_00004201	2904	2904	0	0
+TCONS_00004202	2907	2907	55.4118	107.009
+TCONS_00004203	2415	2415	302.529	479.006
+TCONS_00004204	892	892	7.60353	3.85255
+TCONS_00004205	1700	1700	30.7694	33.1657
+TCONS_00004206	3946	3946	578.063	1540.92
+TCONS_00004207	1631	1631	0	0
+TCONS_00004208	2008	2008	123.074	159.457
+TCONS_00004209	1984	1984	44.2742	56.6113
+TCONS_00004210	3029	3029	12.9302	26.0854
+TCONS_00004211	1559	1559	176.423	172.577
+TCONS_00004212	2474	2474	18.643	30.2959
+TCONS_00004213	3055	3055	44.6479	90.8932
+TCONS_00004214	2975	2975	567.052	1122.32
+TCONS_00004215	2963	2963	0	0
+TCONS_00004216	3650	3650	0.350249	0.860354
+TCONS_00004217	2014	2014	0	0
+TCONS_00004219	5368	5368	21.5759	79.2035
+TCONS_00004220	574	574	41.8251	11.7894
+TCONS_00004221	1122	1122	22.1882	14.85
+TCONS_00004222	2482	2482	0.8366	1.36425
+TCONS_00004223	1160	1160	2175.15	1514.2
+TCONS_00004224	4268	4268	702.878	2033.63
+TCONS_00004225	1512	1512	648.398	612.722
+TCONS_00004226	1512	1512	211.661	200.015
+TCONS_00004227	2216	2216	1.83122	2.64183
+TCONS_00004228	2663	2663	104.738	184.199
+TCONS_00004229	3026	3026	41.7203	84.078
+TCONS_00004230	2696	2696	141.752	252.6
+TCONS_00004231	1404	1404	171.552	149.015
+TCONS_00004232	2173	2173	62.523	88.2989
+TCONS_00004233	1966	1966	18.2709	23.1296
+TCONS_00004234	2746	2746	26.45	48.0685
+TCONS_00004235	1912	1912	76.915	94.4326
+TCONS_00004236	2029	2029	12.1416	15.9111
+TCONS_00004237	596	596	210.123	62.496
+TCONS_00004238	2015	2015	0	0
+TCONS_00004239	1171	1171	0	0
+TCONS_00004240	4170	4170	1.72622	4.87486
+TCONS_00004241	4395	4395	1.22414	3.65169
+TCONS_00004242	359	359	504.172	65.4839
+TCONS_00004243	1100	1100	867.572	567.15
+TCONS_00004244	1097	1097	198.784	129.528
+TCONS_00004245	1081	1081	5.12036	3.27851
+TCONS_00004246	1078	1078	0.916315	0.584764
+TCONS_00004247	1224	1224	236.528	175.357
+TCONS_00004248	3996	3996	187.73	507.059
+TCONS_00004249	3981	3981	196.045	527.438
+TCONS_00004250	3694	3694	0.0212982	0.0529795
+TCONS_00004251	1080	1080	26.9443	17.2331
+TCONS_00004252	1639	1639	0	0
+TCONS_00004253	1143	1143	5234.69	3581.15
+TCONS_00004254	4362	4362	3.363e-5	1.03703e-4
+TCONS_00004255	4014	4014	1.68266	4.77476
+TCONS_00004256	1625	1625	0	0
+TCONS_00004258	3950	3950	652.602	1741.46
+TCONS_00004259	4091	4091	166.087	459.755
+TCONS_00004260	2521	2521	0	0
+TCONS_00004261	3241	3241	204.973	444.232
+TCONS_00004262	2368	2368	0	0
+TCONS_00004263	3381	3381	328.008	743.345
+TCONS_00004264	5835	5835	374.131	1496.92
+TCONS_00004265	3402	3402	9.31627	21.2512
+TCONS_00004266	941	941	236.908	128.243
+TCONS_00004267	2535	2535	372.124	620.767
+TCONS_00004268	2916	2916	14.6598	28.4036
+TCONS_00004269	2888	2888	0	0
+TCONS_00004270	3481	3481	434.674	1015.8
+TCONS_00004271	3477	3477	98.0826	228.935
+TCONS_00004272	15880	15880	808.264	8973.52
+TCONS_00004273	3162	3162	6.85761	14.4793
+TCONS_00004274	3124	3124	179.439	374.051
+TCONS_00004275	2172	2172	0	0
+TCONS_00004276	5751	5751	5.36473	21.146
+TCONS_00004277	2675	2675	7.49306	13.2413
+TCONS_00004278	4237	4237	2011.2	5774.91
+TCONS_00004279	4234	4234	82.3087	236.165
+TCONS_00004280	4234	4234	229.103	657.355
+TCONS_00004281	4171	4171	9.32161	26.3309
+TCONS_00004282	2314	2314	9.92548	15.0067
+TCONS_00004283	2117	2117	0	0
+TCONS_00004284	1241	1241	12.6755	9.54973
+TCONS_00004285	1362	1362	1927.33	1616.91
+TCONS_00004286	1257	1257	1015.18	776.318
+TCONS_00004287	1032	1032	0	0
+TCONS_00004288	1575	1575	0	0
+TCONS_00004289	2084	2084	18.8245	25.4007
+TCONS_00004290	1629	1629	19793.9	20342
+TCONS_00004291	2049	2049	167.13	221.38
+TCONS_00004292	2093	2093	20.1265	27.2856
+TCONS_00004293	2232	2232	117.163	170.352
+TCONS_00004294	2973	2973	373.604	738.917
+TCONS_00004295	2401	2401	0	0
+TCONS_00004296	2281	2281	101.541	151.155
+TCONS_00004297	1715	1715	31.7863	34.5989
+TCONS_00004298	1045	1045	9.63659	5.92496
+TCONS_00004299	1249	1249	0	0
+TCONS_00004301	922	922	6.64325e-4	3.50689e-4
+TCONS_00004302	999	999	0	0
+TCONS_00004303	968	968	0	0
+TCONS_00004304	888	888	5.41459	2.72814
+TCONS_00004308	1452	1452	0	0
+TCONS_00004309	2467	2467	4.69349	8.18549
+TCONS_00004310	1607	1607	5042.8	5104.01
+TCONS_00004311	2350	2350	8507.96	13080
+TCONS_00004312	2456	2456	1374.97	2216.9
+TCONS_00004313	2126	2126	12796.8	17647.2
+TCONS_00004314	2135	2135	0	0
+TCONS_00004315	2073	2073	0	0
+TCONS_00004316	2015	2015	0	0
+TCONS_00004317	1812	1812	13.3569	15.4548
+TCONS_00004318	1671	1671	136.61	144.449
+TCONS_00004319	1978	1978	19.2894	24.5826
+TCONS_00004320	3776	3776	0	0
+TCONS_00004321	3773	3773	27.7696	70.628
+TCONS_00004322	3705	3705	49.9771	124.707
+TCONS_00004323	3834	3834	44.5145	115.136
+TCONS_00004324	3063	3063	100.372	204.902
+TCONS_00004325	3139	3139	117.394	245.959
+TCONS_00004326	4775	4775	172.133	559.726
+TCONS_00004327	4317	4317	31.4786	92.1672
+TCONS_00004328	3921	3921	788.321	2087.46
+TCONS_00004329	3797	3797	1967.7	5037.95
+TCONS_00004330	1860	1860	1467.83	1748.18
+TCONS_00004331	2544	2544	0	0
+TCONS_00004332	2537	2537	239.209	399.38
+TCONS_00004333	927	927	267.594	142.205
+TCONS_00004334	5160	5160	628.196	2213.68
+TCONS_00004335	4949	4949	48.9399	165.158
+TCONS_00004336	5786	5786	802.383	3182.59
+TCONS_00004337	5850	5850	216.424	868.219
+TCONS_00004338	6175	6175	313.871	1331.26
+TCONS_00004340	6283	6283	311.711	1345.9
+TCONS_00004342	1915	1915	0	0
+TCONS_00004343	2088	2088	84.9247	114.833
+TCONS_00004344	5241	5241	155.001	555.081
+TCONS_00004345	5087	5087	986.331	3424.81
+TCONS_00004346	5096	5096	1772	6164.14
+TCONS_00004347	5000	5000	17.8227	60.7891
+TCONS_00004348	5136	5136	3578.95	12551
+TCONS_00004349	2198	2198	272.719	389.97
+TCONS_00004350	2326	2326	0.448641	0.682124
+TCONS_00004351	2057	2057	611.143	812.978
+TCONS_00004352	3348	3348	0	0
+TCONS_00004353	3300	3300	2.46707	5.44969
+TCONS_00004354	3333	3333	0.00326853	0.00729636
+TCONS_00004355	3494	3494	0	0
+TCONS_00004356	3639	3639	56.5689	138.516
+TCONS_00004357	4462	4462	1140.54	3456.33
+TCONS_00004359	4264	4264	56.0565	162.029
+TCONS_00004360	4498	4498	0	0
+TCONS_00004361	2089	2089	2.14287	2.89905
+TCONS_00004362	2126	2126	190.394	262.56
+TCONS_00004363	2411	2411	176.613	279.139
+TCONS_00004364	3586	3586	185.294	446.773
+TCONS_00004365	14287	14287	5743.53	57297.8
+TCONS_00004366	14290	14290	1240.5	12377.9
+TCONS_00004367	846	846	322.826	153.071
+TCONS_00004368	3903	3903	0.0101707	0.0280627
+TCONS_00004369	3883	3883	1.48074	4.06468
+TCONS_00004370	510	510	0	0
+TCONS_00004371	8653	8653	478.317	2866.65
+TCONS_00004372	8587	8587	568.553	3380.92
+TCONS_00004373	3921	3921	0	0
+TCONS_00004374	2834	2834	0	0
+TCONS_00004375	1637	1637	0.283549	0.293004
+TCONS_00004376	2740	2740	289.799	525.433
+TCONS_00004377	2731	2731	1179.9	2131.75
+TCONS_00004378	2565	2565	2277.44	3847.46
+TCONS_00004379	2574	2574	509.044	863.207
+TCONS_00004380	2451	2451	0	0
+TCONS_00004381	2617	2617	0	0
+TCONS_00004382	2388	2388	89.2775	139.653
+TCONS_00004383	4314	4314	313.143	916.196
+TCONS_00004384	4492	4492	110.131	336.081
+TCONS_00004385	1586	1586	567.04	565.504
+TCONS_00004386	540	540	217.637	56.115
+TCONS_00004387	738	738	168.593	67.0681
+TCONS_00004388	646	646	13.0752	4.35108
+TCONS_00004389	2552	2552	59.8523	100.563
+TCONS_00004390	2791	2791	41.4315	76.613
+TCONS_00004391	4088	4088	91.3879	252.783
+TCONS_00004392	4129	4129	498.976	1394.65
+TCONS_00004394	1768	1768	0	0
+TCONS_00004395	697	697	0.195125	0.0719674
+TCONS_00004396	2041	2041	0	0
+TCONS_00004397	5192	5192	29.62	105.047
+TCONS_00004398	1287	1287	1229.48	966.267
+TCONS_00004399	1547	1547	71.3578	69.1972
+TCONS_00004400	1074	1074	142.83	90.7456
+TCONS_00004401	1607	1607	0	0
+TCONS_00004402	1631	1631	192.089	197.679
+TCONS_00004403	1553	1553	0	0
+TCONS_00004404	1566	1566	193.265	190.009
+TCONS_00004405	1676	1676	121.508	128.91
+TCONS_00004406	1824	1824	29.0902	33.9059
+TCONS_00004408	1244	1244	3.57145	2.6983
+TCONS_00004409	934	934	0	0
+TCONS_00004410	1607	1607	1594.15	1613.5
+TCONS_00004412	1394	1394	327.298	281.987
+TCONS_00004413	2160	2160	0	0
+TCONS_00004414	1411	1411	5.04991	4.41149
+TCONS_00004415	2054	2054	37.355	49.6126
+TCONS_00004416	2077	2077	124.816	167.802
+TCONS_00004418	953	953	0	0
+TCONS_00004419	1774	1774	0	0
+TCONS_00004420	2239	2239	205.454	299.74
+TCONS_00004421	1842	1842	1284.91	1513.96
+TCONS_00004422	2924	2924	962.225	1869.77
+TCONS_00004423	2686	2686	0	0
+TCONS_00004424	4859	4859	0	0
+TCONS_00004425	5799	5799	0	0
+TCONS_00004426	3940	3940	0	0
+TCONS_00004427	5094	5094	0	0
+TCONS_00004428	2703	2703	2.28441	4.08209
+TCONS_00004429	2798	2798	0	0
+TCONS_00004431	2725	2725	0.00591119	0.0106549
+TCONS_00004432	4461	4461	0.00134022	0.00422657
+TCONS_00004433	4548	4548	0	0
+TCONS_00004434	4417	4417	0.147425	0.460339
+TCONS_00004435	4424	4424	0.0695635	0.217558
+TCONS_00004436	686	686	0	0
+TCONS_00004439	2497	2497	40.3414	66.2127
+TCONS_00004440	2827	2827	12.8311	24.0531
+TCONS_00004441	2683	2683	241.43	428.007
+TCONS_00004442	2803	2803	6.05059	11.2398
+TCONS_00004443	1653	1653	14.842	15.5048
diff -r 000000000000 -r f3fefb6d8254 test-data/salmon_cond2_rep1.sf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/salmon_cond2_rep1.sf	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,1093 @@
+Name	Length	EffectiveLength	TPM	NumReads
+TCONS_00000001	1652	1652	0	0
+TCONS_00000002	1488	1488	0	0
+TCONS_00000003	1595	1595	0	0
+TCONS_00000006	78	78	1377990	4.67384
+TCONS_00000007	2750	2750	329.487	589.154
+TCONS_00000008	4369	4369	358.067	1050.07
+TCONS_00000009	4272	4272	0.00971677	0.0278293
+TCONS_00000010	937	937	0	0
+TCONS_00000012	1584	1584	88354.2	85156.6
+TCONS_00000013	694	694	6801.86	2276.16
+TCONS_00000015	1023	1023	31724.9	17994.9
+TCONS_00000016	510	510	0	0
+TCONS_00000017	854	854	0	0
+TCONS_00000018	701	701	86.5869	29.4037
+TCONS_00000019	517	517	0	0
+TCONS_00000020	1543	1543	121.215	113.315
+TCONS_00000021	2682	2682	27.6282	48.0737
+TCONS_00000022	3043	3043	23.7597	47.4061
+TCONS_00000023	490	490	0	0
+TCONS_00000024	2554	2554	0	0
+TCONS_00000025	2121	2121	8.21721	11.0393
+TCONS_00000026	2560	2560	167.146	276.421
+TCONS_00000027	955	955	158.746	82.4125
+TCONS_00000028	2003	2003	234.098	294.967
+TCONS_00000029	1149	1149	184.96	121.388
+TCONS_00000030	2398	2398	9.52126	14.6556
+TCONS_00000031	2554	2554	12.1632	20.0637
+TCONS_00000032	2293	2293	4.25187e-4	6.2291e-4
+TCONS_00000033	662	662	1003.63	313.147
+TCONS_00000034	7319	7319	1882.49	9446.49
+TCONS_00000035	673	673	4.17578	1.33538
+TCONS_00000036	971	971	27.6915	14.6892
+TCONS_00000037	1616	1616	2.03063	2.00307
+TCONS_00000041	2259	2259	5.07399	7.31156
+TCONS_00000042	2278	2278	0.00524265	0.00762502
+TCONS_00000043	2111	2111	9.51204	12.7115
+TCONS_00000044	2790	2790	291.136	528.811
+TCONS_00000045	3054	3054	2.05334	4.11285
+TCONS_00000046	2960	2960	5.612	10.8679
+TCONS_00000047	2590	2590	21.0208	35.2095
+TCONS_00000048	2684	2684	6.52646	11.3654
+TCONS_00000049	2530	2530	29.7772	48.6133
+TCONS_00000050	1239	1239	644.637	464.085
+TCONS_00000051	1181	1181	137.01	93.0183
+TCONS_00000052	1932	1932	15.435	18.6737
+TCONS_00000053	2192	2192	201.703	281.098
+TCONS_00000054	2558	2558	3.23266	5.34153
+TCONS_00000055	1747	1747	0	0
+TCONS_00000056	1594	1594	83.5124	81.0804
+TCONS_00000057	1741	1741	475.434	510.996
+TCONS_00000058	491	491	55.8942	10.6831
+TCONS_00000059	2141	2141	41.0204	55.6882
+TCONS_00000060	2536	2536	494.032	808.638
+TCONS_00000061	3859	3859	77.4015	199.083
+TCONS_00000062	2432	2432	478.775	748.464
+TCONS_00000063	1939	1939	119.152	144.742
+TCONS_00000064	2667	2667	106.773	184.656
+TCONS_00000065	1170	1170	264.323	177.397
+TCONS_00000066	2611	2611	55.8615	94.3965
+TCONS_00000067	2467	2467	1032.87	1640.23
+TCONS_00000068	2329	2329	317.113	472.649
+TCONS_00000069	2616	2616	29.3079	49.6291
+TCONS_00000070	1048	1048	6.84937	4.00615
+TCONS_00000071	3243	3243	0.00599657	0.0128123
+TCONS_00000072	3201	3201	99.9908	210.673
+TCONS_00000073	3231	3231	0	0
+TCONS_00000074	3026	3026	102.016	202.32
+TCONS_00000076	2930	2930	47.3159	90.6262
+TCONS_00000077	2890	2890	25.253	47.6541
+TCONS_00000078	3311	3311	0	0
+TCONS_00000079	2590	2590	109.105	182.749
+TCONS_00000080	2308	2308	0	0
+TCONS_00000081	585	585	224.576	57.8466
+TCONS_00000082	1239	1239	36.4726	26.2572
+TCONS_00000083	1306	1306	17.9878	13.8017
+TCONS_00000084	905	905	0	0
+TCONS_00000085	850	850	8.25962	3.67487
+TCONS_00000086	906	906	51.4446	24.9253
+TCONS_00000087	848	848	16.8154	7.4577
+TCONS_00000088	1808	1808	89.9153	100.9
+TCONS_00000089	921	921	2.69713	1.33538
+TCONS_00000090	1101	1101	24.6753	15.3569
+TCONS_00000091	1925	1925	42.116	50.7445
+TCONS_00000092	2324	2324	863.746	1284.34
+TCONS_00000093	2112	2112	0	0
+TCONS_00000094	2032	2032	0	0
+TCONS_00000095	2009	2009	39.3944	49.8046
+TCONS_00000096	1745	1745	0	0
+TCONS_00000097	1212	1212	4.2835	3.002
+TCONS_00000098	1849	1849	8.06605	9.28521
+TCONS_00000099	1859	1859	18.5776	21.5169
+TCONS_00000100	2089	2089	57.7278	76.2475
+TCONS_00000101	1943	1943	109.674	133.539
+TCONS_00000102	5706	5706	778.44	3018.63
+TCONS_00000103	3093	3093	780.296	1584.45
+TCONS_00000104	3203	3203	22.6022	47.653
+TCONS_00000105	4834	4834	0	0
+TCONS_00000106	3951	3951	0	0
+TCONS_00000107	3939	3939	3.13321e-5	8.23607e-5
+TCONS_00000108	4854	4854	0.299922	0.982391
+TCONS_00000109	5564	5564	1.33074	5.02675
+TCONS_00000110	2241	2241	0	0
+TCONS_00000111	722	722	0	0
+TCONS_00000112	1671	1671	1.30241	1.33538
+TCONS_00000113	4460	4460	0.66837	2.00307
+TCONS_00000114	1704	1704	0	0
+TCONS_00000115	1561	1561	0	0
+TCONS_00000116	2709	2709	440.065	774.122
+TCONS_00000117	2763	2763	14.8261	26.6468
+TCONS_00000118	2677	2677	291.339	505.907
+TCONS_00000119	2697	2697	0	0
+TCONS_00000120	2601	2601	6.79634	11.4366
+TCONS_00000121	2598	2598	0.0455975	0.0766329
+TCONS_00000122	2571	2571	93.9943	156.177
+TCONS_00000124	8659	8659	4.02601	24.0167
+TCONS_00000125	8716	8716	0	0
+TCONS_00000126	8662	8662	1.12227	6.69713
+TCONS_00000127	8719	8719	0	0
+TCONS_00000128	8720	8720	0	0
+TCONS_00000129	2902	2902	241.562	457.892
+TCONS_00000130	2209	2209	68.179	95.8353
+TCONS_00000131	2217	2217	41.0076	57.874
+TCONS_00000132	1403	1403	14.107	11.7914
+TCONS_00000133	1817	1817	8.19158	9.24441
+TCONS_00000134	2425	2425	495.731	772.518
+TCONS_00000135	2248	2248	0	0
+TCONS_00000136	1904	1904	0.254416	0.302762
+TCONS_00000137	2845	2845	64.0217	118.776
+TCONS_00000138	1585	1585	5.07964	4.8994
+TCONS_00000140	2728	2728	2.00297	3.55035
+TCONS_00000141	2673	2673	0	0
+TCONS_00000142	1091	1091	0	0
+TCONS_00000144	1894	1894	0	0
+TCONS_00000145	2174	2174	0.483518	0.667691
+TCONS_00000146	545	545	66.9717	15.3569
+TCONS_00000147	760	760	0	0
+TCONS_00000149	956	956	0	0
+TCONS_00000151	3027	3027	111.505	221.217
+TCONS_00000152	3077	3077	0.00154959	0.00312902
+TCONS_00000154	3151	3151	3.40925	7.06252
+TCONS_00000156	3196	3196	11.6186	24.4385
+TCONS_00000157	3099	3099	0	0
+TCONS_00000158	1950	1950	1.30551	1.59605
+TCONS_00000159	1279	1279	17.4997	13.0931
+TCONS_00000160	1055	1055	12.4518	7.3446
+TCONS_00000163	2070	2070	26.5836	34.7548
+TCONS_00000164	2922	2922	46.1334	88.1003
+TCONS_00000165	4625	4625	15.2255	47.4061
+TCONS_00000166	3128	3128	15.0807	30.9957
+TCONS_00000167	2388	2388	13.3614	20.4721
+TCONS_00000168	3171	3171	0	0
+TCONS_00000169	3129	3129	93.5006	192.239
+TCONS_00000170	3557	3557	0	0
+TCONS_00000171	3426	3426	0	0
+TCONS_00000172	3137	3137	0	0
+TCONS_00000173	1293	1293	8.74938	6.63283
+TCONS_00000174	3963	3963	28.8931	76.4397
+TCONS_00000175	1412	1412	16.5231	13.916
+TCONS_00000176	1421	1421	14.7466	12.5137
+TCONS_00000177	1248	1248	123.19	89.4706
+TCONS_00000178	687	687	1575.62	519.464
+TCONS_00000179	3530	3530	17.6105	41.1998
+TCONS_00000180	1883	1883	137.568	161.667
+TCONS_00000181	2698	2698	0	0
+TCONS_00000182	1936	1936	0	0
+TCONS_00000183	1293	1293	0.880753	0.667691
+TCONS_00000184	2364	2364	0	0
+TCONS_00000185	2257	2257	8.04411	11.5801
+TCONS_00000186	2337	2337	90.7195	135.728
+TCONS_00000187	2265	2265	127.547	184.335
+TCONS_00000188	2483	2483	99.4845	159.11
+TCONS_00000189	3669	3669	655.977	1599.12
+TCONS_00000190	1363	1363	112.645	90.9698
+TCONS_00000191	1270	1270	93.2031	69.1411
+TCONS_00000192	2094	2094	16.9919	22.5031
+TCONS_00000193	722	722	1659.2	588.071
+TCONS_00000194	8441	8441	6.92569	40.247
+TCONS_00000195	5417	5417	23.9562	88.0028
+TCONS_00000196	5158	5158	0	0
+TCONS_00000197	3979	3979	0	0
+TCONS_00000198	2204	2204	486.681	682.38
+TCONS_00000199	1523	1523	4.82425	4.44162
+TCONS_00000200	3524	3524	6.9065	16.1285
+TCONS_00000201	3414	3414	25.0874	56.6347
+TCONS_00000202	6251	6251	8.38518	35.7466
+TCONS_00000203	6278	6278	39.5786	169.482
+TCONS_00000204	6336	6336	0	0
+TCONS_00000205	1476	1476	30.8664	27.3927
+TCONS_00000206	902	902	6554.32	3157.08
+TCONS_00000207	842	842	29.254	12.8502
+TCONS_00000208	960	960	2449.31	1280.21
+TCONS_00000209	2323	2323	17.5192	26.0377
+TCONS_00000210	2400	2400	30.7869	47.4324
+TCONS_00000211	1756	1756	8.58788	9.3213
+TCONS_00000214	9113	9113	81.9967	515.457
+TCONS_00000215	3115	3115	24.6116	50.3584
+TCONS_00000216	2961	2961	54.3105	105.214
+TCONS_00000217	1460	1460	178.52	156.41
+TCONS_00000218	1536	1536	29.2565	27.205
+TCONS_00000219	3848	3848	173.365	444.561
+TCONS_00000220	3735	3735	220.29	547.294
+TCONS_00000221	5410	5410	267.299	980.599
+TCONS_00000222	5336	5336	139.07	502.911
+TCONS_00000223	5482	5482	23.0065	85.5712
+TCONS_00000224	3780	3780	40.3336	101.489
+TCONS_00000225	654	654	231.02	70.7752
+TCONS_00000227	5515	5515	1138.01	4259.29
+TCONS_00000228	5902	5902	23.759	95.4244
+TCONS_00000229	5548	5548	0	0
+TCONS_00000230	5400	5400	4.24728	15.5513
+TCONS_00000231	1035	1035	21.7232	12.5061
+TCONS_00000232	2038	2038	20.7482	26.6564
+TCONS_00000233	1574	1574	0	0
+TCONS_00000234	7662	7662	192.279	1011.49
+TCONS_00000235	10579	10579	369.887	2708.57
+TCONS_00000236	10667	10667	2.13723	15.7832
+TCONS_00000237	8667	8667	5.85708	34.9728
+TCONS_00000240	8703	8703	90.7981	544.469
+TCONS_00000241	1936	1936	7018.51	8511
+TCONS_00000243	1870	1870	481.64	561.589
+TCONS_00000244	2051	2051	0	0
+TCONS_00000245	1235	1235	99.4435	71.3098
+TCONS_00000246	1467	1467	0	0
+TCONS_00000247	1400	1400	11.7569	9.80209
+TCONS_00000248	1427	1427	135.998	115.982
+TCONS_00000249	1184	1184	24.3266	16.5673
+TCONS_00000250	309	309	99.0756	6.19835
+TCONS_00000251	1132	1132	5.2482	3.38128
+TCONS_00000252	1125	1125	8.71805	5.57368
+TCONS_00000253	1924	1924	615.762	741.48
+TCONS_00000256	1795	1795	3.47386	3.86631
+TCONS_00000258	4216	4216	2806.14	7925.84
+TCONS_00000259	4052	4052	49.9152	135.197
+TCONS_00000260	2237	2237	0.936822	1.33538
+TCONS_00000261	3653	3653	320.299	777.192
+TCONS_00000262	759	759	17.5449	6.67737
+TCONS_00000263	5213	5213	60.5395	213.661
+TCONS_00000264	2837	2837	0	0
+TCONS_00000265	2933	2933	19.7517	37.8731
+TCONS_00000266	781	781	156.742	62.092
+TCONS_00000267	3319	3319	158.063	346.213
+TCONS_00000268	2947	2947	52.4475	101.085
+TCONS_00000269	2822	2822	81.3674	149.634
+TCONS_00000270	2918	2918	0	0
+TCONS_00000271	2688	2688	95.0734	165.833
+TCONS_00000272	1547	1547	29.5516	27.7092
+TCONS_00000273	1773	1773	324.287	355.879
+TCONS_00000274	3728	3728	227.009	562.863
+TCONS_00000275	1279	1279	193.737	144.953
+TCONS_00000276	1258	1258	32.0848	23.5294
+TCONS_00000277	1182	1182	1129.46	767.608
+TCONS_00000278	1161	1161	205.154	136.381
+TCONS_00000279	1126	1126	18.5276	11.8583
+TCONS_00000280	726	726	3.73785	1.33538
+TCONS_00000281	2663	2663	2.06969	3.5735
+TCONS_00000282	1738	1738	1.37483	1.47475
+TCONS_00000283	1202	1202	1.00187	0.695061
+TCONS_00000284	1077	1077	6.40095	3.87509
+TCONS_00000285	1041	1041	9.42449	5.46568
+TCONS_00000286	1194	1194	29.7678	20.4833
+TCONS_00000287	5643	5643	332.903	1276.1
+TCONS_00000288	5627	5627	6.62842	25.3334
+TCONS_00000290	837	837	15.5261	6.76515
+TCONS_00000291	957	957	0	0
+TCONS_00000292	660	660	0	0
+TCONS_00000293	467	467	0	0
+TCONS_00000295	934	934	0	0
+TCONS_00000296	3003	3003	919.86	1809.32
+TCONS_00000297	3144	3144	3.61408	7.46896
+TCONS_00000298	4676	4676	748.539	2357.64
+TCONS_00000299	4531	4531	171.017	521.114
+TCONS_00000300	1588	1588	1282.01	1239.23
+TCONS_00000301	3684	3684	391.988	959.732
+TCONS_00000302	3593	3593	17.814	42.4693
+TCONS_00000303	2359	2359	0.275802	0.416926
+TCONS_00000304	2151	2151	11.0315	15.054
+TCONS_00000305	3674	3674	18.8435	46.0028
+TCONS_00000306	3574	3574	10.7311	25.4393
+TCONS_00000307	3561	3561	3.53674e-4	8.35172e-4
+TCONS_00000308	16326	16326	0	0
+TCONS_00000309	16251	16251	79.9709	906.263
+TCONS_00000310	13946	13946	73.4533	712.712
+TCONS_00000311	4062	4062	0	0
+TCONS_00000312	5671	5671	17.2952	66.6391
+TCONS_00000313	4219	4219	5.77674	16.3284
+TCONS_00000314	152	152	598.194	0.668656
+TCONS_00000315	1574	1574	1.39576	1.33538
+TCONS_00000316	3832	3832	2.27658	5.81211
+TCONS_00000317	4049	4049	8.95431	24.234
+TCONS_00000318	897	897	1.39642	0.667691
+TCONS_00000319	1018	1018	1.18451	0.667691
+TCONS_00000320	1783	1783	0	0
+TCONS_00000321	1606	1606	0	0
+TCONS_00000325	1855	1855	0	0
+TCONS_00000326	1863	1863	0	0
+TCONS_00000330	1863	1863	0	0
+TCONS_00000331	1557	1557	0	0
+TCONS_00000333	2804	2804	799.02	1459.23
+TCONS_00000334	2810	2810	922.2	1688.1
+TCONS_00000335	2699	2699	3.52794	6.1811
+TCONS_00000339	2700	2700	24.4573	42.8675
+TCONS_00000340	7456	7456	9.41927	48.1789
+TCONS_00000341	7955	7955	19.5836	107.077
+TCONS_00000342	2129	2129	1.67704	2.26247
+TCONS_00000343	2020	2020	0	0
+TCONS_00000344	6272	6272	101.184	432.858
+TCONS_00000345	2301	2301	0	0
+TCONS_00000347	4052	4052	0.885387	2.39809
+TCONS_00000348	3905	3905	53.6921	139.847
+TCONS_00000349	3833	3833	0	0
+TCONS_00000350	6021	6021	8.38885	34.3983
+TCONS_00000351	3842	3842	16.7104	42.7798
+TCONS_00000352	3643	3643	0.00387759	0.0093814
+TCONS_00000353	3653	3653	0	0
+TCONS_00000354	3393	3393	72.5057	162.605
+TCONS_00000355	4528	4528	6.86848	20.9147
+TCONS_00000356	2015	2015	20.2796	25.7247
+TCONS_00000357	1942	1942	27.966	34.0316
+TCONS_00000358	1879	1879	23.8225	27.9284
+TCONS_00000359	1911	1911	33.2716	39.7587
+TCONS_00000360	1984	1984	124.867	155.658
+TCONS_00000361	5090	5090	5.47619	18.8508
+TCONS_00000362	3506	3506	1.3734	3.18976
+TCONS_00000365	1378	1378	0.913746	0.74761
+TCONS_00000367	2419	2419	453.262	704.414
+TCONS_00000368	899	899	0	0
+TCONS_00000369	753	753	0	0
+TCONS_00000371	922	922	1.34697	0.667851
+TCONS_00000372	2314	2314	35.0507	51.8706
+TCONS_00000373	6023	6023	92.1784	378.106
+TCONS_00000374	5838	5838	38.1138	151.354
+TCONS_00000375	2927	2927	1.16646	2.23169
+TCONS_00000376	1462	1462	2.56813	2.2537
+TCONS_00000377	1759	1759	273.927	297.902
+TCONS_00000379	1853	1853	295.929	341.495
+TCONS_00000380	2770	2770	327.504	590.239
+TCONS_00000381	4120	4120	790.835	2180.01
+TCONS_00000382	3070	3070	10.9386	22.0338
+TCONS_00000383	1741	1741	0	0
+TCONS_00000384	1518	1518	26.9362	24.7046
+TCONS_00000385	3493	3493	18.9042	43.7319
+TCONS_00000386	3349	3349	862.515	1907.49
+TCONS_00000388	1524	1524	18.0444	16.626
+TCONS_00000389	2792	2792	37.0068	67.2704
+TCONS_00000390	12227	12227	255.807	2171.22
+TCONS_00000391	11900	11900	121.154	1000.32
+TCONS_00000393	3059	3059	0	0
+TCONS_00000395	2532	2532	4.4770200000000004	7.31538
+TCONS_00000396	2406	2406	10.7721	16.6419
+TCONS_00000397	2535	2535	1.26881	2.0759
+TCONS_00000398	903	903	0	0
+TCONS_00000399	1097	1097	6.95428	4.3084
+TCONS_00000401	2128	2128	42.2014	56.9035
+TCONS_00000402	1498	1498	0	0
+TCONS_00000403	3583	3583	564.628	1342.11
+TCONS_00000404	3580	3580	573.979	1363.11
+TCONS_00000405	3633	3633	292.947	706.682
+TCONS_00000406	1342	1342	0	0
+TCONS_00000407	2079	2079	526.257	691.366
+TCONS_00000408	2003	2003	27.842	35.0814
+TCONS_00000409	2001	2001	0	0
+TCONS_00000410	2415	2415	13.2309	20.5247
+TCONS_00000411	1397	1397	5.64704	4.69614
+TCONS_00000412	1586	1586	3.9022	3.76649
+TCONS_00000413	2635	2635	3.57446	6.10087
+TCONS_00000414	1403	1403	6.47536	5.41246
+TCONS_00000415	1748	1748	0	0
+TCONS_00000416	2736	2736	0	0
+TCONS_00000417	2413	2413	50.8967	78.8827
+TCONS_00000418	2026	2026	25.8646	33.0103
+TCONS_00000419	1668	1668	7.71415	7.89306
+TCONS_00000420	6656	6656	445.797	2028.1
+TCONS_00000421	2614	2614	29.9508	50.6754
+TCONS_00000422	6137	6137	109.897	459.644
+TCONS_00000423	2424	2424	66.8221	104.084
+TCONS_00000424	3847	3847	1.56229	4.00509
+TCONS_00000425	2600	2600	0	0
+TCONS_00000427	2455	2455	0	0
+TCONS_00000428	2086	2086	8.02138e-4	0.00105777
+TCONS_00000429	3186	3186	7.32565	15.3569
+TCONS_00000430	1551	1551	0	0
+TCONS_00000431	2265	2265	3.23397	4.67384
+TCONS_00000432	2347	2347	0	0
+TCONS_00000433	3667	3667	63.1812	153.932
+TCONS_00000434	4493	4493	64.4296	194.596
+TCONS_00000435	4260	4260	0	0
+TCONS_00000436	4245	4245	471.983	1342.77
+TCONS_00000437	2011	2011	2.56737	3.24944
+TCONS_00000438	4599	4599	26.1816	81.0376
+TCONS_00000439	3481	3481	0	0
+TCONS_00000440	3691	3691	0	0
+TCONS_00000441	3075	3075	6.41233	12.9391
+TCONS_00000442	2261	2261	42.5065	61.3115
+TCONS_00000443	1859	1859	19.0239	22.0338
+TCONS_00000444	1943	1943	403.63	491.459
+TCONS_00000445	1884	1884	2.80624	3.29983
+TCONS_00000446	1111	1111	13.7902	8.67998
+TCONS_00000447	5055	5055	229.754	785.202
+TCONS_00000448	4093	4093	18.7817	51.4149
+TCONS_00000449	2259	2259	0	0
+TCONS_00000450	2253	2253	0	0
+TCONS_00000451	6052	6052	1.78164	7.3446
+TCONS_00000452	2272	2272	975.859	1415.17
+TCONS_00000453	1884	1884	211.245	248.4
+TCONS_00000454	1642	1642	0	0
+TCONS_00000455	2254	2254	29.0774	41.7975
+TCONS_00000456	1611	1611	29.5477	29.0423
+TCONS_00000457	1740	1740	50.8958	54.6667
+TCONS_00000458	2298	2298	22.0813	32.4277
+TCONS_00000459	2589	2589	668.267	1118.86
+TCONS_00000460	2025	2025	140.67	179.435
+TCONS_00000461	2054	2054	0	0
+TCONS_00000462	2088	2088	0	0
+TCONS_00000463	2021	2021	28.5763	36.3702
+TCONS_00000464	1983	1983	19.8291	24.7046
+TCONS_00000465	6506	6506	168.3	747.814
+TCONS_00000466	2793	2793	0	0
+TCONS_00000467	2581	2581	0	0
+TCONS_00000468	1893	1893	1.69429	2.00307
+TCONS_00000469	2719	2719	0	0
+TCONS_00000470	2971	2971	15.1098	29.3784
+TCONS_00000471	3743	3743	9.61778	23.949
+TCONS_00000472	4475	4475	7.89476	23.744
+TCONS_00000473	4419	4419	0	0
+TCONS_00000474	2908	2908	1.25478	2.38382
+TCONS_00000476	2581	2581	46.0167	76.7845
+TCONS_00000477	957	957	114.155	59.4245
+TCONS_00000478	1078	1078	0	0
+TCONS_00000479	787	787	0	0
+TCONS_00000480	2659	2659	312.15	538.072
+TCONS_00000481	1658	1658	109.82	111.591
+TCONS_00000482	2437	2437	8.94923	14.0219
+TCONS_00000483	105	105	4463.09	0.667691
+TCONS_00000484	3765	3765	0	0
+TCONS_00000485	4294	4294	30.1262	86.7515
+TCONS_00000486	3729	3729	2.73471	6.78258
+TCONS_00000487	3555	3555	31.8895	75.1691
+TCONS_00000488	2595	2595	4828.38	8104.53
+TCONS_00000489	2554	2554	63.3631	104.52
+TCONS_00000490	2430	2430	46.4369	72.5287
+TCONS_00000491	2314	2314	106.566	157.704
+TCONS_00000492	2557	2557	0	0
+TCONS_00000493	4012	4012	19.3799	51.943
+TCONS_00000494	987	987	10.9134	5.91255
+TCONS_00000495	1001	1001	0	0
+TCONS_00000498	1100	1100	0	0
+TCONS_00000499	1036	1036	447.128	257.729
+TCONS_00000501	1512	1512	13.8912	12.6814
+TCONS_00000502	2293	2293	41.4162	60.6758
+TCONS_00000503	2167	2167	57.8233	79.5621
+TCONS_00000504	2094	2094	1585.92	2100.3
+TCONS_00000505	2302	2302	7.16606	10.5441
+TCONS_00000506	2343	2343	10.9306	16.3999
+TCONS_00000507	8992	8992	6.76406	41.9424
+TCONS_00000508	8704	8704	170.816	1024.41
+TCONS_00000509	8368	8368	95.8222	551.902
+TCONS_00000510	2160	2160	34.7413	47.6305
+TCONS_00000511	1844	1844	50.9272	58.4447
+TCONS_00000512	4996	4996	11.5639	39.0382
+TCONS_00000519	4032	4032	41.8281	112.701
+TCONS_00000520	4868	4868	57.9142	190.27
+TCONS_00000521	4865	4865	172.5	566.362
+TCONS_00000522	4629	4629	0	0
+TCONS_00000523	3565	3565	9.03718	21.3661
+TCONS_00000524	3035	3035	3270.03	6505.97
+TCONS_00000525	3107	3107	821.993	1677.25
+TCONS_00000526	887	887	0	0
+TCONS_00000527	2815	2815	4.36875	8.01248
+TCONS_00000528	2178	2178	0.965061	1.33538
+TCONS_00000529	1779	1779	0	0
+TCONS_00000530	1625	1625	0	0
+TCONS_00000531	607	607	6796.7	1856.41
+TCONS_00000532	604	604	2376.22	643.987
+TCONS_00000533	594	594	68660.9	18122.6
+TCONS_00000534	1975	1975	225.252	279.362
+TCONS_00000535	4942	4942	559.003	1865.78
+TCONS_00000536	1620	1620	1297.85	1283.91
+TCONS_00000537	1576	1576	25.1492	24.096800000000002
+TCONS_00000538	1686	1686	0	0
+TCONS_00000539	1728	1728	310.989	331.392
+TCONS_00000540	1622	1622	805.497	797.984
+TCONS_00000541	1590	1590	1747.45	1691.62
+TCONS_00000542	2412	2412	1205.09	1866.86
+TCONS_00000544	2799	2799	26.7396	48.7391
+TCONS_00000545	2699	2699	0.00132746	0.00232577
+TCONS_00000546	2512	2512	0	0
+TCONS_00000547	1814	1814	1.18978	1.34017
+TCONS_00000548	1732	1732	57.1381	61.0484
+TCONS_00000549	5425	5425	90.153	331.686
+TCONS_00000550	5535	5535	3.35949	12.6213
+TCONS_00000551	2736	2736	7.09368	12.614
+TCONS_00000552	1697	1697	130.808	136.523
+TCONS_00000553	1413	1413	0	0
+TCONS_00000554	1269	1269	16.6931	12.3717
+TCONS_00000555	1271	1271	0	0
+TCONS_00000556	1097	1097	0	0
+TCONS_00000557	3953	3953	2.27748	6.00922
+TCONS_00000558	3933	3933	863.129	2265.19
+TCONS_00000559	3969	3969	0	0
+TCONS_00000560	2393	2393	44.7208	68.6787
+TCONS_00000561	2510	2510	769.696	1245.7
+TCONS_00000562	1489	1489	60.5994	54.3365
+TCONS_00003803	842	842	278.207	122.206
+TCONS_00003804	2411	2411	0	0
+TCONS_00003807	1745	1745	0	0
+TCONS_00003808	1745	1745	3.57053	3.8477
+TCONS_00003809	1768	1768	131.595	143.949
+TCONS_00003810	1636	1636	9.85097	9.85659
+TCONS_00003812	3181	3181	11.7119	24.5104
+TCONS_00003813	3517	3517	51.6629	120.391
+TCONS_00003814	1189	1189	4.5329	3.10309
+TCONS_00003816	1134	1134	11.4206	7.37417
+TCONS_00003817	1097	1097	0.0179845	0.011142
+TCONS_00003818	717	717	194.107	68.1115
+TCONS_00003819	1577	1577	91.1326	87.3835
+TCONS_00003820	1148	1148	34.3034	22.4888
+TCONS_00003821	1022	1022	234.799	133.016
+TCONS_00003822	806	806	44.1181	18.2567
+TCONS_00003824	1129	1129	9.35791	6.00922
+TCONS_00003825	2373	2373	2.41348	3.6723
+TCONS_00003826	1390	1390	642.52	531.148
+TCONS_00003827	937	937	0	0
+TCONS_00003828	4272	4272	15.4828	44.3435
+TCONS_00003829	4295	4295	317.299	913.919
+TCONS_00003830	4812	4812	180.34	585.347
+TCONS_00003831	78	78	1377990	4.67384
+TCONS_00003833	78	78	1377990	4.67384
+TCONS_00003835	683	683	548.794	179.38
+TCONS_00003836	1317	1317	239.489	185.618
+TCONS_00003837	1316	1316	25.0055	19.363
+TCONS_00003838	1704	1704	2.54688	2.67076
+TCONS_00003839	496	496	0	0
+TCONS_00003840	436	436	8.77096	1.33538
+TCONS_00003841	4282	4282	97.1336	278.882
+TCONS_00003842	2799	2799	567.353	1034.13
+TCONS_00003843	2814	2814	1211.84	2221.71
+TCONS_00003844	896	896	101.407	48.4156
+TCONS_00003845	1214	1214	8.47086	5.9486
+TCONS_00003846	3040	3040	1.03541	2.06369
+TCONS_00003847	962	962	22.8582	11.9799
+TCONS_00003848	1040	1040	4.67735	2.70929
+TCONS_00003849	1870	1870	0	0
+TCONS_00003850	1750	1750	34.9971	37.8375
+TCONS_00003851	1741	1741	6.44643	6.92861
+TCONS_00003852	2741	2741	13.8289	24.6394
+TCONS_00003853	1979	1979	110.321	137.135
+TCONS_00003854	2373	2373	4.30905	6.55657
+TCONS_00003855	2276	2276	37.9034	55.0739
+TCONS_00003856	2704	2704	6.60276	11.5917
+TCONS_00003857	2104	2104	0	0
+TCONS_00003858	3532	3532	5.4193	12.6861
+TCONS_00003859	1062	1062	0	0
+TCONS_00003860	1178	1178	0	0
+TCONS_00003861	1199	1199	34.7535	24.0369
+TCONS_00003862	988	988	0	0
+TCONS_00003863	1067	1067	0	0
+TCONS_00003864	1700	1700	0.638442	0.667691
+TCONS_00003865	3539	3539	101.228	237.466
+TCONS_00003866	2021	2021	1529.33	1946.44
+TCONS_00003867	2137	2137	33.2717	45.0746
+TCONS_00003869	2153	2153	0	0
+TCONS_00003870	771	771	250.811	97.5835
+TCONS_00003871	1036	1036	32.4342	18.6953
+TCONS_00003872	2262	2262	13.0385	18.816
+TCONS_00003873	2379	2379	29.7214	45.3495
+TCONS_00003874	2306	2306	0	0
+TCONS_00003875	2258	2258	664.648	957.282
+TCONS_00003876	2387	2387	33.5246	51.3422
+TCONS_00003877	2127	2127	15.5895	21.0096
+TCONS_00003878	2380	2380	24.8518	37.9371
+TCONS_00003879	3517	3517	34.6694	80.7906
+TCONS_00003880	3211	3211	171.766	363.112
+TCONS_00003881	5325	5325	119.365	430.722
+TCONS_00003882	3759	3759	143.984	360.162
+TCONS_00003883	1946	1946	129.018	157.366
+TCONS_00003884	2880	2880	85.1209	160.027
+TCONS_00003885	2135	2135	1573.93	2130.05
+TCONS_00003886	2608	2608	44.7784	75.5729
+TCONS_00003887	2510	2510	36.1981	58.584
+TCONS_00003888	1832	1832	14.2929	16.2815
+TCONS_00003891	1918	1918	89.019	106.816
+TCONS_00003892	2069	2069	3.96502	5.18098
+TCONS_00003893	2242	2242	77.1676	110.27
+TCONS_00003894	1570	1570	43.2744	41.2799
+TCONS_00003895	1104	1104	385.416	240.685
+TCONS_00003896	2483	2483	135.317	216.418
+TCONS_00003897	2182	2182	294.499	408.34
+TCONS_00003898	2193	2193	27.9163	38.9246
+TCONS_00003899	2923	2923	653.742	1248.91
+TCONS_00003900	4402	4402	185.142	547.272
+TCONS_00003901	2005	2005	0	0
+TCONS_00003902	1987	1987	14.8233	18.5099
+TCONS_00003903	1996	1996	37.794	47.434
+TCONS_00003904	2299	2299	70.0963	102.99
+TCONS_00003905	2728	2728	21.8431	38.7179
+TCONS_00003906	781	781	1686.92	668.257
+TCONS_00003907	813	813	228.324	95.6137
+TCONS_00003908	909	909	730.45	355.458
+TCONS_00003909	990	990	986.496	536.545
+TCONS_00003910	2914	2914	15.015	28.589
+TCONS_00003911	4362	4362	108.402	317.366
+TCONS_00003912	2868	2868	134.998	252.651
+TCONS_00003913	5269	5269	353.551	1261.78
+TCONS_00003914	3115	3115	462.693	946.728
+TCONS_00003915	3129	3129	100.345	206.312
+TCONS_00003916	3839	3839	126.807	324.365
+TCONS_00003917	732	732	4766.04	1722.93
+TCONS_00003918	1148	1148	84.3515	55.2997
+TCONS_00003919	1456	1456	0.0032772	0.00286205
+TCONS_00003920	1475	1475	74.6134	66.1637
+TCONS_00003921	2016	2016	6.26152	7.94715
+TCONS_00003922	1116	1116	63.2919	40.0615
+TCONS_00003923	1302	1302	3288.48	2513.89
+TCONS_00003924	1497	1497	14.6336	13.204
+TCONS_00003925	2970	2970	251.525	488.869
+TCONS_00003926	1629	1629	224.556	223.573
+TCONS_00003927	2053	2053	50.9762	66.0326
+TCONS_00003928	1877	1877	211.301	247.421
+TCONS_00003929	2452	2452	0	0
+TCONS_00003932	2431	2431	5.77119	9.01797
+TCONS_00003934	2499	2499	108.302	174.438
+TCONS_00003935	262	262	1463.07	43.1053
+TCONS_00003936	335	335	308.081	24.9271
+TCONS_00003937	2236	2236	12.7174	18.1188
+TCONS_00003938	5141	5141	277.374	964.81
+TCONS_00003939	6420	6420	93.5897	410.161
+TCONS_00003940	6002	6002	22.189	90.6876
+TCONS_00003941	5915	5915	227.158	914.435
+TCONS_00003942	1231	1231	141.955	101.393
+TCONS_00003943	2279	2279	41.3696	60.198
+TCONS_00003944	1777	1777	100.762	110.864
+TCONS_00003945	1557	1557	140.87	133.083
+TCONS_00003946	1504	1504	89.5491	81.2438
+TCONS_00003947	2595	2595	286.157	480.32
+TCONS_00003948	2625	2625	643.906	1094.47
+TCONS_00003949	1966	1966	134.03	165.374
+TCONS_00003950	1920	1920	0	0
+TCONS_00003951	1277	1277	36.1157	26.9705
+TCONS_00003952	1108	1108	31.7757	19.9332
+TCONS_00003953	1120	1120	2.06326	1.3118
+TCONS_00003954	1150	1150	22.611	14.8554
+TCONS_00003955	887	887	20.6379	9.72203
+TCONS_00003956	704	704	11.4358	3.9077
+TCONS_00003957	734	734	0	0
+TCONS_00003958	657	657	0	0
+TCONS_00003959	2149	2149	133.768	182.357
+TCONS_00003961	3841	3841	369.77	946.374
+TCONS_00003962	1430	1430	298.518	255.216
+TCONS_00003963	3021	3021	22.3949	44.3346
+TCONS_00003964	3127	3127	0	0
+TCONS_00003965	3228	3228	600.882	1277.48
+TCONS_00003966	3152	3152	311.239	644.974
+TCONS_00003967	3646	3646	94.5147	228.868
+TCONS_00003968	1431	1431	216.204	184.995
+TCONS_00003969	3127	3127	4654.8	9563.79
+TCONS_00003970	2981	2981	3.19151	6.22791
+TCONS_00003971	1118	1118	221.053	140.231
+TCONS_00003972	958	958	70.419	36.7072
+TCONS_00003973	2097	2097	2.32425	3.08304
+TCONS_00003974	2755	2755	0.887906	1.5908
+TCONS_00003975	4710	4710	1.05187	3.33831
+TCONS_00003976	2572	2572	0	0
+TCONS_00003977	2145	2145	1.06305e-4	1.44617e-4
+TCONS_00003978	1954	1954	7.62842	9.34767
+TCONS_00003979	1253	1253	21.6946	15.833
+TCONS_00003980	2347	2347	75.316	113.215
+TCONS_00003981	2216	2216	0	0
+TCONS_00003982	2266	2266	21.6975	31.3733
+TCONS_00003983	728	728	1798.76	645.168
+TCONS_00003984	1641	1641	33.1709	33.3071
+TCONS_00003985	1826	1826	0	0
+TCONS_00003986	2248	2248	860.461	1233.23
+TCONS_00003987	1345	1345	63.5892	50.544
+TCONS_00003988	1530	1530	5.34965	4.95182
+TCONS_00003989	2072	2072	10.2022	13.3525
+TCONS_00003990	2012	2012	479.585	607.336
+TCONS_00003991	2642	2642	353.008	604.26
+TCONS_00003993	1305	1305	3.48402	2.67076
+TCONS_00003995	2209	2209	0.949827	1.33512
+TCONS_00003996	2303	2303	1.78559e-4	2.62856e-4
+TCONS_00003997	3322	3322	0	0
+TCONS_00003998	2754	2754	0	0
+TCONS_00003999	2902	2902	11.393	21.5959
+TCONS_00004000	2222	2222	0	0
+TCONS_00004001	620	620	0	0
+TCONS_00004002	6472	6472	39.559	174.823
+TCONS_00004003	7432	7432	170.351	868.444
+TCONS_00004004	1698	1698	366.357	382.623
+TCONS_00004005	2041	2041	215.564	277.404
+TCONS_00004006	5724	5724	72.2483	281.083
+TCONS_00004007	3322	3322	12.3237	27.0192
+TCONS_00004008	6356	6356	435.737	1889.92
+TCONS_00004009	2648	2648	1413.21	2425.05
+TCONS_00004010	6458	6458	20.0393	88.3613
+TCONS_00004011	5892	5892	114.092	457.428
+TCONS_00004012	2208	2208	63.4796	89.1848
+TCONS_00004013	1660	1660	535.353	544.741
+TCONS_00004014	2505	2505	14.9431	24.1315
+TCONS_00004015	847	847	0	0
+TCONS_00004016	5002	5002	147.254	497.735
+TCONS_00004017	4370	4370	33.3677	97.8783
+TCONS_00004018	3630	3630	12.0984	29.1596
+TCONS_00004020	2773	2773	7.10227	12.815
+TCONS_00004021	1349	1349	10.9532	8.7371200000000009
+TCONS_00004022	6343	6343	3.33866	14.4501
+TCONS_00004023	7735	7735	0	0
+TCONS_00004024	9646	9646	10.9131	72.715
+TCONS_00004025	3491	3491	4.61506	10.6697
+TCONS_00004026	2198	2198	6.91298	9.66343
+TCONS_00004027	2084	2084	4565.03	6013.41
+TCONS_00004028	2067	2067	54.0791	70.5872
+TCONS_00004029	4813	4813	1246.08	4045.4
+TCONS_00004030	4920	4920	160.025	531.625
+TCONS_00004031	2710	2710	156.502	275.414
+TCONS_00004032	2632	2632	90.2876	153.911
+TCONS_00004033	1413	1413	1649.47	1390.38
+TCONS_00004034	1429	1429	0	0
+TCONS_00004035	1624	1624	117.878	116.945
+TCONS_00004036	1294	1294	897.561	681.068
+TCONS_00004037	1804	1804	1015.39	1136.56
+TCONS_00004038	1877	1877	9.06258	10.6117
+TCONS_00004039	1802	1802	148.621	166.147
+TCONS_00004040	1200	1200	0	0
+TCONS_00004041	4259	4259	7.25024	20.6984
+TCONS_00004042	1066	1066	0	0
+TCONS_00004043	1559	1559	0	0
+TCONS_00004044	1448	1448	39.5195	34.2897
+TCONS_00004046	1615	1615	168.831	166.42
+TCONS_00004048	1480	1480	0	0
+TCONS_00004049	1642	1642	11.3945	11.4493
+TCONS_00004051	894	894	84.5086	40.2281
+TCONS_00004052	3694	3694	38.2061	93.8129
+TCONS_00004053	5038	5038	28.3954	96.7022
+TCONS_00004054	4725	4725	47.4503	151.095
+TCONS_00004055	4698	4698	61.6005	194.978
+TCONS_00004056	4715	4715	34.3738	109.213
+TCONS_00004058	4643	4643	0	0
+TCONS_00004059	4783	4783	13.8034	44.5201
+TCONS_00004060	4761	4761	59.2999	190.337
+TCONS_00004061	5221	5221	0	0
+TCONS_00004062	4528	4528	5.84589	17.8009
+TCONS_00004063	1548	1548	67.1539	63.0145
+TCONS_00004064	2832	2832	215.563	397.944
+TCONS_00004065	2864	2864	0	0
+TCONS_00004066	6318	6318	76.6261	330.292
+TCONS_00004067	3475	3475	160.545	369.354
+TCONS_00004068	4486	4486	147.948	446.112
+TCONS_00004069	1357	1357	0	0
+TCONS_00004070	3293	3293	1381.76	3001.14
+TCONS_00004071	3137	3137	35.9037	74.0218
+TCONS_00004072	3219	3219	17.589	37.2824
+TCONS_00004074	643	643	0	0
+TCONS_00004075	647	647	0	0
+TCONS_00004076	1883	1883	0	0
+TCONS_00004077	3128	3128	497.354	1022.22
+TCONS_00004078	2156	2156	23.436	32.0646
+TCONS_00004079	6306	6306	378.897	1630
+TCONS_00004080	8192	8192	26.2619	147.992
+TCONS_00004081	8007	8007	636.017	3500.92
+TCONS_00004082	2592	2592	0	0
+TCONS_00004083	584	584	0	0
+TCONS_00004084	2710	2710	5.98779	10.5374
+TCONS_00004085	2267	2267	214.36	310.103
+TCONS_00004086	1812	1812	30626.9	34455
+TCONS_00004087	1801	1801	9684.53	10819.7
+TCONS_00004088	1753	1753	68.3653	74.0588
+TCONS_00004089	1683	1683	3401.14	3516.09
+TCONS_00004090	1644	1644	6.65942	6.70087
+TCONS_00004091	1453	1453	11038.9	9617.1
+TCONS_00004092	1448	1448	4.81468	4.17754
+TCONS_00004093	1276	1276	216.853	161.788
+TCONS_00004094	1539	1539	0.716409	0.667691
+TCONS_00004095	2012	2012	3.29853e-4	4.17719e-4
+TCONS_00004096	1942	1942	2.1944	2.67035
+TCONS_00004097	2436	2436	0	0
+TCONS_00004098	2398	2398	0	0
+TCONS_00004099	2411	2411	0	0
+TCONS_00004100	920	920	0	0
+TCONS_00004101	1279	1279	0	0
+TCONS_00004102	1153	1153	4.27731	2.81926
+TCONS_00004103	958	958	44.3782	23.1329
+TCONS_00004104	2913	2913	1.48879	2.83364
+TCONS_00004105	2396	2396	8.20045	12.611
+TCONS_00004106	3934	3934	245.446	644.322
+TCONS_00004107	1822	1822	1.17967	1.33545
+TCONS_00004108	951	951	226.306	116.846
+TCONS_00004109	2235	2235	122.899	175.011
+TCONS_00004110	5191	5191	0	0
+TCONS_00004111	5161	5161	1064.1	3716.39
+TCONS_00004112	5134	5134	518.985	1802.66
+TCONS_00004113	2995	2995	203.036	398.212
+TCONS_00004114	2961	2961	449.64	871.068
+TCONS_00004115	1345	1345	0	0
+TCONS_00004116	1500	1500	196.868	178.053
+TCONS_00004117	1440	1440	10.3258	8.90091
+TCONS_00004118	1383	1383	0	0
+TCONS_00004119	2036	2036	828.687	1063.49
+TCONS_00004120	3391	3391	266.694	597.725
+TCONS_00004121	7931	7931	29.3782	160.133
+TCONS_00004122	4405	4405	35.797	105.89
+TCONS_00004123	3250	3250	48.9202	104.766
+TCONS_00004124	2267	2267	0.771137	1.11556
+TCONS_00004125	2262	2262	1.85004	2.66981
+TCONS_00004126	2238	2238	0	0
+TCONS_00004127	2316	2316	6.40787e-4	9.49189e-4
+TCONS_00004128	2443	2443	42.1422	66.2081
+TCONS_00004129	720	720	2.09752	0.74046
+TCONS_00004130	2190	2190	14.2588	19.8512
+TCONS_00004132	828	828	150.911	64.7962
+TCONS_00004133	1273	1273	5164.57	3842.2
+TCONS_00004134	2805	2805	1379.72	2520.72
+TCONS_00004135	2730	2730	7.74536	13.7399
+TCONS_00004136	2689	2689	72.5627	126.62
+TCONS_00004137	4020	4020	115.523	310.284
+TCONS_00004138	8724	8724	935.482	5623.49
+TCONS_00004139	1534	1534	1290.64	1198.31
+TCONS_00004140	1543	1543	6.13931	5.73918
+TCONS_00004141	1183	1183	2.05169	1.39582
+TCONS_00004142	1830	1830	318.371	362.216
+TCONS_00004143	1151	1151	6403.6	4211.69
+TCONS_00004144	7188	7188	85.2271	419.784
+TCONS_00004145	7105	7105	91.1537	443.626
+TCONS_00004146	1411	1411	29.6043	24.9123
+TCONS_00004148	852	852	5.9838	2.67077
+TCONS_00004149	697	697	5.9481	2.00307
+TCONS_00004150	2339	2339	619.759	928.116
+TCONS_00004151	2534	2534	118.384	193.604
+TCONS_00004152	1368	1368	370.526	300.538
+TCONS_00004153	1805	1805	318.291	356.499
+TCONS_00004154	1262	1262	15.7743	11.6127
+TCONS_00004155	1222	1222	28.8278	20.4072
+TCONS_00004156	252	252	0	0
+TCONS_00004158	1002	1002	2563.8	1416.17
+TCONS_00004160	1840	1840	0	0
+TCONS_00004162	1720	1720	0	0
+TCONS_00004163	1734	1734	0	0
+TCONS_00004164	1855	1855	0	0
+TCONS_00004165	1007	1007	323.091	179.609
+TCONS_00004169	2100	2100	0	0
+TCONS_00004170	2164	2164	0	0
+TCONS_00004172	1844	1844	0	0
+TCONS_00004173	2100	2100	0	0
+TCONS_00004175	1906	1906	8.40609	10.0154
+TCONS_00004176	6978	6978	6.3024	30.1067
+TCONS_00004177	7099	7099	0	0
+TCONS_00004178	3105	3105	4.21435	8.59329
+TCONS_00004179	4316	4316	28.5825	82.7509
+TCONS_00004180	1987	1987	171.447	214.086
+TCONS_00004181	1537	1537	140.236	130.502
+TCONS_00004182	2045	2045	19.0042	24.5098
+TCONS_00004184	1904	1904	0	0
+TCONS_00004185	1798	1798	72.0127	80.3009
+TCONS_00004186	2196	2196	119.533	166.923
+TCONS_00004187	538	538	14576.6	3270.35
+TCONS_00004188	2732	2732	60.9259	108.166
+TCONS_00004189	2749	2749	267.216	477.619
+TCONS_00004190	2564	2564	0	0
+TCONS_00004191	2770	2770	14.3455	25.854
+TCONS_00004192	2745	2745	12.1814	21.7385
+TCONS_00004193	1894	1894	3.76668	4.45583
+TCONS_00004194	1928	1928	7.15413	8.635
+TCONS_00004196	1166	1166	9.40717	6.28691
+TCONS_00004197	905	905	18.4514	8.92679
+TCONS_00004199	2892	2892	0.0104583	0.0197502
+TCONS_00004200	2877	2877	2.60762	4.89679
+TCONS_00004201	2904	2904	0	0
+TCONS_00004202	2907	2907	0	0
+TCONS_00004203	2415	2415	0.704227	1.09245
+TCONS_00004204	892	892	2.54505	1.20791
+TCONS_00004205	1700	1700	16.4022	17.1537
+TCONS_00004206	3946	3946	646.52	1702.67
+TCONS_00004207	1631	1631	4.9664	4.95167
+TCONS_00004208	2008	2008	296.452	374.581
+TCONS_00004209	1984	1984	0	0
+TCONS_00004210	3029	3029	678.675	1347.39
+TCONS_00004211	1559	1559	43.0479	40.7291
+TCONS_00004212	2474	2474	2.50886	3.99657
+TCONS_00004213	3055	3055	12.6211	25.2891
+TCONS_00004214	2975	2975	258.103	502.566
+TCONS_00004215	2963	2963	1.18674	2.30071
+TCONS_00004216	3650	3650	0	0
+TCONS_00004217	2014	2014	0	0
+TCONS_00004219	5368	5368	49.3056	179.416
+TCONS_00004220	574	574	113.84	28.4378
+TCONS_00004221	1122	1122	37.7553	24.0579
+TCONS_00004222	2482	2482	12.4297	19.8706
+TCONS_00004223	1160	1160	178.636	118.626
+TCONS_00004224	4268	4268	105.022	300.491
+TCONS_00004225	1512	1512	162.551	148.395
+TCONS_00004226	1512	1512	32.2978	29.485
+TCONS_00004227	2216	2216	8.86078	12.4989
+TCONS_00004228	2663	2663	62.2622	107.501
+TCONS_00004229	3026	3026	1.75302	3.47661
+TCONS_00004230	2696	2696	61.7647	108.083
+TCONS_00004231	1404	1404	34.5445	28.8986
+TCONS_00004232	2173	2173	114.736	158.357
+TCONS_00004233	1966	1966	35.1185	43.3312
+TCONS_00004234	2746	2746	142.58	254.543
+TCONS_00004235	1912	1912	148.245	177.254
+TCONS_00004236	2029	2029	38.8158	49.6219
+TCONS_00004237	596	596	189.458	50.2743
+TCONS_00004238	2015	2015	10.4776	13.2909
+TCONS_00004239	1171	1171	1.08752	0.730644
+TCONS_00004240	4170	4170	38.7518	108.193
+TCONS_00004241	4395	4395	2.36658	6.98379
+TCONS_00004242	359	359	423.045	41.3968
+TCONS_00004243	1100	1100	3947.4	2453.91
+TCONS_00004244	1097	1097	858.176	531.667
+TCONS_00004245	1081	1081	0	0
+TCONS_00004246	1078	1078	0	0
+TCONS_00004247	1224	1224	368.538	261.409
+TCONS_00004248	3996	3996	568.106	1516.24
+TCONS_00004249	3981	3981	457.459	1216.08
+TCONS_00004250	3694	3694	20.8169	51.1147
+TCONS_00004251	1080	1080	22.6306	13.7484
+TCONS_00004252	1639	1639	20.7477	20.8035
+TCONS_00004253	1143	1143	1668.07	1087.67
+TCONS_00004254	4362	4362	62.7363	183.671
+TCONS_00004255	4014	4014	0	0
+TCONS_00004256	1625	1625	0.615839	0.611401
+TCONS_00004258	3950	3950	3500.67	9229.22
+TCONS_00004259	4091	4091	1632.42	4466.46
+TCONS_00004260	2521	2521	0	0
+TCONS_00004261	3241	3241	162.727	347.454
+TCONS_00004262	2368	2368	7.71609	11.7134
+TCONS_00004263	3381	3381	504.189	1126.44
+TCONS_00004264	5835	5835	93.7024	371.904
+TCONS_00004265	3402	3402	14.9752	33.6796
+TCONS_00004266	941	941	103.514	52.7146
+TCONS_00004267	2535	2535	65.2408	106.741
+TCONS_00004268	2916	2916	36.2088	68.9939
+TCONS_00004269	2888	2888	190.035	358.34
+TCONS_00004270	3481	3481	703.319	1621.06
+TCONS_00004271	3477	3477	369.752	851.183
+TCONS_00004272	15880	15880	862.15	9544.13
+TCONS_00004273	3162	3162	7.06446	14.6895
+TCONS_00004274	3124	3124	200.83	412.201
+TCONS_00004275	2172	2172	0	0
+TCONS_00004276	5751	5751	4.52114	17.6759
+TCONS_00004277	2675	2675	14.6973	25.5009
+TCONS_00004278	4237	4237	451.266	1281.28
+TCONS_00004279	4234	4234	19.6246	55.6787
+TCONS_00004280	4234	4234	144.128	408.919
+TCONS_00004281	4171	4171	2.39165	6.67904
+TCONS_00004282	2314	2314	13.761	20.3646
+TCONS_00004283	2117	2117	0	0
+TCONS_00004284	1241	1241	15.7358	11.3507
+TCONS_00004285	1362	1362	702.903	567.151
+TCONS_00004286	1257	1257	0	0
+TCONS_00004287	1032	1032	2.41922	1.38762
+TCONS_00004288	1575	1575	0	0
+TCONS_00004289	2084	2084	77.8337	102.528
+TCONS_00004290	1629	1629	5122.54	5100.11
+TCONS_00004291	2049	2049	16.0239	20.7114
+TCONS_00004292	2093	2093	16.142	21.3661
+TCONS_00004293	2232	2232	0	0
+TCONS_00004294	2973	2973	48.9661	95.2754
+TCONS_00004295	2401	2401	3.69282	5.69202
+TCONS_00004296	2281	2281	0	0
+TCONS_00004297	1715	1715	8.70014	9.19098
+TCONS_00004298	1045	1045	0.0182659	0.0106448
+TCONS_00004299	1249	1249	0	0
+TCONS_00004301	922	922	0	0
+TCONS_00004302	999	999	0.00138399	7.61546e-4
+TCONS_00004303	968	968	31.5925	16.6915
+TCONS_00004304	888	888	0	0
+TCONS_00004308	1452	1452	0.767025	0.667691
+TCONS_00004309	2467	2467	0	0
+TCONS_00004310	1607	1607	6.94006	6.80174
+TCONS_00004311	2350	2350	113.467	170.804
+TCONS_00004312	2456	2456	365.058	576.885
+TCONS_00004313	2126	2126	5079.3	6841.66
+TCONS_00004314	2135	2135	0	0
+TCONS_00004315	2073	2073	0	0
+TCONS_00004316	2015	2015	13.5558	17.1956
+TCONS_00004317	1812	1812	5.74775	6.46616
+TCONS_00004318	1671	1671	0	0
+TCONS_00004319	1978	1978	0	0
+TCONS_00004320	3776	3776	61.6179	154.871
+TCONS_00004321	3773	3773	60.9828	153.145
+TCONS_00004322	3705	3705	60.0397	147.891
+TCONS_00004323	3834	3834	73.0323	186.555
+TCONS_00004324	3063	3063	144.58	290.513
+TCONS_00004325	3139	3139	53.0419	109.43
+TCONS_00004326	4775	4775	113.563	365.63
+TCONS_00004327	4317	4317	214.426	620.948
+TCONS_00004328	3921	3921	40.3181	105.469
+TCONS_00004329	3797	3797	55.7553	140.964
+TCONS_00004330	1860	1860	522.544	605.589
+TCONS_00004331	2544	2544	18.1978	29.8892
+TCONS_00004332	2537	2537	15.3445	25.127
+TCONS_00004333	927	927	141.789	70.8027
+TCONS_00004334	5160	5160	14.2089	49.6149
+TCONS_00004335	4949	4949	0	0
+TCONS_00004336	5786	5786	254.426	1001
+TCONS_00004337	5850	5850	0	0
+TCONS_00004338	6175	6175	293.607	1235.89
+TCONS_00004340	6283	6283	137.933	591.14
+TCONS_00004342	1915	1915	0	0
+TCONS_00004343	2088	2088	41.5518	54.8527
+TCONS_00004344	5241	5241	8.24683	29.2686
+TCONS_00004345	5087	5087	0	0
+TCONS_00004346	5096	5096	93.5654	322.479
+TCONS_00004347	5000	5000	3.57736	12.0868
+TCONS_00004348	5136	5136	425.45	1478.37
+TCONS_00004349	2198	2198	29.1022	40.6809
+TCONS_00004350	2326	2326	0.44885	0.668048
+TCONS_00004351	2057	2057	56.9186	73.8911
+TCONS_00004352	3348	3348	15.3114	33.8511
+TCONS_00004353	3300	3300	36.2405	78.8922
+TCONS_00004354	3333	3333	96.0602	211.355
+TCONS_00004355	3494	3494	23.2555	53.8145
+TCONS_00004356	3639	3639	54.1566	130.873
+TCONS_00004357	4462	4462	520.674	1561.17
+TCONS_00004359	4264	4264	40.118	114.673
+TCONS_00004360	4498	4498	2.51869	7.61607
+TCONS_00004361	2089	2089	4.58538	6.05642
+TCONS_00004362	2126	2126	188.206	253.508
+TCONS_00004363	2411	2411	58.1801	90.0886
+TCONS_00004364	3586	3586	176.834	420.704
+TCONS_00004365	14287	14287	730.281	7261.91
+TCONS_00004366	14290	14290	118.195	1175.58
+TCONS_00004367	846	846	0	0
+TCONS_00004368	3903	3903	64.1217	166.921
+TCONS_00004369	3883	3883	7.083e-4	0.00183383
+TCONS_00004370	510	510	0	0
+TCONS_00004371	8653	8653	107.246	639.306
+TCONS_00004372	8587	8587	350.665	2074
+TCONS_00004373	3921	3921	1.34987	3.53115
+TCONS_00004374	2834	2834	116.373	214.996
+TCONS_00004375	1637	1637	5.74673	5.75407
+TCONS_00004376	2740	2740	223.501	398.062
+TCONS_00004377	2731	2731	1127.58	2001.07
+TCONS_00004378	2565	2565	1305.74	2164.03
+TCONS_00004379	2574	2574	231.398	384.971
+TCONS_00004380	2451	2451	6.58024	10.3752
+TCONS_00004381	2617	2617	9.29533	15.747
+TCONS_00004382	2388	2388	106.963	163.887
+TCONS_00004383	4314	4314	15.9207	46.0705
+TCONS_00004384	4492	4492	0	0
+TCONS_00004385	1586	1586	1.82702	1.76348
+TCONS_00004386	540	540	1.06121	0.239589
+TCONS_00004387	738	738	0	0
+TCONS_00004388	646	646	0	0
+TCONS_00004389	2552	2552	31.6687	52.1938
+TCONS_00004390	2791	2791	78.0578	141.837
+TCONS_00004391	4088	4088	77.2774	211.274
+TCONS_00004392	4129	4129	543.731	1502.3
+TCONS_00004394	1768	1768	0	0
+TCONS_00004395	697	697	13.8243	4.65544
+TCONS_00004396	2041	2041	1.55748	2.00429
+TCONS_00004397	5192	5192	87.9633	309.141
+TCONS_00004398	1287	1287	3618.98	2728.17
+TCONS_00004399	1547	1547	170.21	159.598
+TCONS_00004400	1074	1074	58.2416	35.1355
+TCONS_00004401	1607	1607	31.5673	30.9381
+TCONS_00004402	1631	1631	4.37347	4.3605
+TCONS_00004403	1553	1553	25.0089	23.5557
+TCONS_00004404	1566	1566	410.122	390.06
+TCONS_00004405	1676	1676	37.3476	38.4249
+TCONS_00004406	1824	1824	33.4016	37.8598
+TCONS_00004408	1244	1244	6.57668	4.75791
+TCONS_00004409	934	934	13.6156	6.86636
+TCONS_00004410	1607	1607	277.546	272.014
+TCONS_00004412	1394	1394	26.0146	21.5789
+TCONS_00004413	2160	2160	11.2444	15.4161
+TCONS_00004414	1411	1411	7.51267	6.3219900000000004
+TCONS_00004415	2054	2054	8.6179	11.1694
+TCONS_00004416	2077	2077	130.669	171.48
+TCONS_00004418	953	953	13.1216	6.79351
+TCONS_00004419	1774	1774	0	0
+TCONS_00004420	2239	2239	370.852	529.151
+TCONS_00004421	1842	1842	492.533	564.54
+TCONS_00004422	2924	2924	866.093	1655.19
+TCONS_00004423	2686	2686	0.431717	0.752418
+TCONS_00004424	4859	4859	0.217532	0.713293
+TCONS_00004425	5799	5799	0.883374	3.48362
+TCONS_00004426	3940	3940	0	0
+TCONS_00004427	5094	5094	1.08287	3.73065
+TCONS_00004428	2703	2703	2.26131	3.96831
+TCONS_00004429	2798	2798	3.68503	6.71422
+TCONS_00004431	2725	2725	2.96653e-4	5.25201e-4
+TCONS_00004432	4461	4461	0	0
+TCONS_00004433	4548	4548	39.3861	120.489
+TCONS_00004434	4417	4417	29.2748	86.8454
+TCONS_00004435	4424	4424	15.5536	46.2177
+TCONS_00004436	686	686	140.56	46.2416
+TCONS_00004439	2497	2497	6.58664	10.5995
+TCONS_00004440	2827	2827	7.43093	13.6917
+TCONS_00004441	2683	2683	122.443	213.14
+TCONS_00004442	2803	2803	1.3733	2.50705
+TCONS_00004443	1653	1653	5.04101	5.10446
diff -r 000000000000 -r f3fefb6d8254 test-data/salmon_cond2_rep2.sf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/salmon_cond2_rep2.sf	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,1093 @@
+Name	Length	EffectiveLength	TPM	NumReads
+TCONS_00000001	1652	1652	0	0
+TCONS_00000002	1488	1488	0.621918	0.654207
+TCONS_00000003	1595	1595	0	0
+TCONS_00000006	78	78	835811	2.8349
+TCONS_00000007	2750	2750	400.032	715.295
+TCONS_00000008	4369	4369	321.749	943.567
+TCONS_00000009	4272	4272	0.202507	0.579991
+TCONS_00000010	937	937	0	0
+TCONS_00000012	1584	1584	100259	96630.9
+TCONS_00000013	694	694	7026.17	2351.22
+TCONS_00000015	1023	1023	33690.7	19110
+TCONS_00000016	510	510	0	0
+TCONS_00000017	854	854	0	0
+TCONS_00000018	701	701	92.5542	31.4301
+TCONS_00000019	517	517	0	0
+TCONS_00000020	1543	1543	82.8399	77.4408
+TCONS_00000021	2682	2682	29.7021	51.6823
+TCONS_00000022	3043	3043	32.1328	64.1123
+TCONS_00000023	490	490	0	0
+TCONS_00000024	2554	2554	4.23036	6.97813
+TCONS_00000025	2121	2121	0	0
+TCONS_00000026	2560	2560	200.885	332.22
+TCONS_00000027	955	955	157.065	81.5396
+TCONS_00000028	2003	2003	232.477	292.924
+TCONS_00000029	1149	1149	188.186	123.505
+TCONS_00000030	2398	2398	17.3996	26.7824
+TCONS_00000031	2554	2554	7.16309	11.8158
+TCONS_00000032	2293	2293	0	0
+TCONS_00000033	662	662	1123.84	350.655
+TCONS_00000034	7319	7319	1849.52	9281.01
+TCONS_00000035	673	673	2.45178	0.784059
+TCONS_00000036	971	971	33.0539	17.5337
+TCONS_00000037	1616	1616	1.32641	1.30841
+TCONS_00000041	2259	2259	13.599	19.596
+TCONS_00000042	2278	2278	0.00559733	0.00814088
+TCONS_00000043	2111	2111	5.89099	7.8725
+TCONS_00000044	2790	2790	267.968	486.73
+TCONS_00000045	3054	3054	2.64622	5.30039
+TCONS_00000046	2960	2960	18.508	35.8418
+TCONS_00000047	2590	2590	33.1576	55.5385
+TCONS_00000048	2684	2684	3.56635	6.21057
+TCONS_00000049	2530	2530	28.7413	46.9221
+TCONS_00000050	1239	1239	730.129	525.632
+TCONS_00000051	1181	1181	90.0279	61.1212
+TCONS_00000052	1932	1932	14.5404	17.5913
+TCONS_00000053	2192	2192	178.383	248.599
+TCONS_00000054	2558	2558	1.97961	3.27103
+TCONS_00000055	1747	1747	213.471	230.344
+TCONS_00000056	1594	1594	104.682	101.633
+TCONS_00000057	1741	1741	254.603	273.647
+TCONS_00000058	491	491	78.7253	15.0468
+TCONS_00000059	2141	2141	91.5793	124.325
+TCONS_00000060	2536	2536	447.23	732.031
+TCONS_00000061	3859	3859	62.2307	160.063
+TCONS_00000062	2432	2432	345.07	539.444
+TCONS_00000063	1939	1939	107.648	130.768
+TCONS_00000064	2667	2667	175.108	302.835
+TCONS_00000065	1170	1170	413.658	277.622
+TCONS_00000066	2611	2611	55.8828	94.4326
+TCONS_00000067	2467	2467	566.011	898.843
+TCONS_00000068	2329	2329	786.459	1172.2
+TCONS_00000069	2616	2616	23.0799	39.0827
+TCONS_00000070	1048	1048	15.6591	9.15889
+TCONS_00000071	3243	3243	0.0178632	0.0381668
+TCONS_00000072	3201	3201	73.0075	153.821
+TCONS_00000073	3231	3231	9.6167	20.4656
+TCONS_00000074	3026	3026	102.204	202.691
+TCONS_00000076	2930	2930	24.7046	47.3178
+TCONS_00000077	2890	2890	30.1741	56.9405
+TCONS_00000078	3311	3311	8.60342	18.7958
+TCONS_00000079	2590	2590	94.6701	158.571
+TCONS_00000080	2308	2308	0	0
+TCONS_00000081	585	585	246.925	63.6034
+TCONS_00000082	1239	1239	34.402	24.7666
+TCONS_00000083	1306	1306	30.076	23.0767
+TCONS_00000084	905	905	0	0
+TCONS_00000085	850	850	12.3046	5.47456
+TCONS_00000086	906	906	106.944	51.8153
+TCONS_00000087	848	848	20.3516	9.02603
+TCONS_00000088	1808	1808	69.8784	78.4149
+TCONS_00000089	921	921	3.96399	1.96262
+TCONS_00000090	1101	1101	31.5351	19.6262
+TCONS_00000091	1925	1925	42.8944	51.6823
+TCONS_00000092	2324	2324	828.909	1232.54
+TCONS_00000093	2112	2112	0	0
+TCONS_00000094	2032	2032	0	0
+TCONS_00000095	2009	2009	68.5732	86.694
+TCONS_00000096	1745	1745	18.6306	20.0769
+TCONS_00000097	1212	1212	1.75108	1.22721
+TCONS_00000098	1849	1849	22.152	25.5002
+TCONS_00000099	1859	1859	16.8841	19.5555
+TCONS_00000100	2089	2089	54.3286	71.7578
+TCONS_00000101	1943	1943	113.906	138.692
+TCONS_00000102	5706	5706	709.915	2752.9
+TCONS_00000103	3093	3093	777.628	1579.03
+TCONS_00000104	3203	3203	43.3036	91.2986
+TCONS_00000105	4834	4834	1.93379	6.30677
+TCONS_00000106	3951	3951	1.64288e-4	4.33247e-4
+TCONS_00000107	3939	3939	4.11107e-4	0.00108065
+TCONS_00000108	4854	4854	0	0
+TCONS_00000109	5564	5564	1.10103	4.15902
+TCONS_00000110	2241	2241	0	0
+TCONS_00000111	722	722	1.6725	0.853653
+TCONS_00000112	1671	1671	1.24167	1.2731
+TCONS_00000113	4460	4460	0	0
+TCONS_00000114	1704	1704	0	0
+TCONS_00000115	1561	1561	3.73868	4.12573
+TCONS_00000116	2709	2709	425.876	749.163
+TCONS_00000117	2763	2763	64.833	116.523
+TCONS_00000118	2677	2677	355.202	616.805
+TCONS_00000119	2697	2697	11.1787	19.5698
+TCONS_00000120	2601	2601	25.3814	42.7108
+TCONS_00000121	2598	2598	0	0
+TCONS_00000122	2571	2571	9.42276	15.6564
+TCONS_00000124	8659	8659	4.36491	26.0383
+TCONS_00000125	8716	8716	0	0
+TCONS_00000126	8662	8662	1.11806	6.67201
+TCONS_00000127	8719	8719	0	0
+TCONS_00000128	8720	8720	0	0
+TCONS_00000129	2902	2902	222.463	421.69
+TCONS_00000130	2209	2209	53.9465	75.8295
+TCONS_00000131	2217	2217	81.1706	114.556
+TCONS_00000132	1403	1403	9.57497	8.00328
+TCONS_00000133	1817	1817	5.31411	5.99711
+TCONS_00000134	2425	2425	516.786	805.328
+TCONS_00000135	2248	2248	0	0
+TCONS_00000136	1904	1904	0	0
+TCONS_00000137	2845	2845	61.5073	114.112
+TCONS_00000138	1585	1585	5.68473	5.48302
+TCONS_00000140	2728	2728	9.70256	17.1982
+TCONS_00000141	2673	2673	2.55616	4.43152
+TCONS_00000142	1091	1091	1.20016	0.738447
+TCONS_00000144	1894	1894	0	0
+TCONS_00000145	2174	2174	5.68504	7.85048
+TCONS_00000146	545	545	105.561	24.2056
+TCONS_00000147	760	760	0	0
+TCONS_00000149	956	956	12.6736	6.58841
+TCONS_00000151	3027	3027	63.4016	125.783
+TCONS_00000152	3077	3077	0	0
+TCONS_00000154	3151	3151	8.54099	17.6933
+TCONS_00000156	3196	3196	19.3223	40.6422
+TCONS_00000157	3099	3099	14.4648	29.4331
+TCONS_00000158	1950	1950	0	0
+TCONS_00000159	1279	1279	12.2413	9.15889
+TCONS_00000160	1055	1055	7.76387	4.57945
+TCONS_00000163	2070	2070	23.0308	30.1099
+TCONS_00000164	2922	2922	54.1179	103.348
+TCONS_00000165	4625	4625	21.4315	66.7291
+TCONS_00000166	3128	3128	26.3344	54.1255
+TCONS_00000167	2388	2388	16.9602	25.9862
+TCONS_00000168	3171	3171	0	0
+TCONS_00000169	3129	3129	98.5801	202.683
+TCONS_00000170	3557	3557	1.64609	3.88245
+TCONS_00000171	3426	3426	1.38415	3.13645
+TCONS_00000172	3137	3137	0	0
+TCONS_00000173	1293	1293	18.0531	13.6859
+TCONS_00000174	3963	3963	27.9095	73.8376
+TCONS_00000175	1412	1412	18.3447	15.4502
+TCONS_00000176	1421	1421	22.818	19.3629
+TCONS_00000177	1248	1248	150.428	109.253
+TCONS_00000178	687	687	1480.3	488.038
+TCONS_00000179	3530	3530	23.5695	55.1408
+TCONS_00000180	1883	1883	184.103	216.355
+TCONS_00000181	2698	2698	1.24375	2.17822
+TCONS_00000182	1936	1936	0.239069	0.289907
+TCONS_00000183	1293	1293	0.196149	0.148699
+TCONS_00000184	2364	2364	0	0
+TCONS_00000185	2257	2257	26.1846	37.6948
+TCONS_00000186	2337	2337	62.2135	93.0795
+TCONS_00000187	2265	2265	176.306	254.803
+TCONS_00000188	2483	2483	72.6541	116.199
+TCONS_00000189	3669	3669	676.812	1649.91
+TCONS_00000190	1363	1363	149.632	120.839
+TCONS_00000191	1270	1270	85.9191	63.7375
+TCONS_00000192	2094	2094	23.1773	30.6948
+TCONS_00000193	722	722	1374.3	487.094
+TCONS_00000194	8441	8441	9.77862	56.8261
+TCONS_00000195	5417	5417	28.5975	105.053
+TCONS_00000196	5158	5158	0	0
+TCONS_00000197	3979	3979	0	0
+TCONS_00000198	2204	2204	535.176	750.375
+TCONS_00000199	1523	1523	10.0998	9.29878
+TCONS_00000200	3524	3524	0	0
+TCONS_00000201	3414	3414	64.2675	145.084
+TCONS_00000202	6251	6251	7.89057	33.6381
+TCONS_00000203	6278	6278	66.8942	286.451
+TCONS_00000204	6336	6336	4.34858	18.7996
+TCONS_00000205	1476	1476	24.8263	22.0324
+TCONS_00000206	902	902	6026.58	2902.88
+TCONS_00000207	842	842	50.3161	22.102
+TCONS_00000208	960	960	2467.95	1289.96
+TCONS_00000209	2323	2323	11.6617	17.3321
+TCONS_00000210	2400	2400	29.4993	45.4486
+TCONS_00000211	1756	1756	11.7705	12.7757
+TCONS_00000214	9113	9113	104.797	658.786
+TCONS_00000215	3115	3115	12.3267	25.222
+TCONS_00000216	2961	2961	83.2243	161.227
+TCONS_00000217	1460	1460	252.129	220.902
+TCONS_00000218	1536	1536	12.1962	11.3409
+TCONS_00000219	3848	3848	173.059	443.778
+TCONS_00000220	3735	3735	245.458	609.822
+TCONS_00000221	5410	5410	249.013	913.514
+TCONS_00000222	5336	5336	181.788	657.388
+TCONS_00000223	5482	5482	28.8094	107.155
+TCONS_00000224	3780	3780	39.2591	98.7852
+TCONS_00000225	654	654	264.792	81.1216
+TCONS_00000227	5515	5515	1079.45	4040.13
+TCONS_00000228	5902	5902	16.7798	67.3935
+TCONS_00000229	5548	5548	0	0
+TCONS_00000230	5400	5400	4.88956	17.903
+TCONS_00000231	1035	1035	0	0
+TCONS_00000232	2038	2038	0	0
+TCONS_00000233	1574	1574	4.76177	4.55577
+TCONS_00000234	7662	7662	202.645	1066.02
+TCONS_00000235	10579	10579	325.991	2387.13
+TCONS_00000236	10667	10667	0	0
+TCONS_00000237	8667	8667	0	0
+TCONS_00000240	8703	8703	85.2765	511.358
+TCONS_00000241	1936	1936	6785.75	8228.74
+TCONS_00000243	1870	1870	341.384	398.051
+TCONS_00000244	2051	2051	4.73263	6.12377
+TCONS_00000245	1235	1235	74.8244	53.6558
+TCONS_00000246	1467	1467	0	0
+TCONS_00000247	1400	1400	7.26745	6.05911
+TCONS_00000248	1427	1427	148.64	126.763
+TCONS_00000249	1184	1184	32.618	22.214
+TCONS_00000250	309	309	83.5415	5.22651
+TCONS_00000251	1132	1132	8.28269	5.33633
+TCONS_00000252	1125	1125	6.0946	3.89644
+TCONS_00000253	1924	1924	601.09	723.813
+TCONS_00000256	1795	1795	0	0
+TCONS_00000258	4216	4216	1977.36	5584.96
+TCONS_00000259	4052	4052	0	0
+TCONS_00000260	2237	2237	0.917903	1.30841
+TCONS_00000261	3653	3653	300.08	728.132
+TCONS_00000262	759	759	8.98698	3.42034
+TCONS_00000263	5213	5213	63.7235	224.898
+TCONS_00000264	2837	2837	0	0
+TCONS_00000265	2933	2933	18.315	35.1183
+TCONS_00000266	781	781	149.732	59.315
+TCONS_00000267	3319	3319	161.7	354.179
+TCONS_00000268	2947	2947	68.2064	131.458
+TCONS_00000269	2822	2822	174.3	320.537
+TCONS_00000270	2918	2918	11.9872	22.8579
+TCONS_00000271	2688	2688	0	0
+TCONS_00000272	1547	1547	22.6755	21.2617
+TCONS_00000273	1773	1773	371.39	407.571
+TCONS_00000274	3728	3728	194.72	482.805
+TCONS_00000275	1279	1279	245.723	183.848
+TCONS_00000276	1258	1258	71.2541	52.2541
+TCONS_00000277	1182	1182	1096.88	745.466
+TCONS_00000278	1161	1161	341.094	226.751
+TCONS_00000279	1126	1126	0	0
+TCONS_00000280	726	726	3.66236	1.30841
+TCONS_00000281	2663	2663	2.55177	4.40587
+TCONS_00000282	1738	1738	2.85302	3.06037
+TCONS_00000283	1202	1202	1.1054	0.766884
+TCONS_00000284	1077	1077	9.0877	5.50163
+TCONS_00000285	1041	1041	0	0
+TCONS_00000286	1194	1194	8.22662	5.66078
+TCONS_00000287	5643	5643	316.026	1211.41
+TCONS_00000288	5627	5627	0	0
+TCONS_00000290	837	837	0	0
+TCONS_00000291	957	957	0	0
+TCONS_00000292	660	660	2.19742	0.682521
+TCONS_00000293	467	467	0	0
+TCONS_00000295	934	934	0	0
+TCONS_00000296	3003	3003	1012.93	1992.39
+TCONS_00000297	3144	3144	0	0
+TCONS_00000298	4676	4676	862.533	2716.68
+TCONS_00000299	4531	4531	115.693	352.534
+TCONS_00000300	1588	1588	1221.6	1180.84
+TCONS_00000301	3684	3684	442.502	1083.41
+TCONS_00000302	3593	3593	19.21	45.7975
+TCONS_00000303	2359	2359	9.70689	14.6738
+TCONS_00000304	2151	2151	0	0
+TCONS_00000305	3674	3674	33.0191	80.6097
+TCONS_00000306	3574	3574	6.01122	14.2502
+TCONS_00000307	3561	3561	0	0
+TCONS_00000308	16326	16326	0.00188256	0.0214338
+TCONS_00000309	16251	16251	64.1432	726.898
+TCONS_00000310	13946	13946	59.1542	573.969
+TCONS_00000311	4062	4062	0	0
+TCONS_00000312	5671	5671	22.971	88.5086
+TCONS_00000313	4219	4219	3.98354	11.2598
+TCONS_00000314	152	152	585.268	0.654207
+TCONS_00000315	1574	1574	1.36757	1.30841
+TCONS_00000316	3832	3832	0.406568	1.03797
+TCONS_00000317	4049	4049	8.56032	23.1677
+TCONS_00000318	897	897	0	0
+TCONS_00000319	1018	1018	0	0
+TCONS_00000320	1783	1783	1.5570600000000001	1.96262
+TCONS_00000321	1606	1606	0	0
+TCONS_00000325	1855	1855	0	0
+TCONS_00000326	1863	1863	0	0
+TCONS_00000330	1863	1863	0	0
+TCONS_00000331	1557	1557	0.594357	0.654207
+TCONS_00000333	2804	2804	848.737	1550.02
+TCONS_00000334	2810	2810	865.048	1583.48
+TCONS_00000335	2699	2699	10.5389	18.4645
+TCONS_00000339	2700	2700	0	0
+TCONS_00000340	7456	7456	10.871	55.6043
+TCONS_00000341	7955	7955	22.6164	123.659
+TCONS_00000342	2129	2129	1.82725	2.46513
+TCONS_00000343	2020	2020	0	0
+TCONS_00000344	6272	6272	119.963	513.19
+TCONS_00000345	2301	2301	1.56973	2.30858
+TCONS_00000347	4052	4052	0.540913	1.46508
+TCONS_00000348	3905	3905	37.4761	97.6105
+TCONS_00000349	3833	3833	0	0
+TCONS_00000350	6021	6021	12.1352	49.7602
+TCONS_00000351	3842	3842	21.2858	54.4931
+TCONS_00000352	3643	3643	0	0
+TCONS_00000353	3653	3653	0	0
+TCONS_00000354	3393	3393	89.5863	200.911
+TCONS_00000355	4528	4528	3.02987	9.22603
+TCONS_00000356	2015	2015	0.0095909	0.012166
+TCONS_00000357	1942	1942	97.393	118.517
+TCONS_00000358	1879	1879	0	0
+TCONS_00000359	1911	1911	62.1958	74.3225
+TCONS_00000360	1984	1984	83.0303	103.504
+TCONS_00000361	5090	5090	6.97666	24.0159
+TCONS_00000362	3506	3506	2.24494	5.21396
+TCONS_00000365	1378	1378	0	0
+TCONS_00000367	2419	2419	498.411	774.581
+TCONS_00000368	899	899	0	0
+TCONS_00000369	753	753	0	0
+TCONS_00000371	922	922	1.31945	0.654207
+TCONS_00000372	2314	2314	9.45551	13.9929
+TCONS_00000373	6023	6023	132.507	543.53
+TCONS_00000374	5838	5838	0.00782069	0.0310568
+TCONS_00000375	2927	2927	2.65441	5.07847
+TCONS_00000376	1462	1462	1.34743	1.18245
+TCONS_00000377	1759	1759	274.773	298.822
+TCONS_00000379	1853	1853	231.542	267.193
+TCONS_00000380	2770	2770	288.583	520.094
+TCONS_00000381	4120	4120	780.441	2151.36
+TCONS_00000382	3070	3070	3.55212	7.15508
+TCONS_00000383	1741	1741	5.51644	5.92906
+TCONS_00000384	1518	1518	37.805	34.673
+TCONS_00000385	3493	3493	39.3861	91.1138
+TCONS_00000386	3349	3349	773.697	1711.07
+TCONS_00000388	1524	1524	30.8531	28.4278
+TCONS_00000389	2792	2792	165.473	300.794
+TCONS_00000390	12227	12227	229.165	1945.09
+TCONS_00000391	11900	11900	159.167	1314.17
+TCONS_00000393	3059	3059	10.4605	20.9894
+TCONS_00000395	2532	2532	14.2752	23.3255
+TCONS_00000396	2406	2406	11.0813	17.1196
+TCONS_00000397	2535	2535	7.61786	12.4636
+TCONS_00000398	903	903	12.5589	6.05827
+TCONS_00000399	1097	1097	0	0
+TCONS_00000401	2128	2128	64.0989	86.4298
+TCONS_00000402	1498	1498	0	0
+TCONS_00000403	3583	3583	511.48	1215.77
+TCONS_00000404	3580	3580	580.974	1379.73
+TCONS_00000405	3633	3633	227.694	549.271
+TCONS_00000406	1342	1342	0	0
+TCONS_00000407	2079	2079	529.708	695.899
+TCONS_00000408	2003	2003	6.37068	8.02715
+TCONS_00000409	2001	2001	0	0
+TCONS_00000410	2415	2415	11.5352	17.8942
+TCONS_00000411	1397	1397	1.13535	0.94417
+TCONS_00000412	1586	1586	8.92013	8.60991
+TCONS_00000413	2635	2635	0	0
+TCONS_00000414	1403	1403	8.859	7.40483
+TCONS_00000415	1748	1748	7.8994	8.52935
+TCONS_00000416	2736	2736	0.192114	0.341617
+TCONS_00000417	2413	2413	77.5931	120.258
+TCONS_00000418	2026	2026	41.6194	53.1178
+TCONS_00000419	1668	1668	2.65369	2.71523
+TCONS_00000420	6656	6656	414.925	1887.65
+TCONS_00000421	2614	2614	32.4887	54.9694
+TCONS_00000422	6137	6137	91.2537	381.667
+TCONS_00000423	2424	2424	60.1366	93.6708
+TCONS_00000424	3847	3847	0.752634	1.92945
+TCONS_00000425	2600	2600	2.91814	4.90847
+TCONS_00000427	2455	2455	1.27794e-4	2.01857e-4
+TCONS_00000428	2086	2086	3.24822	4.28339
+TCONS_00000429	3186	3186	18.4124	38.5982
+TCONS_00000430	1551	1551	3.30918	3.11222
+TCONS_00000431	2265	2265	2.82588	4.08406
+TCONS_00000432	2347	2347	0.394296	0.654207
+TCONS_00000433	3667	3667	48.1699	117.359
+TCONS_00000434	4493	4493	64.0644	193.493
+TCONS_00000435	4260	4260	0	0
+TCONS_00000436	4245	4245	495.497	1409.67
+TCONS_00000437	2011	2011	3.17249	4.01532
+TCONS_00000438	4599	4599	25.4604	78.8055
+TCONS_00000439	3481	3481	11.2922	26.027
+TCONS_00000440	3691	3691	0	0
+TCONS_00000441	3075	3075	4.68047	9.44447
+TCONS_00000442	2261	2261	47.962	69.1806
+TCONS_00000443	1859	1859	15.8155	18.3178
+TCONS_00000444	1943	1943	408.998	497.995
+TCONS_00000445	1884	1884	3.77191	4.43535
+TCONS_00000446	1111	1111	23.9054	15.0468
+TCONS_00000447	5055	5055	189.506	647.651
+TCONS_00000448	4093	4093	0.00495709	0.0135701
+TCONS_00000449	2259	2259	0.0652279	0.0939927
+TCONS_00000450	2253	2253	0.389918	0.560214
+TCONS_00000451	6052	6052	0	0
+TCONS_00000452	2272	2272	978.03	1418.32
+TCONS_00000453	1884	1884	226.119	265.891
+TCONS_00000454	1642	1642	4.05564	4.07515
+TCONS_00000455	2254	2254	28.6665	41.2069
+TCONS_00000456	1611	1611	0	0
+TCONS_00000457	1740	1740	83.6573	89.8556
+TCONS_00000458	2298	2298	11.9692	17.5775
+TCONS_00000459	2589	2589	583.308	976.619
+TCONS_00000460	2025	2025	188.164	240.016
+TCONS_00000461	2054	2054	2.55873	3.31629
+TCONS_00000462	2088	2088	0	0
+TCONS_00000463	2021	2021	11.2322	14.2956
+TCONS_00000464	1983	1983	25.7298	32.0561
+TCONS_00000465	6506	6506	148.558	660.095
+TCONS_00000466	2793	2793	0	0
+TCONS_00000467	2581	2581	0	0
+TCONS_00000468	1893	1893	0	0
+TCONS_00000469	2719	2719	0.680701	1.30841
+TCONS_00000470	2971	2971	21.1976	41.215
+TCONS_00000471	3743	3743	14.0996	35.1092
+TCONS_00000472	4475	4475	4.93388	14.8389
+TCONS_00000473	4419	4419	0	0
+TCONS_00000474	2908	2908	0.91282	1.73417
+TCONS_00000476	2581	2581	36.0699	60.187
+TCONS_00000477	957	957	161.036	83.8289
+TCONS_00000478	1078	1078	3.85614	2.33721
+TCONS_00000479	787	787	20.0801	8.0397
+TCONS_00000480	2659	2659	350.994	605.031
+TCONS_00000481	1658	1658	125.655	127.681
+TCONS_00000482	2437	2437	6.26305	9.8131
+TCONS_00000483	105	105	52475.4	7.85048
+TCONS_00000484	3765	3765	9.81018	24.5807
+TCONS_00000485	4294	4294	45.0799	129.812
+TCONS_00000486	3729	3729	0	0
+TCONS_00000487	3555	3555	0	0
+TCONS_00000488	2595	2595	4801.13	8058.79
+TCONS_00000489	2554	2554	10.0504	16.5785
+TCONS_00000490	2430	2430	236.208	368.928
+TCONS_00000491	2314	2314	140.049	207.254
+TCONS_00000492	2557	2557	0	0
+TCONS_00000493	4012	4012	25.1391	67.3789
+TCONS_00000494	987	987	12.1092	6.56039
+TCONS_00000495	1001	1001	0	0
+TCONS_00000498	1100	1100	9.31318	5.78956
+TCONS_00000499	1036	1036	441.674	254.585
+TCONS_00000501	1512	1512	5.72637	5.22766
+TCONS_00000502	2293	2293	97.557	142.924
+TCONS_00000503	2167	2167	9.25552	12.7352
+TCONS_00000504	2094	2094	1468.87	1945.3
+TCONS_00000505	2302	2302	0	0
+TCONS_00000506	2343	2343	7.65519	11.4856
+TCONS_00000507	8992	8992	4.88506	30.2912
+TCONS_00000508	8704	8704	61.2754	367.48
+TCONS_00000509	8368	8368	57.736	332.539
+TCONS_00000510	2160	2160	13.2037	18.1024
+TCONS_00000511	1844	1844	91.3447	104.828
+TCONS_00000512	4996	4996	22.6273	76.3869
+TCONS_00000519	4032	4032	124.967	336.708
+TCONS_00000520	4868	4868	15.3499	50.4303
+TCONS_00000521	4865	4865	196.412	644.872
+TCONS_00000522	4629	4629	0	0
+TCONS_00000523	3565	3565	7.19442	17.0094
+TCONS_00000524	3035	3035	3008.93	5986.48
+TCONS_00000525	3107	3107	1059.56	2161.99
+TCONS_00000526	887	887	5.98178	2.81787
+TCONS_00000527	2815	2815	4.52762	8.30387
+TCONS_00000528	2178	2178	0.945571	1.30841
+TCONS_00000529	1779	1779	0	0
+TCONS_00000530	1625	1625	0	0
+TCONS_00000531	607	607	7623.06	2082.12
+TCONS_00000532	604	604	972.076	263.446
+TCONS_00000533	594	594	76262.2	20129
+TCONS_00000534	1975	1975	165.35	205.071
+TCONS_00000535	4942	4942	494.345	1649.97
+TCONS_00000536	1620	1620	1041.47	1030.28
+TCONS_00000537	1576	1576	103.881	99.5341
+TCONS_00000538	1686	1686	0.192633	0.199552
+TCONS_00000539	1728	1728	513.376	547.057
+TCONS_00000540	1622	1622	624.445	618.62
+TCONS_00000541	1590	1590	1505.82	1457.71
+TCONS_00000542	2412	2412	850.301	1317.25
+TCONS_00000544	2799	2799	22.9664	41.8617
+TCONS_00000545	2699	2699	0.0043104	0.00755199
+TCONS_00000546	2512	2512	0	0
+TCONS_00000547	1814	1814	0	0
+TCONS_00000548	1732	1732	55.5746	59.3779
+TCONS_00000549	5425	5425	71.4974	263.049
+TCONS_00000550	5535	5535	5.31471	19.9669
+TCONS_00000551	2736	2736	4.27763	7.60648
+TCONS_00000552	1697	1697	97.129	101.373
+TCONS_00000553	1413	1413	0	0
+TCONS_00000554	1269	1269	6.61494	4.9025
+TCONS_00000555	1271	1271	12.3708	9.18577
+TCONS_00000556	1097	1097	6.87415	4.25876
+TCONS_00000557	3953	3953	2.47943	6.54207
+TCONS_00000558	3933	3933	757.939	1989.13
+TCONS_00000559	3969	3969	0	0
+TCONS_00000560	2393	2393	48.7518	74.8691
+TCONS_00000561	2510	2510	1019.86	1650.58
+TCONS_00000562	1489	1489	76.6175	68.6991
+TCONS_00003803	842	842	459.054	201.646
+TCONS_00003804	2411	2411	0	0
+TCONS_00003807	1745	1745	0.0136576	0.0147178
+TCONS_00003808	1745	1745	0	0
+TCONS_00003809	1768	1768	77.9198	85.2353
+TCONS_00003810	1636	1636	19.9932	20.0046
+TCONS_00003812	3181	3181	19.318	40.4283
+TCONS_00003813	3517	3517	48.0267	111.917
+TCONS_00003814	1189	1189	0	0
+TCONS_00003816	1134	1134	0	0
+TCONS_00003817	1097	1097	68.4073	42.3805
+TCONS_00003818	717	717	286.708	100.605
+TCONS_00003819	1577	1577	98.9784	94.9065
+TCONS_00003820	1148	1148	50.7712	33.2849
+TCONS_00003821	1022	1022	25.5907	14.4974
+TCONS_00003822	806	806	11.6002	4.80034
+TCONS_00003824	1129	1129	25.4692	16.3552
+TCONS_00003825	2373	2373	2.57971	3.92524
+TCONS_00003826	1390	1390	662.914	548.007
+TCONS_00003827	937	937	0	0
+TCONS_00003828	4272	4272	22.17	63.496
+TCONS_00003829	4295	4295	281.992	812.223
+TCONS_00003830	4812	4812	205.926	668.394
+TCONS_00003831	78	78	835811	2.8349
+TCONS_00003833	78	78	835811	2.8349
+TCONS_00003835	683	683	568.121	185.697
+TCONS_00003836	1317	1317	246.048	190.701
+TCONS_00003837	1316	1316	15.2072	11.7757
+TCONS_00003838	1704	1704	1.87158	1.96262
+TCONS_00003839	496	496	0	0
+TCONS_00003840	436	436	0	0
+TCONS_00003841	4282	4282	105.901	304.054
+TCONS_00003842	2799	2799	550.099	1002.68
+TCONS_00003843	2814	2814	982.856	1801.91
+TCONS_00003844	896	896	104.896	50.0811
+TCONS_00003845	1214	1214	22.3583	15.701
+TCONS_00003846	3040	3040	0	0
+TCONS_00003847	962	962	29.2849	15.3481
+TCONS_00003848	1040	1040	22.0683	12.7828
+TCONS_00003849	1870	1870	0.00182192	0.00212435
+TCONS_00003850	1750	1750	12.3034	13.302
+TCONS_00003851	1741	1741	16.4742	17.7065
+TCONS_00003852	2741	2741	15.865	28.2671
+TCONS_00003853	1979	1979	74.1911	92.2232
+TCONS_00003854	2373	2373	3.58549	5.45561
+TCONS_00003855	2276	2276	20.5432	29.8495
+TCONS_00003856	2704	2704	7.99481	14.0355
+TCONS_00003857	2104	2104	0	0
+TCONS_00003858	3532	3532	6.70718	15.701
+TCONS_00003859	1062	1062	18.2746	10.8696
+TCONS_00003860	1178	1178	0	0
+TCONS_00003861	1199	1199	19.2818	13.3361
+TCONS_00003862	988	988	0	0
+TCONS_00003863	1067	1067	0.479707	0.361843
+TCONS_00003864	1700	1700	1.53065	1.60078
+TCONS_00003865	3539	3539	112.027	262.799
+TCONS_00003866	2021	2021	1473.11	1874.88
+TCONS_00003867	2137	2137	0.487274	0.660132
+TCONS_00003869	2153	2153	12.7037	17.3539
+TCONS_00003870	771	771	194.828	75.8022
+TCONS_00003871	1036	1036	55.6135	32.0561
+TCONS_00003872	2262	2262	20.1196	29.0348
+TCONS_00003873	2379	2379	26.1638	39.9213
+TCONS_00003874	2306	2306	0	0
+TCONS_00003875	2258	2258	535.89	771.833
+TCONS_00003876	2387	2387	44.4477	68.0707
+TCONS_00003877	2127	2127	24.4679	32.9748
+TCONS_00003878	2380	2380	17.717	27.0455
+TCONS_00003879	3517	3517	40.1455	93.5516
+TCONS_00003880	3211	3211	120.547	254.836
+TCONS_00003881	5325	5325	109.448	394.936
+TCONS_00003882	3759	3759	212.301	531.047
+TCONS_00003883	1946	1946	111.941	136.537
+TCONS_00003884	2880	2880	106.105	199.477
+TCONS_00003885	2135	2135	1657.64	2243.34
+TCONS_00003886	2608	2608	39.2981	66.3239
+TCONS_00003887	2510	2510	40.4206	65.4179
+TCONS_00003888	1832	1832	31.5997	35.9961
+TCONS_00003891	1918	1918	117.977	141.564
+TCONS_00003892	2069	2069	4.65004	6.07608
+TCONS_00003893	2242	2242	27.6623	39.5286
+TCONS_00003894	1570	1570	42.1227	40.1813
+TCONS_00003895	1104	1104	509.791	318.354
+TCONS_00003896	2483	2483	131.539	210.376
+TCONS_00003897	2182	2182	224.94	311.892
+TCONS_00003898	2193	2193	37.7982	52.7032
+TCONS_00003899	2923	2923	719.299	1374.15
+TCONS_00003900	4402	4402	207.349	612.914
+TCONS_00003901	2005	2005	17.9114	22.5939
+TCONS_00003902	1987	1987	0	0
+TCONS_00003903	1996	1996	73.5322	92.2878
+TCONS_00003904	2299	2299	61.4087	90.2258
+TCONS_00003905	2728	2728	15.6781	27.7901
+TCONS_00003906	781	781	2439.94	966.561
+TCONS_00003907	813	813	167.295	70.0569
+TCONS_00003908	909	909	633.943	308.495
+TCONS_00003909	990	990	849.081	461.807
+TCONS_00003910	2914	2914	15.9958	30.4565
+TCONS_00003911	4362	4362	109.519	320.636
+TCONS_00003912	2868	2868	80.2757	150.237
+TCONS_00003913	5269	5269	362.136	1292.41
+TCONS_00003914	3115	3115	437.221	894.609
+TCONS_00003915	3129	3129	96.3126	198.021
+TCONS_00003916	3839	3839	95.1355	243.352
+TCONS_00003917	732	732	4281.29	1547.69
+TCONS_00003918	1148	1148	99.3025	65.1013
+TCONS_00003919	1456	1456	20.6767	18.0574
+TCONS_00003920	1475	1475	40.0393	35.505
+TCONS_00003921	2016	2016	7.79672	9.89563
+TCONS_00003922	1116	1116	110.591	70.0001
+TCONS_00003923	1302	1302	3234.08	2472.3
+TCONS_00003924	1497	1497	8.35143	7.53555
+TCONS_00003925	2970	2970	225.649	438.577
+TCONS_00003926	1629	1629	157.392	156.703
+TCONS_00003927	2053	2053	246.904	319.829
+TCONS_00003928	1877	1877	129.096	151.164
+TCONS_00003929	2452	2452	0	0
+TCONS_00003932	2431	2431	37.8509	59.1452
+TCONS_00003934	2499	2499	111.311	179.284
+TCONS_00003935	262	262	1431.38	42.1718
+TCONS_00003936	335	335	344.309	27.8583
+TCONS_00003937	2236	2236	18.6817	26.6164
+TCONS_00003938	5141	5141	174.59	607.288
+TCONS_00003939	6420	6420	66.8855	293.129
+TCONS_00003940	6002	6002	71.9901	294.227
+TCONS_00003941	5915	5915	232.039	934.085
+TCONS_00003942	1231	1231	109.97	78.5474
+TCONS_00003943	2279	2279	34.2839	49.8875
+TCONS_00003944	1777	1777	129.781	142.791
+TCONS_00003945	1557	1557	167.546	158.284
+TCONS_00003946	1504	1504	116.315	105.527
+TCONS_00003947	2595	2595	97.6427	163.895
+TCONS_00003948	2625	2625	618.991	1052.12
+TCONS_00003949	1966	1966	200.704	247.641
+TCONS_00003950	1920	1920	0	0
+TCONS_00003951	1277	1277	45.4453	33.9377
+TCONS_00003952	1108	1108	12.3494	7.74689
+TCONS_00003953	1120	1120	0.164544	0.104615
+TCONS_00003954	1150	1150	28.8815	18.9751
+TCONS_00003955	887	887	15.7973	7.44172
+TCONS_00003956	704	704	0	0
+TCONS_00003957	734	734	14.6913	5.33168
+TCONS_00003958	657	657	0	0
+TCONS_00003959	2149	2149	125.536	171.134
+TCONS_00003961	3841	3841	318.913	816.213
+TCONS_00003962	1430	1430	263.228	225.044
+TCONS_00003963	3021	3021	3.93678	7.79354
+TCONS_00003964	3127	3127	0.0385476	0.0792002
+TCONS_00003965	3228	3228	436.598	928.211
+TCONS_00003966	3152	3152	352.783	731.067
+TCONS_00003967	3646	3646	89.762	217.359
+TCONS_00003968	1431	1431	220.5	188.67
+TCONS_00003969	3127	3127	5090.99	10460
+TCONS_00003970	2981	2981	6.09647	11.8966
+TCONS_00003971	1118	1118	216.855	137.568
+TCONS_00003972	958	958	98.7936	51.4979
+TCONS_00003973	2097	2097	1.51781	2.01332
+TCONS_00003974	2755	2755	1.43229	2.56612
+TCONS_00003975	4710	4710	0.824479	2.61664
+TCONS_00003976	2572	2572	1.13807e-4	1.89177e-4
+TCONS_00003977	2145	2145	0	0
+TCONS_00003978	1954	1954	9.07601	11.1215
+TCONS_00003979	1253	1253	47.7902	34.8779
+TCONS_00003980	2347	2347	74.7542	112.371
+TCONS_00003981	2216	2216	0	0
+TCONS_00003982	2266	2266	30.2139	43.6874
+TCONS_00003983	728	728	1989	713.4
+TCONS_00003984	1641	1641	93.4345	93.818
+TCONS_00003985	1826	1826	3.79054	4.30184
+TCONS_00003986	2248	2248	996.455	1428.13
+TCONS_00003987	1345	1345	20.1245	15.996
+TCONS_00003988	1530	1530	8.52786	7.89369
+TCONS_00003989	2072	2072	9.02304	11.8093
+TCONS_00003990	2012	2012	440.65	558.029
+TCONS_00003991	2642	2642	379.511	649.627
+TCONS_00003993	1305	1305	2.56025	1.96262
+TCONS_00003995	2209	2209	0	0
+TCONS_00003996	2303	2303	0	0
+TCONS_00003997	3322	3322	1.23759	2.90641
+TCONS_00003998	2754	2754	0	0
+TCONS_00003999	2902	2902	14.4761	27.4402
+TCONS_00004000	2222	2222	0	0
+TCONS_00004001	620	620	0	0
+TCONS_00004002	6472	6472	44.5614	196.93
+TCONS_00004003	7432	7432	186.841	952.511
+TCONS_00004004	1698	1698	284.324	296.948
+TCONS_00004005	2041	2041	199.312	256.49
+TCONS_00004006	5724	5724	78.0288	303.572
+TCONS_00004007	3322	3322	10.1236	22.1957
+TCONS_00004008	6356	6356	413.292	1792.57
+TCONS_00004009	2648	2648	1312.24	2251.78
+TCONS_00004010	6458	6458	39.6621	174.886
+TCONS_00004011	5892	5892	87.5201	350.893
+TCONS_00004012	2208	2208	42.2856	59.4086
+TCONS_00004013	1660	1660	566.111	576.038
+TCONS_00004014	2505	2505	10.7297	17.3273
+TCONS_00004015	847	847	1.09258	0.654207
+TCONS_00004016	5002	5002	135.586	458.297
+TCONS_00004017	4370	4370	32.6044	95.6394
+TCONS_00004018	3630	3630	6.85921	16.532
+TCONS_00004020	2773	2773	0	0
+TCONS_00004021	1349	1349	0	0
+TCONS_00004022	6343	6343	3.78105	16.3648
+TCONS_00004023	7735	7735	1.4441	7.67132
+TCONS_00004024	9646	9646	16.5366	110.185
+TCONS_00004025	3491	3491	6.67497	15.4321
+TCONS_00004026	2198	2198	1.05043	1.46836
+TCONS_00004027	2084	2084	4103.51	5405.46
+TCONS_00004028	2067	2067	174.613	227.915
+TCONS_00004029	4813	4813	1165.92	3785.17
+TCONS_00004030	4920	4920	114.235	379.505
+TCONS_00004031	2710	2710	198.38	349.112
+TCONS_00004032	2632	2632	106.826	182.104
+TCONS_00004033	1413	1413	752.081	633.946
+TCONS_00004034	1429	1429	0	0
+TCONS_00004035	1624	1624	72.9778	72.4003
+TCONS_00004036	1294	1294	1644.11	1247.55
+TCONS_00004037	1804	1804	410.309	459.273
+TCONS_00004038	1877	1877	0	0
+TCONS_00004039	1802	1802	606.444	677.956
+TCONS_00004040	1200	1200	3.85589	3.27103
+TCONS_00004041	4259	4259	5.72889	16.3552
+TCONS_00004042	1066	1066	60.4348	36.1169
+TCONS_00004043	1559	1559	0	0
+TCONS_00004044	1448	1448	30.3036	26.2934
+TCONS_00004046	1615	1615	148.726	146.603
+TCONS_00004048	1480	1480	0	0
+TCONS_00004049	1642	1642	9.20069	9.24496
+TCONS_00004051	894	894	160.147	76.2337
+TCONS_00004052	3694	3694	34.6685	85.1264
+TCONS_00004053	5038	5038	50.8563	173.194
+TCONS_00004054	4725	4725	76.4587	243.467
+TCONS_00004055	4698	4698	86.9026	275.064
+TCONS_00004056	4715	4715	52.5516	166.968
+TCONS_00004058	4643	4643	14.7766	46.1964
+TCONS_00004059	4783	4783	0.00896501	0.0289148
+TCONS_00004060	4761	4761	46.9017	150.542
+TCONS_00004061	5221	5221	0	0
+TCONS_00004062	4528	4528	7.95641	24.2275
+TCONS_00004063	1548	1548	93.6659	87.8923
+TCONS_00004064	2832	2832	167.976	310.094
+TCONS_00004065	2864	2864	0	0
+TCONS_00004066	6318	6318	47.7127	205.663
+TCONS_00004067	3475	3475	145.447	334.618
+TCONS_00004068	4486	4486	164.053	494.674
+TCONS_00004069	1357	1357	0	0
+TCONS_00004070	3293	3293	1318.04	2862.74
+TCONS_00004071	3137	3137	18.7376	38.6309
+TCONS_00004072	3219	3219	0	0
+TCONS_00004074	643	643	1.43944	0.65431
+TCONS_00004075	647	647	0	0
+TCONS_00004076	1883	1883	0.491457	0.654207
+TCONS_00004077	3128	3128	395.628	813.142
+TCONS_00004078	2156	2156	20.11	27.514
+TCONS_00004079	6306	6306	263.745	1134.62
+TCONS_00004080	8192	8192	21.8087	122.897
+TCONS_00004081	8007	8007	647.051	3561.66
+TCONS_00004082	2592	2592	3.11034	5.21418
+TCONS_00004083	584	584	0	0
+TCONS_00004084	2710	2710	1.70709	3.00417
+TCONS_00004085	2267	2267	215.718	312.068
+TCONS_00004086	1812	1812	30213.9	33990.4
+TCONS_00004087	1801	1801	7283.83	8137.6
+TCONS_00004088	1753	1753	33.4967	36.2863
+TCONS_00004089	1683	1683	0	0
+TCONS_00004090	1644	1644	0	0
+TCONS_00004091	1453	1453	14285.9	12445.9
+TCONS_00004092	1448	1448	15.2791	13.2572
+TCONS_00004093	1276	1276	216.085	161.215
+TCONS_00004094	1539	1539	0	0
+TCONS_00004095	2012	2012	3.42616e-4	4.33881e-4
+TCONS_00004096	1942	1942	3.76288	4.57901
+TCONS_00004097	2436	2436	0	0
+TCONS_00004098	2398	2398	0	0
+TCONS_00004099	2411	2411	0	0
+TCONS_00004100	920	920	0	0
+TCONS_00004101	1279	1279	0	0
+TCONS_00004102	1153	1153	7.89077	5.20097
+TCONS_00004103	958	958	62.4378	32.5468
+TCONS_00004104	2913	2913	1.6646	3.16827
+TCONS_00004105	2396	2396	1.89602	2.91578
+TCONS_00004106	3934	3934	183.171	480.842
+TCONS_00004107	1822	1822	0	0
+TCONS_00004108	951	951	257.213	132.804
+TCONS_00004109	2235	2235	174.265	248.157
+TCONS_00004110	5191	5191	0	0
+TCONS_00004111	5161	5161	1075.48	3756.14
+TCONS_00004112	5134	5134	531.162	1844.95
+TCONS_00004113	2995	2995	58.304	114.351
+TCONS_00004114	2961	2961	616.029	1193.41
+TCONS_00004115	1345	1345	7.13768	5.67339
+TCONS_00004116	1500	1500	140.032	126.649
+TCONS_00004117	1440	1440	50.6484	43.6594
+TCONS_00004118	1383	1383	0	0
+TCONS_00004119	2036	2036	920.003	1180.68
+TCONS_00004120	3391	3391	275.914	618.389
+TCONS_00004121	7931	7931	13.2639	72.2976
+TCONS_00004122	4405	4405	39.02	115.424
+TCONS_00004123	3250	3250	51.8319	111.001
+TCONS_00004124	2267	2267	1.98163	2.86672
+TCONS_00004125	2262	2262	0	0
+TCONS_00004126	2238	2238	7.33925	10.4668
+TCONS_00004127	2316	2316	3.2336e-4	4.78989e-4
+TCONS_00004128	2443	2443	50.0899	78.6945
+TCONS_00004129	720	720	0	0
+TCONS_00004130	2190	2190	8.32204	11.586
+TCONS_00004132	828	828	757.606	325.291
+TCONS_00004133	1273	1273	4052.8	3015.09
+TCONS_00004134	2805	2805	1204.72	2201
+TCONS_00004135	2730	2730	0	0
+TCONS_00004136	2689	2689	63.5949	110.971
+TCONS_00004137	4020	4020	156.599	420.61
+TCONS_00004138	8724	8724	856.275	5147.34
+TCONS_00004139	1534	1534	1770.86	1644.18
+TCONS_00004140	1543	1543	8.32384	7.78133
+TCONS_00004141	1183	1183	6.52912	4.44195
+TCONS_00004142	1830	1830	312.32	355.332
+TCONS_00004143	1151	1151	6961.28	4578.48
+TCONS_00004144	7188	7188	43.5322	214.416
+TCONS_00004145	7105	7105	96.7082	470.659
+TCONS_00004146	1411	1411	26.7451	22.5063
+TCONS_00004148	852	852	16.125	7.19712
+TCONS_00004149	697	697	9.7133	3.27103
+TCONS_00004150	2339	2339	713.507	1068.51
+TCONS_00004151	2534	2534	80.6904	131.961
+TCONS_00004152	1368	1368	316.218	256.488
+TCONS_00004153	1805	1805	298.542	334.38
+TCONS_00004154	1262	1262	6.29114	4.63139
+TCONS_00004155	1222	1222	29.332	20.7641
+TCONS_00004156	252	252	0	0
+TCONS_00004158	1002	1002	1962.48	1084.02
+TCONS_00004160	1840	1840	0	0
+TCONS_00004162	1720	1720	0	0
+TCONS_00004163	1734	1734	0	0
+TCONS_00004164	1855	1855	0	0
+TCONS_00004165	1007	1007	248.31	138.038
+TCONS_00004169	2100	2100	0	0
+TCONS_00004170	2164	2164	0	0
+TCONS_00004172	1844	1844	0	0
+TCONS_00004173	2100	2100	0	0
+TCONS_00004175	1906	1906	8.23632	9.8131
+TCONS_00004176	6978	6978	12.2197	58.3737
+TCONS_00004177	7099	7099	0	0
+TCONS_00004178	3105	3105	3.3111	6.75152
+TCONS_00004179	4316	4316	37.8519	109.587
+TCONS_00004180	1987	1987	246.673	308.021
+TCONS_00004181	1537	1537	127.436	118.59
+TCONS_00004182	2045	2045	16.7676	21.6253
+TCONS_00004184	1904	1904	0	0
+TCONS_00004185	1798	1798	18.9668	21.1498
+TCONS_00004186	2196	2196	115.938	161.901
+TCONS_00004187	538	538	21537.1	4831.97
+TCONS_00004188	2732	2732	57.116	101.402
+TCONS_00004189	2749	2749	258.788	462.555
+TCONS_00004190	2564	2564	12.8997	21.3697
+TCONS_00004191	2770	2770	37.5763	67.7213
+TCONS_00004192	2745	2745	0	0
+TCONS_00004193	1894	1894	0	0
+TCONS_00004194	1928	1928	8.85955	10.6934
+TCONS_00004196	1166	1166	7.80374	5.21532
+TCONS_00004197	905	905	24.2773	11.7454
+TCONS_00004199	2892	2892	4.51777	8.53172
+TCONS_00004200	2877	2877	0	0
+TCONS_00004201	2904	2904	0	0
+TCONS_00004202	2907	2907	0	0
+TCONS_00004203	2415	2415	6.73019	10.4404
+TCONS_00004204	892	892	7.35763	3.49201
+TCONS_00004205	1700	1700	27.6258	28.8915
+TCONS_00004206	3946	3946	508.99	1340.47
+TCONS_00004207	1631	1631	0	0
+TCONS_00004208	2008	2008	364.361	460.389
+TCONS_00004209	1984	1984	0	0
+TCONS_00004210	3029	3029	693.892	1377.6
+TCONS_00004211	1559	1559	67.0708	63.458
+TCONS_00004212	2474	2474	2.07191	3.30052
+TCONS_00004213	3055	3055	5.14538	10.3098
+TCONS_00004214	2975	2975	260.3	506.845
+TCONS_00004215	2963	2963	0.826367	1.60205
+TCONS_00004216	3650	3650	0	0
+TCONS_00004217	2014	2014	0	0
+TCONS_00004219	5368	5368	47.9146	174.354
+TCONS_00004220	574	574	52.1823	13.0354
+TCONS_00004221	1122	1122	63.034	40.1656
+TCONS_00004222	2482	2482	11.928	19.0685
+TCONS_00004223	1160	1160	185.701	123.318
+TCONS_00004224	4268	4268	113.641	325.151
+TCONS_00004225	1512	1512	79.3946	72.4801
+TCONS_00004226	1512	1512	25.7054	23.4667
+TCONS_00004227	2216	2216	1.05972	1.49483
+TCONS_00004228	2663	2663	57.9475	100.052
+TCONS_00004229	3026	3026	1.72116	3.41342
+TCONS_00004230	2696	2696	47.0618	82.3545
+TCONS_00004231	1404	1404	47.1204	39.4191
+TCONS_00004232	2173	2173	105.678	145.855
+TCONS_00004233	1966	1966	51.1875	63.1581
+TCONS_00004234	2746	2746	158.368	282.729
+TCONS_00004235	1912	1912	165.726	198.156
+TCONS_00004236	2029	2029	27.6136	35.3011
+TCONS_00004237	596	596	276.275	73.3117
+TCONS_00004238	2015	2015	12.2077	15.4855
+TCONS_00004239	1171	1171	6.16319	4.14071
+TCONS_00004240	4170	4170	38.2544	106.804
+TCONS_00004241	4395	4395	4.15502	12.2615
+TCONS_00004242	359	359	641.809	62.8038
+TCONS_00004243	1100	1100	4426.87	2751.98
+TCONS_00004244	1097	1097	874.78	541.954
+TCONS_00004245	1081	1081	0	0
+TCONS_00004246	1078	1078	0	0
+TCONS_00004247	1224	1224	389.272	276.116
+TCONS_00004248	3996	3996	517.118	1380.16
+TCONS_00004249	3981	3981	495.76	1317.89
+TCONS_00004250	3694	3694	3.72519	9.14698
+TCONS_00004251	1080	1080	25.292	15.3653
+TCONS_00004252	1639	1639	16.5167	16.5612
+TCONS_00004253	1143	1143	1533.05	999.628
+TCONS_00004254	4362	4362	64.2642	188.144
+TCONS_00004255	4014	4014	0	0
+TCONS_00004256	1625	1625	4.22272	4.19229
+TCONS_00004258	3950	3950	4827.01	12726
+TCONS_00004259	4091	4091	1053.7	2883.03
+TCONS_00004260	2521	2521	0	0
+TCONS_00004261	3241	3241	280.398	598.706
+TCONS_00004262	2368	2368	21.4795	32.6069
+TCONS_00004263	3381	3381	342.304	764.765
+TCONS_00004264	5835	5835	86.3707	342.804
+TCONS_00004265	3402	3402	10.1524	22.8329
+TCONS_00004266	941	941	32.0592	16.3262
+TCONS_00004267	2535	2535	128.294	209.903
+TCONS_00004268	2916	2916	11.0166	20.9915
+TCONS_00004269	2888	2888	137.04	258.41
+TCONS_00004270	3481	3481	429.082	988.977
+TCONS_00004271	3477	3477	482.791	1111.4
+TCONS_00004272	15880	15880	672.049	7439.68
+TCONS_00004273	3162	3162	3.49693	7.27135
+TCONS_00004274	3124	3124	189.305	388.547
+TCONS_00004275	2172	2172	0	0
+TCONS_00004276	5751	5751	4.9425	19.3232
+TCONS_00004277	2675	2675	11.9631	20.7568
+TCONS_00004278	4237	4237	464.011	1317.47
+TCONS_00004279	4234	4234	32.6797	92.7184
+TCONS_00004280	4234	4234	81.0293	229.895
+TCONS_00004281	4171	4171	6.39335	17.8544
+TCONS_00004282	2314	2314	9.94638	14.7194
+TCONS_00004283	2117	2117	2.12333e-4	2.84655e-4
+TCONS_00004284	1241	1241	19.9528	14.3925
+TCONS_00004285	1362	1362	723.574	583.83
+TCONS_00004286	1257	1257	0	0
+TCONS_00004287	1032	1032	2.36764	1.35804
+TCONS_00004288	1575	1575	0	0
+TCONS_00004289	2084	2084	63.9842	84.2849
+TCONS_00004290	1629	1629	5460.8	5436.89
+TCONS_00004291	2049	2049	0	0
+TCONS_00004292	2093	2093	15.816	20.9347
+TCONS_00004293	2232	2232	0	0
+TCONS_00004294	2973	2973	64.7807	126.047
+TCONS_00004295	2401	2401	0.0219259	0.033796
+TCONS_00004296	2281	2281	0	0
+TCONS_00004297	1715	1715	10.0802	10.6489
+TCONS_00004298	1045	1045	0	0
+TCONS_00004299	1249	1249	0.740923	0.654207
+TCONS_00004301	922	922	0	0
+TCONS_00004302	999	999	7.90747e-4	4.35111e-4
+TCONS_00004303	968	968	25.06	13.2402
+TCONS_00004304	888	888	19.0817	9.00243
+TCONS_00004308	1452	1452	0.751535	0.654207
+TCONS_00004309	2467	2467	0	0
+TCONS_00004310	1607	1607	6.26433	6.13947
+TCONS_00004311	2350	2350	139.338	209.749
+TCONS_00004312	2456	2456	348.578	550.842
+TCONS_00004313	2126	2126	5031.68	6777.52
+TCONS_00004314	2135	2135	0	0
+TCONS_00004315	2073	2073	0	0
+TCONS_00004316	2015	2015	27.3855	34.7384
+TCONS_00004317	1812	1812	0	0
+TCONS_00004318	1671	1671	26.3366	27.0033
+TCONS_00004319	1978	1978	16.5636	20.5776
+TCONS_00004320	3776	3776	18.8735	47.4368
+TCONS_00004321	3773	3773	161.712	406.105
+TCONS_00004322	3705	3705	0.00992042	0.0244362
+TCONS_00004323	3834	3834	166.051	424.162
+TCONS_00004324	3063	3063	176.334	354.32
+TCONS_00004325	3139	3139	64.0226	132.085
+TCONS_00004326	4775	4775	102.861	331.174
+TCONS_00004327	4317	4317	154.917	448.617
+TCONS_00004328	3921	3921	7.62166	19.9376
+TCONS_00004329	3797	3797	60.5164	153.001
+TCONS_00004330	1860	1860	489.726	567.555
+TCONS_00004331	2544	2544	6.32839	10.3942
+TCONS_00004332	2537	2537	23.7927	38.961
+TCONS_00004333	927	927	80.959	40.4272
+TCONS_00004334	5160	5160	0	0
+TCONS_00004335	4949	4949	0	0
+TCONS_00004336	5786	5786	242.063	952.36
+TCONS_00004337	5850	5850	0	0
+TCONS_00004338	6175	6175	229.585	966.402
+TCONS_00004340	6283	6283	166.823	714.951
+TCONS_00004342	1915	1915	27.176	32.5516
+TCONS_00004343	2088	2088	28.4611	37.5716
+TCONS_00004344	5241	5241	4.2945	15.2415
+TCONS_00004345	5087	5087	40.8351	140.481
+TCONS_00004346	5096	5096	103.166	355.568
+TCONS_00004347	5000	5000	5.52684	18.6735
+TCONS_00004348	5136	5136	426.931	1483.52
+TCONS_00004349	2198	2198	3.16078	4.41835
+TCONS_00004350	2326	2326	1.31865	1.96262
+TCONS_00004351	2057	2057	64.756	84.0656
+TCONS_00004352	3348	3348	31.623	69.9135
+TCONS_00004353	3300	3300	136.687	297.555
+TCONS_00004354	3333	3333	0.00274081	0.00603043
+TCONS_00004355	3494	3494	22.4161	51.872
+TCONS_00004356	3639	3639	45.8456	110.789
+TCONS_00004357	4462	4462	518.87	1555.76
+TCONS_00004359	4264	4264	6.11996	17.4933
+TCONS_00004360	4498	4498	0	0
+TCONS_00004361	2089	2089	4.52441	5.97589
+TCONS_00004362	2126	2126	169.394	228.168
+TCONS_00004363	2411	2411	32.92	50.9748
+TCONS_00004364	3586	3586	197.217	469.197
+TCONS_00004365	14287	14287	755.99	7517.56
+TCONS_00004366	14290	14290	131.468	1307.6
+TCONS_00004367	846	846	0	0
+TCONS_00004368	3903	3903	84.6913	220.468
+TCONS_00004369	3883	3883	0	0
+TCONS_00004370	510	510	1.81454	0.654207
+TCONS_00004371	8653	8653	185.251	1104.3
+TCONS_00004372	8587	8587	224.966	1330.55
+TCONS_00004373	3921	3921	5.29009	13.8384
+TCONS_00004374	2834	2834	164.66	304.206
+TCONS_00004375	1637	1637	0	0
+TCONS_00004376	2740	2740	177.331	315.831
+TCONS_00004377	2731	2731	1258.05	2232.61
+TCONS_00004378	2565	2565	1419.55	2352.63
+TCONS_00004379	2574	2574	174.874	290.933
+TCONS_00004380	2451	2451	0	0
+TCONS_00004381	2617	2617	0	0
+TCONS_00004382	2388	2388	76.283	116.88
+TCONS_00004383	4314	4314	21.2511	61.4952
+TCONS_00004384	4492	4492	0	0
+TCONS_00004385	1586	1586	0.92831	0.896026
+TCONS_00004386	540	540	10.5196	2.37501
+TCONS_00004387	738	738	0	0
+TCONS_00004388	646	646	0	0
+TCONS_00004389	2552	2552	10.2353	16.869
+TCONS_00004390	2791	2791	109.526	199.017
+TCONS_00004391	4088	4088	43.8011	119.751
+TCONS_00004392	4129	4129	577.809	1596.46
+TCONS_00004394	1768	1768	61.9915	67.8115
+TCONS_00004395	697	697	0	0
+TCONS_00004396	2041	2041	1.5251	1.96262
+TCONS_00004397	5192	5192	104.243	366.356
+TCONS_00004398	1287	1287	2646.35	1994.95
+TCONS_00004399	1547	1547	94.5968	88.699
+TCONS_00004400	1074	1074	104.54	63.0659
+TCONS_00004401	1607	1607	50.0332	49.036
+TCONS_00004402	1631	1631	18.2766	18.2224
+TCONS_00004403	1553	1553	9.36654	8.82229
+TCONS_00004404	1566	1566	387.15	368.212
+TCONS_00004405	1676	1676	52.3524	53.8627
+TCONS_00004406	1824	1824	72.2985	81.9484
+TCONS_00004408	1244	1244	14.7138	10.6447
+TCONS_00004409	934	934	0	0
+TCONS_00004410	1607	1607	296.235	290.331
+TCONS_00004412	1394	1394	79.1313	65.6388
+TCONS_00004413	2160	2160	14.3916	19.7309
+TCONS_00004414	1411	1411	12.799	10.7705
+TCONS_00004415	2054	2054	6.18476	8.01588
+TCONS_00004416	2077	2077	118.072	154.949
+TCONS_00004418	953	953	7.77114	4.02338
+TCONS_00004419	1774	1774	0	0
+TCONS_00004420	2239	2239	199.968	285.325
+TCONS_00004421	1842	1842	600.875	688.722
+TCONS_00004422	2924	2924	683.304	1305.86
+TCONS_00004423	2686	2686	2.26253	3.94325
+TCONS_00004424	4859	4859	2.96008	9.70615
+TCONS_00004425	5799	5799	0	0
+TCONS_00004426	3940	3940	0	0
+TCONS_00004427	5094	5094	0.215708	0.743146
+TCONS_00004428	2703	2703	0	0
+TCONS_00004429	2798	2798	8.25825	15.0468
+TCONS_00004431	2725	2725	0	0
+TCONS_00004432	4461	4461	0	0
+TCONS_00004433	4548	4548	48.5196	148.429
+TCONS_00004434	4417	4417	20.4325	60.614
+TCONS_00004435	4424	4424	11.1145	33.0269
+TCONS_00004436	686	686	127.227	41.8554
+TCONS_00004439	2497	2497	7.99159	12.8604
+TCONS_00004440	2827	2827	14.0584	25.903
+TCONS_00004441	2683	2683	143.47	249.742
+TCONS_00004442	2803	2803	0	0
+TCONS_00004443	1653	1653	0	0
diff -r 000000000000 -r f3fefb6d8254 test-data/signalP_results.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/signalP_results.txt	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,3905 @@
+# SignalP-4.1 euk predictions
+>TCONS_00000007 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.130
+  max. Y    39       0.122
+  max. S    38       0.314
+  mean S     1-38    0.114
+       D     1-38    0.118   0.450   NO
+Name=TCONS_00000007	SP='NO' D=0.118 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000008 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.130
+  max. Y    39       0.122
+  max. S    38       0.314
+  mean S     1-38    0.114
+       D     1-38    0.118   0.450   NO
+Name=TCONS_00000008	SP='NO' D=0.118 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000009 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.130
+  max. Y    39       0.122
+  max. S    38       0.314
+  mean S     1-38    0.114
+       D     1-38    0.118   0.450   NO
+Name=TCONS_00000009	SP='NO' D=0.118 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000020 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    27       0.186
+  max. Y    27       0.254
+  max. S    18       0.608
+  mean S     1-26    0.355
+       D     1-26    0.308   0.450   NO
+Name=TCONS_00000020	SP='NO' D=0.308 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000023 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.110
+  max. Y    12       0.110
+  max. S    11       0.122
+  mean S     1-11    0.112
+       D     1-11    0.111   0.450   NO
+Name=TCONS_00000023	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000024 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.110
+  max. Y    12       0.110
+  max. S    11       0.122
+  mean S     1-11    0.112
+       D     1-11    0.111   0.450   NO
+Name=TCONS_00000024	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000025 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    60       0.110
+  max. Y    13       0.117
+  max. S     2       0.175
+  mean S     1-12    0.125
+       D     1-12    0.122   0.450   NO
+Name=TCONS_00000025	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000026 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    49       0.112
+  max. Y    46       0.112
+  max. S    37       0.123
+  mean S     1-45    0.105
+       D     1-45    0.108   0.450   NO
+Name=TCONS_00000026	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000027 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    35       0.154
+  max. Y    35       0.119
+  max. S    54       0.119
+  mean S     1-34    0.095
+       D     1-34    0.106   0.450   NO
+Name=TCONS_00000027	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000028 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    21       0.345
+  max. Y    21       0.301
+  max. S     1       0.362
+  mean S     1-20    0.252
+       D     1-20    0.274   0.450   NO
+Name=TCONS_00000028	SP='NO' D=0.274 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000029 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    21       0.345
+  max. Y    21       0.301
+  max. S     1       0.362
+  mean S     1-20    0.252
+       D     1-20    0.274   0.450   NO
+Name=TCONS_00000029	SP='NO' D=0.274 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000030 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.111
+  max. Y    15       0.115
+  max. S     4       0.155
+  mean S     1-14    0.118
+       D     1-14    0.116   0.450   NO
+Name=TCONS_00000030	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000031 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.111
+  max. Y    15       0.115
+  max. S     4       0.155
+  mean S     1-14    0.118
+       D     1-14    0.116   0.450   NO
+Name=TCONS_00000031	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000032 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.111
+  max. Y    15       0.115
+  max. S     4       0.155
+  mean S     1-14    0.118
+       D     1-14    0.116   0.450   NO
+Name=TCONS_00000032	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000045 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    61       0.110
+  max. Y    11       0.125
+  max. S     3       0.182
+  mean S     1-10    0.129
+       D     1-10    0.127   0.450   NO
+Name=TCONS_00000045	SP='NO' D=0.127 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000046 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    40       0.112
+  max. Y    11       0.117
+  max. S     4       0.136
+  mean S     1-10    0.122
+       D     1-10    0.120   0.450   NO
+Name=TCONS_00000046	SP='NO' D=0.120 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000047 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    40       0.112
+  max. Y    11       0.117
+  max. S     4       0.136
+  mean S     1-10    0.122
+       D     1-10    0.120   0.450   NO
+Name=TCONS_00000047	SP='NO' D=0.120 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000048 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    13       0.160
+  max. Y    13       0.168
+  max. S    12       0.336
+  mean S     1-12    0.176
+       D     1-12    0.172   0.450   NO
+Name=TCONS_00000048	SP='NO' D=0.172 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000049 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.114
+  max. Y    18       0.175
+  max. S    14       0.440
+  mean S     1-17    0.264
+       D     1-17    0.223   0.450   NO
+Name=TCONS_00000049	SP='NO' D=0.223 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000055 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.121
+  max. Y    12       0.141
+  max. S     6       0.261
+  mean S     1-11    0.198
+       D     1-11    0.172   0.450   NO
+Name=TCONS_00000055	SP='NO' D=0.172 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000056 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.121
+  max. Y    12       0.141
+  max. S     6       0.261
+  mean S     1-11    0.198
+       D     1-11    0.172   0.450   NO
+Name=TCONS_00000056	SP='NO' D=0.172 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000057 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.121
+  max. Y    12       0.144
+  max. S     6       0.271
+  mean S     1-11    0.205
+       D     1-11    0.177   0.450   NO
+Name=TCONS_00000057	SP='NO' D=0.177 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000062 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    16       0.130
+  max. Y    16       0.121
+  max. S     9       0.146
+  mean S     1-15    0.117
+       D     1-15    0.119   0.450   NO
+Name=TCONS_00000062	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000063 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    16       0.399
+  max. Y    16       0.492
+  max. S     7       0.746
+  mean S     1-15    0.639
+       D     1-15    0.571   0.450   YES
+Name=TCONS_00000063	SP='YES' Cleavage site between pos. 15 and 16: VWA-RS D=0.571 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000064 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    16       0.399
+  max. Y    16       0.492
+  max. S     7       0.746
+  mean S     1-15    0.639
+       D     1-15    0.571   0.450   YES
+Name=TCONS_00000064	SP='YES' Cleavage site between pos. 15 and 16: VWA-RS D=0.571 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000065 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    40       0.112
+  max. Y    11       0.114
+  max. S     8       0.152
+  mean S     1-10    0.126
+       D     1-10    0.120   0.450   NO
+Name=TCONS_00000065	SP='NO' D=0.120 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000066 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    16       0.132
+  max. Y    16       0.124
+  max. S    13       0.151
+  mean S     1-15    0.123
+       D     1-15    0.124   0.450   NO
+Name=TCONS_00000066	SP='NO' D=0.124 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000067 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    16       0.132
+  max. Y    16       0.124
+  max. S    13       0.151
+  mean S     1-15    0.123
+       D     1-15    0.124   0.450   NO
+Name=TCONS_00000067	SP='NO' D=0.124 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000068 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.110
+  max. Y    51       0.111
+  max. S    34       0.129
+  mean S     1-50    0.101
+       D     1-50    0.106   0.450   NO
+Name=TCONS_00000068	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000071 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    38       0.111
+  max. Y    12       0.120
+  max. S     1       0.144
+  mean S     1-11    0.120
+       D     1-11    0.120   0.450   NO
+Name=TCONS_00000071	SP='NO' D=0.120 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000072 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.114
+  max. Y    12       0.121
+  max. S     1       0.149
+  mean S     1-11    0.123
+       D     1-11    0.122   0.450   NO
+Name=TCONS_00000072	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000073 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    38       0.111
+  max. Y    12       0.120
+  max. S     1       0.144
+  mean S     1-11    0.120
+       D     1-11    0.120   0.450   NO
+Name=TCONS_00000073	SP='NO' D=0.120 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000074 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.153
+  max. Y    29       0.124
+  max. S     1       0.165
+  mean S     1-28    0.104
+       D     1-28    0.114   0.450   NO
+Name=TCONS_00000074	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000076 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    56       0.111
+  max. Y    15       0.115
+  max. S     2       0.136
+  mean S     1-14    0.121
+       D     1-14    0.118   0.450   NO
+Name=TCONS_00000076	SP='NO' D=0.118 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000077 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.119
+  max. Y    11       0.123
+  max. S     1       0.163
+  mean S     1-10    0.120
+       D     1-10    0.121   0.450   NO
+Name=TCONS_00000077	SP='NO' D=0.121 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000078 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    56       0.111
+  max. Y    15       0.115
+  max. S     2       0.136
+  mean S     1-14    0.121
+       D     1-14    0.118   0.450   NO
+Name=TCONS_00000078	SP='NO' D=0.118 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000079 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.153
+  max. Y    29       0.124
+  max. S     1       0.165
+  mean S     1-28    0.104
+       D     1-28    0.114   0.450   NO
+Name=TCONS_00000079	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000080 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.117
+  max. Y    15       0.145
+  max. S    13       0.290
+  mean S     1-14    0.212
+       D     1-14    0.181   0.450   NO
+Name=TCONS_00000080	SP='NO' D=0.181 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000081 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    70       0.111
+  max. Y    40       0.110
+  max. S    19       0.153
+  mean S     1-39    0.105
+       D     1-39    0.107   0.450   NO
+Name=TCONS_00000081	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000092 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.169
+  max. Y    34       0.139
+  max. S    33       0.218
+  mean S     1-33    0.115
+       D     1-33    0.126   0.450   NO
+Name=TCONS_00000092	SP='NO' D=0.126 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000093 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.108
+  max. Y    50       0.106
+  max. S    20       0.111
+  mean S     1-49    0.101
+       D     1-49    0.103   0.450   NO
+Name=TCONS_00000093	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000095 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.108
+  max. Y    50       0.106
+  max. S    20       0.111
+  mean S     1-49    0.101
+       D     1-49    0.103   0.450   NO
+Name=TCONS_00000095	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000096 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.109
+  max. Y    41       0.107
+  max. S    21       0.126
+  mean S     1-40    0.101
+       D     1-40    0.104   0.450   NO
+Name=TCONS_00000096	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000097 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    27       0.113
+  max. Y    18       0.111
+  max. S    31       0.125
+  mean S     1-17    0.106
+       D     1-17    0.108   0.450   NO
+Name=TCONS_00000097	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000098 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    46       0.108
+  max. Y    46       0.106
+  max. S    45       0.110
+  mean S     1-45    0.100
+       D     1-45    0.103   0.450   NO
+Name=TCONS_00000098	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000099 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.272
+  max. Y    51       0.221
+  max. S    47       0.289
+  mean S     1-50    0.141
+       D     1-50    0.178   0.450   NO
+Name=TCONS_00000099	SP='NO' D=0.178 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000111 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.212
+  max. Y    39       0.381
+  max. S    30       0.866
+  mean S     1-38    0.627
+       D     1-38    0.514   0.450   YES
+Name=TCONS_00000111	SP='YES' Cleavage site between pos. 38 and 39: APA-LP D=0.514 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000112 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.212
+  max. Y    39       0.381
+  max. S    30       0.866
+  mean S     1-38    0.627
+       D     1-38    0.514   0.450   YES
+Name=TCONS_00000112	SP='YES' Cleavage site between pos. 38 and 39: APA-LP D=0.514 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000113 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.178
+  max. Y    17       0.280
+  max. S    21       0.588
+  mean S     1-16    0.393
+       D     1-16    0.341   0.450   NO
+Name=TCONS_00000113	SP='NO' D=0.341 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000114 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.212
+  max. Y    39       0.381
+  max. S    30       0.866
+  mean S     1-38    0.627
+       D     1-38    0.514   0.450   YES
+Name=TCONS_00000114	SP='YES' Cleavage site between pos. 38 and 39: APA-LP D=0.514 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000115 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.212
+  max. Y    39       0.381
+  max. S    30       0.866
+  mean S     1-38    0.627
+       D     1-38    0.514   0.450   YES
+Name=TCONS_00000115	SP='YES' Cleavage site between pos. 38 and 39: APA-LP D=0.514 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000129 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    35       0.120
+  max. Y    70       0.107
+  max. S     5       0.121
+  mean S     1-69    0.098
+       D     1-69    0.102   0.450   NO
+Name=TCONS_00000129	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000130 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    31       0.127
+  max. Y    17       0.114
+  max. S    49       0.191
+  mean S     1-16    0.102
+       D     1-16    0.108   0.450   NO
+Name=TCONS_00000130	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000131 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    31       0.127
+  max. Y    17       0.114
+  max. S    49       0.191
+  mean S     1-16    0.102
+       D     1-16    0.108   0.450   NO
+Name=TCONS_00000131	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000132 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    31       0.153
+  max. Y    11       0.183
+  max. S    42       0.387
+  mean S     1-10    0.280
+       D     1-10    0.235   0.450   NO
+Name=TCONS_00000132	SP='NO' D=0.235 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000133 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.146
+  max. Y    19       0.156
+  max. S    15       0.240
+  mean S     1-18    0.192
+       D     1-18    0.176   0.450   NO
+Name=TCONS_00000133	SP='NO' D=0.176 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000158 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.165
+  max. Y    27       0.154
+  max. S    40       0.403
+  mean S     1-26    0.152
+       D     1-26    0.153   0.450   NO
+Name=TCONS_00000158	SP='NO' D=0.153 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000159 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.165
+  max. Y    27       0.154
+  max. S    40       0.403
+  mean S     1-26    0.152
+       D     1-26    0.153   0.450   NO
+Name=TCONS_00000159	SP='NO' D=0.153 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000160 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.109
+  max. Y    12       0.164
+  max. S     1       0.291
+  mean S     1-11    0.208
+       D     1-11    0.188   0.450   NO
+Name=TCONS_00000160	SP='NO' D=0.188 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000173 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C     9       0.109
+  max. Y    19       0.112
+  max. S     8       0.149
+  mean S     1-18    0.120
+       D     1-18    0.117   0.450   NO
+Name=TCONS_00000173	SP='NO' D=0.117 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000174 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C     9       0.109
+  max. Y    19       0.112
+  max. S     8       0.149
+  mean S     1-18    0.120
+       D     1-18    0.117   0.450   NO
+Name=TCONS_00000174	SP='NO' D=0.117 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000175 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    54       0.118
+  max. Y    13       0.111
+  max. S    11       0.148
+  mean S     1-12    0.119
+       D     1-12    0.115   0.450   NO
+Name=TCONS_00000175	SP='NO' D=0.115 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000176 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.111
+  max. Y    54       0.108
+  max. S    50       0.132
+  mean S     1-53    0.104
+       D     1-53    0.106   0.450   NO
+Name=TCONS_00000176	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000179 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    38       0.224
+  max. Y    38       0.158
+  max. S    11       0.149
+  mean S     1-37    0.116
+       D     1-37    0.135   0.450   NO
+Name=TCONS_00000179	SP='NO' D=0.135 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000180 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.171
+  max. Y    22       0.131
+  max. S    20       0.122
+  mean S     1-21    0.100
+       D     1-21    0.114   0.450   NO
+Name=TCONS_00000180	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000185 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    57       0.168
+  max. Y    57       0.145
+  max. S    42       0.155
+  mean S     1-56    0.109
+       D     1-56    0.125   0.450   NO
+Name=TCONS_00000185	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000186 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    57       0.168
+  max. Y    57       0.145
+  max. S    42       0.155
+  mean S     1-56    0.109
+       D     1-56    0.125   0.450   NO
+Name=TCONS_00000186	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000187 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    57       0.168
+  max. Y    57       0.145
+  max. S    42       0.155
+  mean S     1-56    0.109
+       D     1-56    0.125   0.450   NO
+Name=TCONS_00000187	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000190 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C     8       0.108
+  max. Y    11       0.113
+  max. S     8       0.130
+  mean S     1-10    0.118
+       D     1-10    0.116   0.450   NO
+Name=TCONS_00000190	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000191 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C     8       0.108
+  max. Y    11       0.113
+  max. S     8       0.130
+  mean S     1-10    0.118
+       D     1-10    0.116   0.450   NO
+Name=TCONS_00000191	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000192 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C     8       0.108
+  max. Y    11       0.113
+  max. S     8       0.130
+  mean S     1-10    0.118
+       D     1-10    0.116   0.450   NO
+Name=TCONS_00000192	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000199 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.110
+  max. Y    12       0.116
+  max. S     1       0.145
+  mean S     1-11    0.105
+       D     1-11    0.110   0.450   NO
+Name=TCONS_00000199	SP='NO' D=0.110 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000200 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.110
+  max. Y    12       0.116
+  max. S     1       0.145
+  mean S     1-11    0.105
+       D     1-11    0.110   0.450   NO
+Name=TCONS_00000200	SP='NO' D=0.110 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000201 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.110
+  max. Y    12       0.116
+  max. S     1       0.145
+  mean S     1-11    0.105
+       D     1-11    0.110   0.450   NO
+Name=TCONS_00000201	SP='NO' D=0.110 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000202 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.110
+  max. Y    12       0.116
+  max. S     1       0.145
+  mean S     1-11    0.105
+       D     1-11    0.110   0.450   NO
+Name=TCONS_00000202	SP='NO' D=0.110 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000203 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.110
+  max. Y    12       0.116
+  max. S     1       0.145
+  mean S     1-11    0.105
+       D     1-11    0.110   0.450   NO
+Name=TCONS_00000203	SP='NO' D=0.110 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000204 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    61       0.128
+  max. Y    61       0.113
+  max. S    13       0.118
+  mean S     1-60    0.099
+       D     1-60    0.105   0.450   NO
+Name=TCONS_00000204	SP='NO' D=0.105 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000205 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.130
+  max. Y    23       0.141
+  max. S     7       0.192
+  mean S     1-22    0.152
+       D     1-22    0.147   0.450   NO
+Name=TCONS_00000205	SP='NO' D=0.147 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000206 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.130
+  max. Y    23       0.141
+  max. S     7       0.192
+  mean S     1-22    0.152
+       D     1-22    0.147   0.450   NO
+Name=TCONS_00000206	SP='NO' D=0.147 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000207 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.130
+  max. Y    23       0.139
+  max. S     7       0.187
+  mean S     1-22    0.149
+       D     1-22    0.145   0.450   NO
+Name=TCONS_00000207	SP='NO' D=0.145 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000208 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.130
+  max. Y    23       0.141
+  max. S     7       0.192
+  mean S     1-22    0.152
+       D     1-22    0.147   0.450   NO
+Name=TCONS_00000208	SP='NO' D=0.147 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000210 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C     8       0.111
+  max. Y    11       0.118
+  max. S     1       0.149
+  mean S     1-10    0.118
+       D     1-10    0.118   0.450   NO
+Name=TCONS_00000210	SP='NO' D=0.118 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000211 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.110
+  max. Y    11       0.107
+  max. S     1       0.115
+  mean S     1-10    0.097
+       D     1-10    0.101   0.450   NO
+Name=TCONS_00000211	SP='NO' D=0.101 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000215 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    69       0.107
+  max. Y    69       0.105
+  max. S    48       0.120
+  mean S     1-68    0.094
+       D     1-68    0.099   0.450   NO
+Name=TCONS_00000215	SP='NO' D=0.099 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000216 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    69       0.107
+  max. Y    69       0.105
+  max. S    48       0.120
+  mean S     1-68    0.094
+       D     1-68    0.099   0.450   NO
+Name=TCONS_00000216	SP='NO' D=0.099 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000219 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.164
+  max. Y    18       0.231
+  max. S    11       0.418
+  mean S     1-17    0.320
+       D     1-17    0.266   0.500   NO
+Name=TCONS_00000219	SP='NO' D=0.266 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000220 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.164
+  max. Y    18       0.231
+  max. S    11       0.418
+  mean S     1-17    0.320
+       D     1-17    0.266   0.500   NO
+Name=TCONS_00000220	SP='NO' D=0.266 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000221 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    56       0.112
+  max. Y    29       0.107
+  max. S    37       0.135
+  mean S     1-28    0.106
+       D     1-28    0.106   0.450   NO
+Name=TCONS_00000221	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000222 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    56       0.112
+  max. Y    29       0.107
+  max. S    37       0.135
+  mean S     1-28    0.106
+       D     1-28    0.106   0.450   NO
+Name=TCONS_00000222	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000223 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    56       0.112
+  max. Y    29       0.107
+  max. S    37       0.135
+  mean S     1-28    0.106
+       D     1-28    0.106   0.450   NO
+Name=TCONS_00000223	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000230 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    38       0.148
+  max. Y    38       0.159
+  max. S    31       0.278
+  mean S     1-37    0.164
+       D     1-37    0.162   0.450   NO
+Name=TCONS_00000230	SP='NO' D=0.162 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000231 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    40       0.121
+  max. Y    40       0.142
+  max. S    34       0.227
+  mean S     1-39    0.145
+       D     1-39    0.143   0.450   NO
+Name=TCONS_00000231	SP='NO' D=0.143 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000232 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    54       0.113
+  max. Y    69       0.104
+  max. S    59       0.113
+  mean S     1-68    0.100
+       D     1-68    0.102   0.450   NO
+Name=TCONS_00000232	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000234 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.108
+  max. Y    12       0.105
+  max. S    17       0.112
+  mean S     1-11    0.100
+       D     1-11    0.102   0.450   NO
+Name=TCONS_00000234	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000235 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.108
+  max. Y    12       0.105
+  max. S    17       0.112
+  mean S     1-11    0.100
+       D     1-11    0.102   0.450   NO
+Name=TCONS_00000235	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000236 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.108
+  max. Y    12       0.105
+  max. S    17       0.112
+  mean S     1-11    0.100
+       D     1-11    0.102   0.450   NO
+Name=TCONS_00000236	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000237 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.108
+  max. Y    12       0.105
+  max. S    17       0.112
+  mean S     1-11    0.100
+       D     1-11    0.102   0.450   NO
+Name=TCONS_00000237	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000240 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.108
+  max. Y    12       0.105
+  max. S    17       0.112
+  mean S     1-11    0.100
+       D     1-11    0.102   0.450   NO
+Name=TCONS_00000240	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000245 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    32       0.118
+  max. Y    32       0.110
+  max. S    35       0.150
+  mean S     1-31    0.104
+       D     1-31    0.107   0.450   NO
+Name=TCONS_00000245	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000246 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    32       0.118
+  max. Y    32       0.110
+  max. S    35       0.150
+  mean S     1-31    0.104
+       D     1-31    0.107   0.450   NO
+Name=TCONS_00000246	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000248 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    55       0.275
+  max. Y    55       0.200
+  max. S    49       0.315
+  mean S     1-54    0.127
+       D     1-54    0.161   0.450   NO
+Name=TCONS_00000248	SP='NO' D=0.161 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000250 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    48       0.118
+  max. Y    24       0.116
+  max. S    18       0.161
+  mean S     1-23    0.118
+       D     1-23    0.117   0.450   NO
+Name=TCONS_00000250	SP='NO' D=0.117 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000251 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    38       0.132
+  max. Y    38       0.120
+  max. S    35       0.146
+  mean S     1-37    0.112
+       D     1-37    0.116   0.450   NO
+Name=TCONS_00000251	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000252 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.112
+  max. Y    24       0.110
+  max. S    46       0.118
+  mean S     1-23    0.107
+       D     1-23    0.108   0.450   NO
+Name=TCONS_00000252	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000265 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.182
+  max. Y    24       0.152
+  max. S    23       0.283
+  mean S     1-23    0.129
+       D     1-23    0.140   0.450   NO
+Name=TCONS_00000265	SP='NO' D=0.140 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000266 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.182
+  max. Y    24       0.152
+  max. S    23       0.283
+  mean S     1-23    0.129
+       D     1-23    0.140   0.450   NO
+Name=TCONS_00000266	SP='NO' D=0.140 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000267 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.182
+  max. Y    24       0.152
+  max. S    23       0.283
+  mean S     1-23    0.129
+       D     1-23    0.140   0.450   NO
+Name=TCONS_00000267	SP='NO' D=0.140 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000268 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.182
+  max. Y    24       0.152
+  max. S    23       0.283
+  mean S     1-23    0.129
+       D     1-23    0.140   0.450   NO
+Name=TCONS_00000268	SP='NO' D=0.140 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000269 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.182
+  max. Y    24       0.152
+  max. S    23       0.283
+  mean S     1-23    0.129
+       D     1-23    0.140   0.450   NO
+Name=TCONS_00000269	SP='NO' D=0.140 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000270 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.182
+  max. Y    24       0.152
+  max. S    23       0.283
+  mean S     1-23    0.129
+       D     1-23    0.140   0.450   NO
+Name=TCONS_00000270	SP='NO' D=0.140 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000271 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.152
+  max. Y    41       0.221
+  max. S    10       0.596
+  mean S     1-40    0.331
+       D     1-40    0.265   0.500   NO
+Name=TCONS_00000271	SP='NO' D=0.265 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000283 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.146
+  max. Y    11       0.205
+  max. S     2       0.510
+  mean S     1-10    0.390
+       D     1-10    0.279   0.500   NO
+Name=TCONS_00000283	SP='NO' D=0.279 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000284 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.227
+  max. Y    20       0.273
+  max. S     1       0.570
+  mean S     1-19    0.289
+       D     1-19    0.282   0.450   NO
+Name=TCONS_00000284	SP='NO' D=0.282 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000285 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.227
+  max. Y    20       0.273
+  max. S     1       0.570
+  mean S     1-19    0.289
+       D     1-19    0.282   0.450   NO
+Name=TCONS_00000285	SP='NO' D=0.282 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000286 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.227
+  max. Y    20       0.273
+  max. S     1       0.570
+  mean S     1-19    0.289
+       D     1-19    0.282   0.450   NO
+Name=TCONS_00000286	SP='NO' D=0.282 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000287 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.227
+  max. Y    20       0.273
+  max. S     1       0.570
+  mean S     1-19    0.289
+       D     1-19    0.282   0.450   NO
+Name=TCONS_00000287	SP='NO' D=0.282 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000288 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.140
+  max. Y    20       0.184
+  max. S    19       0.345
+  mean S     1-19    0.291
+       D     1-19    0.227   0.500   NO
+Name=TCONS_00000288	SP='NO' D=0.227 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000298 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    63       0.108
+  max. Y    21       0.108
+  max. S     3       0.129
+  mean S     1-20    0.108
+       D     1-20    0.108   0.450   NO
+Name=TCONS_00000298	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000299 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    63       0.108
+  max. Y    21       0.108
+  max. S     3       0.129
+  mean S     1-20    0.108
+       D     1-20    0.108   0.450   NO
+Name=TCONS_00000299	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000301 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.632
+  max. Y    19       0.770
+  max. S    12       0.970
+  mean S     1-18    0.934
+       D     1-18    0.859   0.450   YES
+Name=TCONS_00000301	SP='YES' Cleavage site between pos. 18 and 19: LRA-FP D=0.859 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000302 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.127
+  max. Y    12       0.182
+  max. S     1       0.348
+  mean S     1-11    0.269
+       D     1-11    0.229   0.450   NO
+Name=TCONS_00000302	SP='NO' D=0.229 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000303 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    46       0.110
+  max. Y    30       0.110
+  max. S    13       0.134
+  mean S     1-29    0.112
+       D     1-29    0.111   0.450   NO
+Name=TCONS_00000303	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000304 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    46       0.110
+  max. Y    30       0.110
+  max. S    13       0.134
+  mean S     1-29    0.112
+       D     1-29    0.111   0.450   NO
+Name=TCONS_00000304	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000305 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.754
+  max. Y    23       0.829
+  max. S    13       0.964
+  mean S     1-22    0.911
+       D     1-22    0.873   0.450   YES
+Name=TCONS_00000305	SP='YES' Cleavage site between pos. 22 and 23: AHA-LP D=0.873 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000306 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.147
+  max. Y    30       0.120
+  max. S     1       0.135
+  mean S     1-29    0.103
+       D     1-29    0.111   0.450   NO
+Name=TCONS_00000306	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000307 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.754
+  max. Y    23       0.829
+  max. S    13       0.964
+  mean S     1-22    0.911
+       D     1-22    0.873   0.450   YES
+Name=TCONS_00000307	SP='YES' Cleavage site between pos. 22 and 23: AHA-LP D=0.873 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000308 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.125
+  max. Y    16       0.150
+  max. S     5       0.231
+  mean S     1-15    0.183
+       D     1-15    0.168   0.450   NO
+Name=TCONS_00000308	SP='NO' D=0.168 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000309 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.125
+  max. Y    16       0.150
+  max. S     5       0.231
+  mean S     1-15    0.183
+       D     1-15    0.168   0.450   NO
+Name=TCONS_00000309	SP='NO' D=0.168 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000310 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.110
+  max. Y    12       0.119
+  max. S    21       0.227
+  mean S     1-11    0.118
+       D     1-11    0.118   0.450   NO
+Name=TCONS_00000310	SP='NO' D=0.118 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000311 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.131
+  max. Y    25       0.128
+  max. S    32       0.234
+  mean S     1-24    0.123
+       D     1-24    0.125   0.450   NO
+Name=TCONS_00000311	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000312 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    27       0.125
+  max. Y    12       0.120
+  max. S     1       0.158
+  mean S     1-11    0.126
+       D     1-11    0.123   0.450   NO
+Name=TCONS_00000312	SP='NO' D=0.123 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000313 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    37       0.116
+  max. Y    11       0.139
+  max. S     1       0.195
+  mean S     1-10    0.167
+       D     1-10    0.154   0.450   NO
+Name=TCONS_00000313	SP='NO' D=0.154 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000339 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.114
+  max. Y    67       0.104
+  max. S    57       0.112
+  mean S     1-66    0.098
+       D     1-66    0.101   0.450   NO
+Name=TCONS_00000339	SP='NO' D=0.101 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000340 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.114
+  max. Y    67       0.104
+  max. S    57       0.112
+  mean S     1-66    0.098
+       D     1-66    0.101   0.450   NO
+Name=TCONS_00000340	SP='NO' D=0.101 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000341 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.114
+  max. Y    67       0.104
+  max. S    57       0.112
+  mean S     1-66    0.098
+       D     1-66    0.101   0.450   NO
+Name=TCONS_00000341	SP='NO' D=0.101 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000342 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    31       0.108
+  max. Y    19       0.110
+  max. S     2       0.137
+  mean S     1-18    0.111
+       D     1-18    0.111   0.450   NO
+Name=TCONS_00000342	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000343 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    32       0.111
+  max. Y    52       0.117
+  max. S    45       0.142
+  mean S     1-51    0.107
+       D     1-51    0.111   0.450   NO
+Name=TCONS_00000343	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000344 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    32       0.120
+  max. Y    57       0.110
+  max. S    39       0.128
+  mean S     1-56    0.103
+       D     1-56    0.107   0.450   NO
+Name=TCONS_00000344	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000345 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.112
+  max. Y    17       0.122
+  max. S    49       0.193
+  mean S     1-16    0.133
+       D     1-16    0.128   0.450   NO
+Name=TCONS_00000345	SP='NO' D=0.128 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000348 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.112
+  max. Y    13       0.108
+  max. S    11       0.121
+  mean S     1-12    0.109
+       D     1-12    0.109   0.450   NO
+Name=TCONS_00000348	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000349 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.112
+  max. Y    13       0.108
+  max. S    11       0.121
+  mean S     1-12    0.109
+       D     1-12    0.109   0.450   NO
+Name=TCONS_00000349	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000350 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.112
+  max. Y    13       0.108
+  max. S    11       0.121
+  mean S     1-12    0.109
+       D     1-12    0.109   0.450   NO
+Name=TCONS_00000350	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000351 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.113
+  max. Y    34       0.109
+  max. S    10       0.124
+  mean S     1-33    0.108
+       D     1-33    0.109   0.450   NO
+Name=TCONS_00000351	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000352 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    48       0.110
+  max. Y    48       0.106
+  max. S    38       0.118
+  mean S     1-47    0.098
+       D     1-47    0.102   0.450   NO
+Name=TCONS_00000352	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000353 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    48       0.110
+  max. Y    48       0.106
+  max. S    38       0.118
+  mean S     1-47    0.098
+       D     1-47    0.102   0.450   NO
+Name=TCONS_00000353	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000354 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    48       0.110
+  max. Y    48       0.106
+  max. S    38       0.118
+  mean S     1-47    0.098
+       D     1-47    0.102   0.450   NO
+Name=TCONS_00000354	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000355 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.115
+  max. Y    39       0.137
+  max. S    33       0.308
+  mean S     1-38    0.138
+       D     1-38    0.138   0.450   NO
+Name=TCONS_00000355	SP='NO' D=0.138 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000356 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.246
+  max. Y    41       0.264
+  max. S    36       0.564
+  mean S     1-40    0.256
+       D     1-40    0.261   0.500   NO
+Name=TCONS_00000356	SP='NO' D=0.261 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000357 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.246
+  max. Y    41       0.264
+  max. S    36       0.564
+  mean S     1-40    0.256
+       D     1-40    0.261   0.500   NO
+Name=TCONS_00000357	SP='NO' D=0.261 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000358 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.246
+  max. Y    41       0.264
+  max. S    36       0.564
+  mean S     1-40    0.256
+       D     1-40    0.261   0.500   NO
+Name=TCONS_00000358	SP='NO' D=0.261 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000359 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.246
+  max. Y    41       0.264
+  max. S    36       0.564
+  mean S     1-40    0.256
+       D     1-40    0.261   0.500   NO
+Name=TCONS_00000359	SP='NO' D=0.261 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000360 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.246
+  max. Y    41       0.264
+  max. S    36       0.564
+  mean S     1-40    0.256
+       D     1-40    0.261   0.500   NO
+Name=TCONS_00000360	SP='NO' D=0.261 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000372 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.629
+  max. Y    26       0.557
+  max. S    24       0.746
+  mean S     1-25    0.522
+       D     1-25    0.543   0.500   YES
+Name=TCONS_00000372	SP='YES' Cleavage site between pos. 25 and 26: LSA-LD D=0.543 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000373 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.629
+  max. Y    26       0.557
+  max. S    24       0.746
+  mean S     1-25    0.522
+       D     1-25    0.543   0.500   YES
+Name=TCONS_00000373	SP='YES' Cleavage site between pos. 25 and 26: LSA-LD D=0.543 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000374 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.118
+  max. Y    11       0.129
+  max. S     1       0.186
+  mean S     1-10    0.127
+       D     1-10    0.128   0.450   NO
+Name=TCONS_00000374	SP='NO' D=0.128 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000385 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.135
+  max. Y    28       0.143
+  max. S    25       0.261
+  mean S     1-27    0.148
+       D     1-27    0.146   0.450   NO
+Name=TCONS_00000385	SP='NO' D=0.146 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000386 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.135
+  max. Y    28       0.143
+  max. S    25       0.261
+  mean S     1-27    0.148
+       D     1-27    0.146   0.450   NO
+Name=TCONS_00000386	SP='NO' D=0.146 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000388 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.135
+  max. Y    28       0.143
+  max. S    25       0.261
+  mean S     1-27    0.148
+       D     1-27    0.146   0.450   NO
+Name=TCONS_00000388	SP='NO' D=0.146 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000389 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.135
+  max. Y    28       0.143
+  max. S    25       0.261
+  mean S     1-27    0.148
+       D     1-27    0.146   0.450   NO
+Name=TCONS_00000389	SP='NO' D=0.146 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000390 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.141
+  max. Y    20       0.116
+  max. S    55       0.115
+  mean S     1-19    0.095
+       D     1-19    0.104   0.450   NO
+Name=TCONS_00000390	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000391 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.672
+  max. Y    19       0.310
+  max. S    46       0.336
+  mean S     1-18    0.144
+       D     1-18    0.221   0.450   NO
+Name=TCONS_00000391	SP='NO' D=0.221 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000397 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    66       0.119
+  max. Y    66       0.110
+  max. S    66       0.157
+  mean S     1-65    0.096
+       D     1-65    0.105   0.500   NO
+Name=TCONS_00000397	SP='NO' D=0.105 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000401 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    16       0.116
+  max. Y    16       0.122
+  max. S    13       0.188
+  mean S     1-15    0.123
+       D     1-15    0.122   0.450   NO
+Name=TCONS_00000401	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000411 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    68       0.145
+  max. Y    68       0.125
+  max. S     1       0.173
+  mean S     1-67    0.107
+       D     1-67    0.115   0.450   NO
+Name=TCONS_00000411	SP='NO' D=0.115 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000412 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.114
+  max. Y    12       0.125
+  max. S     1       0.178
+  mean S     1-11    0.115
+       D     1-11    0.120   0.450   NO
+Name=TCONS_00000412	SP='NO' D=0.120 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000413 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.112
+  max. Y    51       0.110
+  max. S    44       0.127
+  mean S     1-50    0.105
+       D     1-50    0.107   0.450   NO
+Name=TCONS_00000413	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000414 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    56       0.189
+  max. Y    12       0.213
+  max. S     1       0.492
+  mean S     1-11    0.369
+       D     1-11    0.297   0.450   NO
+Name=TCONS_00000414	SP='NO' D=0.297 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000415 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.114
+  max. Y    12       0.125
+  max. S     1       0.178
+  mean S     1-11    0.115
+       D     1-11    0.120   0.450   NO
+Name=TCONS_00000415	SP='NO' D=0.120 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000416 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.190
+  max. Y    57       0.163
+  max. S     6       0.192
+  mean S     1-56    0.130
+       D     1-56    0.145   0.450   NO
+Name=TCONS_00000416	SP='NO' D=0.145 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000417 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.162
+  max. Y    23       0.210
+  max. S     2       0.372
+  mean S     1-22    0.272
+       D     1-22    0.243   0.450   NO
+Name=TCONS_00000417	SP='NO' D=0.243 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000418 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.118
+  max. Y    26       0.126
+  max. S     8       0.193
+  mean S     1-25    0.132
+       D     1-25    0.129   0.450   NO
+Name=TCONS_00000418	SP='NO' D=0.129 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000420 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.133
+  max. Y    29       0.122
+  max. S     2       0.155
+  mean S     1-28    0.115
+       D     1-28    0.118   0.450   NO
+Name=TCONS_00000420	SP='NO' D=0.118 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000421 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.122
+  max. Y    18       0.108
+  max. S    32       0.117
+  mean S     1-17    0.096
+       D     1-17    0.102   0.450   NO
+Name=TCONS_00000421	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000422 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.132
+  max. Y    19       0.112
+  max. S    32       0.121
+  mean S     1-18    0.097
+       D     1-18    0.104   0.450   NO
+Name=TCONS_00000422	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000453 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    61       0.147
+  max. Y    19       0.141
+  max. S    10       0.269
+  mean S     1-18    0.178
+       D     1-18    0.156   0.500   NO
+Name=TCONS_00000453	SP='NO' D=0.156 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000454 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.336
+  max. Y    19       0.388
+  max. S     1       0.565
+  mean S     1-18    0.460
+       D     1-18    0.417   0.500   NO
+Name=TCONS_00000454	SP='NO' D=0.417 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000455 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    61       0.147
+  max. Y    19       0.141
+  max. S    10       0.269
+  mean S     1-18    0.178
+       D     1-18    0.156   0.500   NO
+Name=TCONS_00000455	SP='NO' D=0.156 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000456 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    35       0.406
+  max. Y    35       0.419
+  max. S    32       0.705
+  mean S     1-34    0.296
+       D     1-34    0.370   0.500   NO
+Name=TCONS_00000456	SP='NO' D=0.370 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000457 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    35       0.406
+  max. Y    35       0.419
+  max. S    32       0.705
+  mean S     1-34    0.296
+       D     1-34    0.370   0.500   NO
+Name=TCONS_00000457	SP='NO' D=0.370 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000480 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.232
+  max. Y    17       0.223
+  max. S     2       0.587
+  mean S     1-16    0.308
+       D     1-16    0.269   0.450   NO
+Name=TCONS_00000480	SP='NO' D=0.269 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000481 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    43       0.161
+  max. Y    46       0.172
+  max. S    42       0.365
+  mean S     1-45    0.170
+       D     1-45    0.171   0.450   NO
+Name=TCONS_00000481	SP='NO' D=0.171 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000493 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.306
+  max. Y    26       0.505
+  max. S    17       0.936
+  mean S     1-25    0.831
+       D     1-25    0.681   0.450   YES
+Name=TCONS_00000493	SP='YES' Cleavage site between pos. 25 and 26: ATA-LE D=0.681 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000494 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    38       0.163
+  max. Y    38       0.131
+  max. S    10       0.165
+  mean S     1-37    0.116
+       D     1-37    0.123   0.450   NO
+Name=TCONS_00000494	SP='NO' D=0.123 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000501 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    55       0.115
+  max. Y    12       0.143
+  max. S     1       0.239
+  mean S     1-11    0.150
+       D     1-11    0.147   0.450   NO
+Name=TCONS_00000501	SP='NO' D=0.147 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000502 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    55       0.115
+  max. Y    12       0.143
+  max. S     1       0.239
+  mean S     1-11    0.150
+       D     1-11    0.147   0.450   NO
+Name=TCONS_00000502	SP='NO' D=0.147 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000503 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    55       0.115
+  max. Y    12       0.143
+  max. S     1       0.239
+  mean S     1-11    0.150
+       D     1-11    0.147   0.450   NO
+Name=TCONS_00000503	SP='NO' D=0.147 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000504 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    50       0.126
+  max. Y    50       0.124
+  max. S    46       0.192
+  mean S     1-49    0.110
+       D     1-49    0.116   0.450   NO
+Name=TCONS_00000504	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000505 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    52       0.110
+  max. Y    12       0.141
+  max. S     1       0.231
+  mean S     1-11    0.147
+       D     1-11    0.144   0.450   NO
+Name=TCONS_00000505	SP='NO' D=0.144 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000506 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    49       0.110
+  max. Y    11       0.110
+  max. S     4       0.157
+  mean S     1-10    0.120
+       D     1-10    0.116   0.450   NO
+Name=TCONS_00000506	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000507 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    59       0.131
+  max. Y    54       0.185
+  max. S    42       0.422
+  mean S     1-53    0.168
+       D     1-53    0.176   0.450   NO
+Name=TCONS_00000507	SP='NO' D=0.176 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000508 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    59       0.131
+  max. Y    54       0.185
+  max. S    42       0.422
+  mean S     1-53    0.168
+       D     1-53    0.176   0.450   NO
+Name=TCONS_00000508	SP='NO' D=0.176 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000509 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    59       0.131
+  max. Y    54       0.185
+  max. S    42       0.422
+  mean S     1-53    0.168
+       D     1-53    0.176   0.450   NO
+Name=TCONS_00000509	SP='NO' D=0.176 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000511 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.466
+  max. Y    28       0.581
+  max. S     8       0.908
+  mean S     1-27    0.739
+       D     1-27    0.666   0.450   YES
+Name=TCONS_00000511	SP='YES' Cleavage site between pos. 27 and 28: VSA-AR D=0.666 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000512 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.466
+  max. Y    28       0.581
+  max. S     8       0.908
+  mean S     1-27    0.739
+       D     1-27    0.666   0.450   YES
+Name=TCONS_00000512	SP='YES' Cleavage site between pos. 27 and 28: VSA-AR D=0.666 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000519 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.388
+  max. Y    19       0.608
+  max. S    14       0.979
+  mean S     1-18    0.958
+       D     1-18    0.797   0.450   YES
+Name=TCONS_00000519	SP='YES' Cleavage site between pos. 18 and 19: LAA-VE D=0.797 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000520 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.388
+  max. Y    19       0.608
+  max. S    14       0.979
+  mean S     1-18    0.958
+       D     1-18    0.797   0.450   YES
+Name=TCONS_00000520	SP='YES' Cleavage site between pos. 18 and 19: LAA-VE D=0.797 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000521 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.388
+  max. Y    19       0.608
+  max. S    14       0.979
+  mean S     1-18    0.958
+       D     1-18    0.797   0.450   YES
+Name=TCONS_00000521	SP='YES' Cleavage site between pos. 18 and 19: LAA-VE D=0.797 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000531 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    37       0.235
+  max. Y    37       0.160
+  max. S     2       0.218
+  mean S     1-36    0.128
+       D     1-36    0.143   0.450   NO
+Name=TCONS_00000531	SP='NO' D=0.143 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000532 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    36       0.241
+  max. Y    36       0.162
+  max. S     1       0.227
+  mean S     1-35    0.129
+       D     1-35    0.144   0.450   NO
+Name=TCONS_00000532	SP='NO' D=0.144 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000533 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.316
+  max. Y    26       0.205
+  max. S    16       0.268
+  mean S     1-25    0.135
+       D     1-25    0.167   0.450   NO
+Name=TCONS_00000533	SP='NO' D=0.167 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000534 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.316
+  max. Y    26       0.205
+  max. S    16       0.268
+  mean S     1-25    0.135
+       D     1-25    0.167   0.450   NO
+Name=TCONS_00000534	SP='NO' D=0.167 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000538 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.148
+  max. Y    21       0.166
+  max. S     1       0.271
+  mean S     1-20    0.188
+       D     1-20    0.178   0.450   NO
+Name=TCONS_00000538	SP='NO' D=0.178 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000539 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.148
+  max. Y    21       0.166
+  max. S     1       0.271
+  mean S     1-20    0.188
+       D     1-20    0.178   0.450   NO
+Name=TCONS_00000539	SP='NO' D=0.178 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000540 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.148
+  max. Y    21       0.166
+  max. S     1       0.271
+  mean S     1-20    0.188
+       D     1-20    0.178   0.450   NO
+Name=TCONS_00000540	SP='NO' D=0.178 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000541 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.124
+  max. Y    19       0.124
+  max. S    47       0.162
+  mean S     1-18    0.123
+       D     1-18    0.124   0.450   NO
+Name=TCONS_00000541	SP='NO' D=0.124 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000544 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.111
+  max. Y    41       0.106
+  max. S    43       0.114
+  mean S     1-40    0.095
+       D     1-40    0.100   0.450   NO
+Name=TCONS_00000544	SP='NO' D=0.100 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000545 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.252
+  max. Y    18       0.386
+  max. S     1       0.794
+  mean S     1-17    0.530
+       D     1-17    0.464   0.450   YES
+Name=TCONS_00000545	SP='YES' Cleavage site between pos. 17 and 18: VRL-LK D=0.464 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000546 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    53       0.137
+  max. Y    53       0.114
+  max. S     1       0.130
+  mean S     1-52    0.094
+       D     1-52    0.103   0.450   NO
+Name=TCONS_00000546	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000547 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.178
+  max. Y    20       0.142
+  max. S    19       0.267
+  mean S     1-19    0.117
+       D     1-19    0.132   0.500   NO
+Name=TCONS_00000547	SP='NO' D=0.132 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000548 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.178
+  max. Y    20       0.142
+  max. S    19       0.267
+  mean S     1-19    0.117
+       D     1-19    0.132   0.500   NO
+Name=TCONS_00000548	SP='NO' D=0.132 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000549 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.178
+  max. Y    20       0.142
+  max. S    19       0.267
+  mean S     1-19    0.117
+       D     1-19    0.132   0.500   NO
+Name=TCONS_00000549	SP='NO' D=0.132 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000550 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.283
+  max. Y    26       0.259
+  max. S     5       0.445
+  mean S     1-25    0.303
+       D     1-25    0.276   0.500   NO
+Name=TCONS_00000550	SP='NO' D=0.276 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00000558 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    12       0.140
+  max. Y    12       0.111
+  max. S    12       0.124
+  mean S     1-11    0.098
+       D     1-11    0.104   0.450   NO
+Name=TCONS_00000558	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000559 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    12       0.140
+  max. Y    12       0.111
+  max. S    12       0.124
+  mean S     1-11    0.098
+       D     1-11    0.104   0.450   NO
+Name=TCONS_00000559	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000560 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.120
+  max. Y    12       0.115
+  max. S     1       0.142
+  mean S     1-11    0.112
+       D     1-11    0.113   0.450   NO
+Name=TCONS_00000560	SP='NO' D=0.113 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00000561 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    16       0.123
+  max. Y    16       0.132
+  max. S     7       0.250
+  mean S     1-15    0.155
+       D     1-15    0.144   0.450   NO
+Name=TCONS_00000561	SP='NO' D=0.144 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003841 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    69       0.124
+  max. Y    16       0.161
+  max. S    21       0.337
+  mean S     1-15    0.226
+       D     1-15    0.196   0.450   NO
+Name=TCONS_00003841	SP='NO' D=0.196 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003842 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.113
+  max. Y    11       0.142
+  max. S     1       0.214
+  mean S     1-10    0.143
+       D     1-10    0.143   0.450   NO
+Name=TCONS_00003842	SP='NO' D=0.143 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003843 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.113
+  max. Y    11       0.142
+  max. S     1       0.214
+  mean S     1-10    0.143
+       D     1-10    0.143   0.450   NO
+Name=TCONS_00003843	SP='NO' D=0.143 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003844 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.113
+  max. Y    11       0.145
+  max. S     1       0.227
+  mean S     1-10    0.149
+       D     1-10    0.148   0.450   NO
+Name=TCONS_00003844	SP='NO' D=0.148 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003865 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    37       0.116
+  max. Y    56       0.108
+  max. S    46       0.119
+  mean S     1-55    0.100
+       D     1-55    0.104   0.450   NO
+Name=TCONS_00003865	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003866 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    37       0.577
+  max. Y    37       0.593
+  max. S    27       0.813
+  mean S     1-36    0.606
+       D     1-36    0.598   0.500   YES
+Name=TCONS_00003866	SP='YES' Cleavage site between pos. 36 and 37: ASA-RP D=0.598 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00003867 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    37       0.577
+  max. Y    37       0.593
+  max. S    27       0.813
+  mean S     1-36    0.606
+       D     1-36    0.598   0.500   YES
+Name=TCONS_00003867	SP='YES' Cleavage site between pos. 36 and 37: ASA-RP D=0.598 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00003869 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    37       0.577
+  max. Y    37       0.593
+  max. S    27       0.813
+  mean S     1-36    0.606
+       D     1-36    0.598   0.500   YES
+Name=TCONS_00003869	SP='YES' Cleavage site between pos. 36 and 37: ASA-RP D=0.598 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00003870 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    46       0.109
+  max. Y    46       0.107
+  max. S    24       0.121
+  mean S     1-45    0.102
+       D     1-45    0.104   0.450   NO
+Name=TCONS_00003870	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003880 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    32       0.115
+  max. Y    32       0.113
+  max. S    11       0.157
+  mean S     1-31    0.115
+       D     1-31    0.114   0.450   NO
+Name=TCONS_00003880	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003881 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.148
+  max. Y    29       0.137
+  max. S    18       0.156
+  mean S     1-28    0.127
+       D     1-28    0.131   0.450   NO
+Name=TCONS_00003881	SP='NO' D=0.131 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003882 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    50       0.109
+  max. Y    68       0.103
+  max. S    46       0.118
+  mean S     1-67    0.096
+       D     1-67    0.099   0.450   NO
+Name=TCONS_00003882	SP='NO' D=0.099 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003884 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    46       0.117
+  max. Y    46       0.108
+  max. S    23       0.118
+  mean S     1-45    0.099
+       D     1-45    0.103   0.450   NO
+Name=TCONS_00003884	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003885 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.111
+  max. Y    14       0.114
+  max. S     4       0.144
+  mean S     1-13    0.124
+       D     1-13    0.119   0.450   NO
+Name=TCONS_00003885	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003886 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.236
+  max. Y    19       0.222
+  max. S    12       0.322
+  mean S     1-18    0.213
+       D     1-18    0.217   0.450   NO
+Name=TCONS_00003886	SP='NO' D=0.217 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003887 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    47       0.115
+  max. Y    21       0.118
+  max. S    45       0.239
+  mean S     1-20    0.121
+       D     1-20    0.120   0.450   NO
+Name=TCONS_00003887	SP='NO' D=0.120 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003888 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.112
+  max. Y    14       0.114
+  max. S     4       0.143
+  mean S     1-13    0.123
+       D     1-13    0.119   0.450   NO
+Name=TCONS_00003888	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003891 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    38       0.114
+  max. Y    38       0.107
+  max. S    16       0.124
+  mean S     1-37    0.096
+       D     1-37    0.101   0.450   NO
+Name=TCONS_00003891	SP='NO' D=0.101 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003892 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.111
+  max. Y    14       0.114
+  max. S     4       0.144
+  mean S     1-13    0.124
+       D     1-13    0.119   0.450   NO
+Name=TCONS_00003892	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003893 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    48       0.168
+  max. Y    48       0.127
+  max. S    12       0.130
+  mean S     1-47    0.101
+       D     1-47    0.113   0.450   NO
+Name=TCONS_00003893	SP='NO' D=0.113 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003894 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.254
+  max. Y    17       0.160
+  max. S     2       0.157
+  mean S     1-16    0.098
+       D     1-16    0.126   0.450   NO
+Name=TCONS_00003894	SP='NO' D=0.126 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003895 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.111
+  max. Y    14       0.114
+  max. S     4       0.144
+  mean S     1-13    0.124
+       D     1-13    0.119   0.450   NO
+Name=TCONS_00003895	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003896 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.254
+  max. Y    17       0.160
+  max. S     2       0.157
+  mean S     1-16    0.098
+       D     1-16    0.126   0.450   NO
+Name=TCONS_00003896	SP='NO' D=0.126 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003897 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    54       0.126
+  max. Y    12       0.119
+  max. S     1       0.153
+  mean S     1-11    0.105
+       D     1-11    0.111   0.450   NO
+Name=TCONS_00003897	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003899 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    45       0.181
+  max. Y    45       0.130
+  max. S    44       0.120
+  mean S     1-44    0.093
+       D     1-44    0.110   0.450   NO
+Name=TCONS_00003899	SP='NO' D=0.110 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003900 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.119
+  max. Y    11       0.140
+  max. S     1       0.211
+  mean S     1-10    0.168
+       D     1-10    0.155   0.450   NO
+Name=TCONS_00003900	SP='NO' D=0.155 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003901 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.177
+  max. Y    20       0.405
+  max. S    15       0.978
+  mean S     1-19    0.928
+       D     1-19    0.687   0.450   YES
+Name=TCONS_00003901	SP='YES' Cleavage site between pos. 19 and 20: SSA-VL D=0.687 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003902 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.177
+  max. Y    20       0.405
+  max. S    15       0.978
+  mean S     1-19    0.928
+       D     1-19    0.687   0.450   YES
+Name=TCONS_00003902	SP='YES' Cleavage site between pos. 19 and 20: SSA-VL D=0.687 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003903 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    32       0.189
+  max. Y    20       0.409
+  max. S    15       0.981
+  mean S     1-19    0.938
+       D     1-19    0.695   0.450   YES
+Name=TCONS_00003903	SP='YES' Cleavage site between pos. 19 and 20: SSA-VL D=0.695 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003904 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.177
+  max. Y    20       0.405
+  max. S    15       0.978
+  mean S     1-19    0.928
+       D     1-19    0.687   0.450   YES
+Name=TCONS_00003904	SP='YES' Cleavage site between pos. 19 and 20: SSA-VL D=0.687 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003905 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.177
+  max. Y    25       0.267
+  max. S    20       0.514
+  mean S     1-24    0.401
+       D     1-24    0.340   0.450   NO
+Name=TCONS_00003905	SP='NO' D=0.340 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003911 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.157
+  max. Y    30       0.133
+  max. S     3       0.148
+  mean S     1-29    0.119
+       D     1-29    0.125   0.450   NO
+Name=TCONS_00003911	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003912 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.157
+  max. Y    30       0.133
+  max. S     3       0.148
+  mean S     1-29    0.119
+       D     1-29    0.125   0.450   NO
+Name=TCONS_00003912	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003913 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.145
+  max. Y    20       0.178
+  max. S     2       0.303
+  mean S     1-19    0.216
+       D     1-19    0.198   0.450   NO
+Name=TCONS_00003913	SP='NO' D=0.198 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003914 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.145
+  max. Y    20       0.178
+  max. S     2       0.303
+  mean S     1-19    0.216
+       D     1-19    0.198   0.450   NO
+Name=TCONS_00003914	SP='NO' D=0.198 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003915 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.157
+  max. Y    30       0.133
+  max. S     3       0.148
+  mean S     1-29    0.119
+       D     1-29    0.125   0.450   NO
+Name=TCONS_00003915	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003916 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.157
+  max. Y    30       0.133
+  max. S     3       0.148
+  mean S     1-29    0.119
+       D     1-29    0.125   0.450   NO
+Name=TCONS_00003916	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003919 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    47       0.113
+  max. Y    47       0.138
+  max. S    46       0.245
+  mean S     1-46    0.142
+       D     1-46    0.140   0.450   NO
+Name=TCONS_00003919	SP='NO' D=0.140 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003920 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    43       0.111
+  max. Y    17       0.109
+  max. S    41       0.119
+  mean S     1-16    0.110
+       D     1-16    0.109   0.450   NO
+Name=TCONS_00003920	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003921 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    43       0.111
+  max. Y    17       0.109
+  max. S    41       0.119
+  mean S     1-16    0.110
+       D     1-16    0.109   0.450   NO
+Name=TCONS_00003921	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003923 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.176
+  max. Y    23       0.137
+  max. S    21       0.164
+  mean S     1-22    0.107
+       D     1-22    0.121   0.450   NO
+Name=TCONS_00003923	SP='NO' D=0.121 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003924 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.176
+  max. Y    23       0.137
+  max. S    21       0.164
+  mean S     1-22    0.107
+       D     1-22    0.121   0.450   NO
+Name=TCONS_00003924	SP='NO' D=0.121 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003925 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.176
+  max. Y    23       0.137
+  max. S    21       0.164
+  mean S     1-22    0.107
+       D     1-22    0.121   0.450   NO
+Name=TCONS_00003925	SP='NO' D=0.121 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003937 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    45       0.109
+  max. Y    32       0.107
+  max. S    23       0.121
+  mean S     1-31    0.101
+       D     1-31    0.104   0.450   NO
+Name=TCONS_00003937	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003938 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.149
+  max. Y    19       0.190
+  max. S     3       0.451
+  mean S     1-18    0.212
+       D     1-18    0.202   0.450   NO
+Name=TCONS_00003938	SP='NO' D=0.202 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003939 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    45       0.109
+  max. Y    32       0.107
+  max. S    23       0.121
+  mean S     1-31    0.101
+       D     1-31    0.104   0.450   NO
+Name=TCONS_00003939	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003940 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    45       0.109
+  max. Y    32       0.107
+  max. S    23       0.121
+  mean S     1-31    0.101
+       D     1-31    0.104   0.450   NO
+Name=TCONS_00003940	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003941 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    45       0.109
+  max. Y    32       0.107
+  max. S    23       0.121
+  mean S     1-31    0.101
+       D     1-31    0.104   0.450   NO
+Name=TCONS_00003941	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003942 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    45       0.109
+  max. Y    32       0.107
+  max. S    23       0.121
+  mean S     1-31    0.101
+       D     1-31    0.104   0.450   NO
+Name=TCONS_00003942	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003943 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    45       0.109
+  max. Y    32       0.107
+  max. S    23       0.121
+  mean S     1-31    0.101
+       D     1-31    0.104   0.450   NO
+Name=TCONS_00003943	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003959 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    45       0.109
+  max. Y    32       0.107
+  max. S    23       0.121
+  mean S     1-31    0.101
+       D     1-31    0.104   0.450   NO
+Name=TCONS_00003959	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003962 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    45       0.109
+  max. Y    32       0.107
+  max. S    23       0.121
+  mean S     1-31    0.101
+       D     1-31    0.104   0.450   NO
+Name=TCONS_00003962	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003963 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    38       0.182
+  max. Y    11       0.165
+  max. S     1       0.287
+  mean S     1-10    0.209
+       D     1-10    0.189   0.450   NO
+Name=TCONS_00003963	SP='NO' D=0.189 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003964 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.123
+  max. Y    34       0.111
+  max. S    34       0.129
+  mean S     1-33    0.102
+       D     1-33    0.106   0.450   NO
+Name=TCONS_00003964	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003965 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.123
+  max. Y    34       0.111
+  max. S    34       0.129
+  mean S     1-33    0.102
+       D     1-33    0.106   0.450   NO
+Name=TCONS_00003965	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003966 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.123
+  max. Y    34       0.111
+  max. S    34       0.129
+  mean S     1-33    0.102
+       D     1-33    0.106   0.450   NO
+Name=TCONS_00003966	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003967 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.123
+  max. Y    34       0.111
+  max. S    34       0.129
+  mean S     1-33    0.102
+       D     1-33    0.106   0.450   NO
+Name=TCONS_00003967	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003968 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.119
+  max. Y    19       0.123
+  max. S     1       0.157
+  mean S     1-18    0.121
+       D     1-18    0.122   0.450   NO
+Name=TCONS_00003968	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003984 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.110
+  max. Y    21       0.116
+  max. S    12       0.152
+  mean S     1-20    0.123
+       D     1-20    0.119   0.450   NO
+Name=TCONS_00003984	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003985 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.110
+  max. Y    21       0.119
+  max. S    12       0.203
+  mean S     1-20    0.131
+       D     1-20    0.125   0.450   NO
+Name=TCONS_00003985	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003987 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.110
+  max. Y    21       0.116
+  max. S    12       0.152
+  mean S     1-20    0.123
+       D     1-20    0.119   0.450   NO
+Name=TCONS_00003987	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00003988 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.112
+  max. Y    11       0.119
+  max. S     3       0.177
+  mean S     1-10    0.121
+       D     1-10    0.120   0.450   NO
+Name=TCONS_00003988	SP='NO' D=0.120 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004002 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    27       0.458
+  max. Y    27       0.503
+  max. S     1       0.801
+  mean S     1-26    0.609
+       D     1-26    0.546   0.500   YES
+Name=TCONS_00004002	SP='YES' Cleavage site between pos. 26 and 27: VAG-TH D=0.546 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004003 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    31       0.754
+  max. Y    31       0.830
+  max. S    28       0.959
+  mean S     1-30    0.905
+       D     1-30    0.870   0.450   YES
+Name=TCONS_00004003	SP='YES' Cleavage site between pos. 30 and 31: VGA-SV D=0.870 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004004 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.116
+  max. Y    25       0.138
+  max. S     7       0.232
+  mean S     1-24    0.168
+       D     1-24    0.154   0.450   NO
+Name=TCONS_00004004	SP='NO' D=0.154 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004005 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.116
+  max. Y    25       0.138
+  max. S     7       0.232
+  mean S     1-24    0.168
+       D     1-24    0.154   0.450   NO
+Name=TCONS_00004005	SP='NO' D=0.154 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004006 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    44       0.205
+  max. Y    26       0.232
+  max. S    13       0.419
+  mean S     1-25    0.281
+       D     1-25    0.259   0.450   NO
+Name=TCONS_00004006	SP='NO' D=0.259 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004010 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.133
+  max. Y    22       0.119
+  max. S     1       0.135
+  mean S     1-21    0.105
+       D     1-21    0.111   0.450   NO
+Name=TCONS_00004010	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004011 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.133
+  max. Y    22       0.119
+  max. S     1       0.135
+  mean S     1-21    0.105
+       D     1-21    0.111   0.450   NO
+Name=TCONS_00004011	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004012 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.133
+  max. Y    22       0.119
+  max. S     1       0.135
+  mean S     1-21    0.105
+       D     1-21    0.111   0.450   NO
+Name=TCONS_00004012	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004016 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.122
+  max. Y    22       0.126
+  max. S    20       0.214
+  mean S     1-21    0.130
+       D     1-21    0.128   0.450   NO
+Name=TCONS_00004016	SP='NO' D=0.128 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004017 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    47       0.164
+  max. Y    47       0.160
+  max. S     5       0.407
+  mean S     1-46    0.182
+       D     1-46    0.172   0.450   NO
+Name=TCONS_00004017	SP='NO' D=0.172 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004022 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    36       0.136
+  max. Y    36       0.125
+  max. S    35       0.208
+  mean S     1-35    0.114
+       D     1-35    0.119   0.450   NO
+Name=TCONS_00004022	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004023 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    70       0.127
+  max. Y    70       0.111
+  max. S    56       0.108
+  mean S     1-69    0.095
+       D     1-69    0.102   0.450   NO
+Name=TCONS_00004023	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004024 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    14       0.109
+  max. Y    41       0.108
+  max. S    28       0.122
+  mean S     1-40    0.099
+       D     1-40    0.103   0.450   NO
+Name=TCONS_00004024	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004025 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    48       0.111
+  max. Y    61       0.111
+  max. S    41       0.163
+  mean S     1-60    0.106
+       D     1-60    0.108   0.450   NO
+Name=TCONS_00004025	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004026 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.108
+  max. Y    11       0.118
+  max. S     1       0.148
+  mean S     1-10    0.115
+       D     1-10    0.117   0.450   NO
+Name=TCONS_00004026	SP='NO' D=0.117 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004027 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    57       0.109
+  max. Y    47       0.104
+  max. S    36       0.130
+  mean S     1-46    0.094
+       D     1-46    0.099   0.450   NO
+Name=TCONS_00004027	SP='NO' D=0.099 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004028 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    57       0.109
+  max. Y    47       0.104
+  max. S    36       0.130
+  mean S     1-46    0.094
+       D     1-46    0.099   0.450   NO
+Name=TCONS_00004028	SP='NO' D=0.099 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004033 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    35       0.118
+  max. Y    35       0.112
+  max. S    16       0.137
+  mean S     1-34    0.107
+       D     1-34    0.110   0.450   NO
+Name=TCONS_00004033	SP='NO' D=0.110 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004034 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.133
+  max. Y    20       0.162
+  max. S     1       0.274
+  mean S     1-19    0.184
+       D     1-19    0.174   0.450   NO
+Name=TCONS_00004034	SP='NO' D=0.174 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004035 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.270
+  max. Y    20       0.227
+  max. S    13       0.242
+  mean S     1-19    0.193
+       D     1-19    0.208   0.450   NO
+Name=TCONS_00004035	SP='NO' D=0.208 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004036 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    61       0.116
+  max. Y    61       0.107
+  max. S    36       0.120
+  mean S     1-60    0.098
+       D     1-60    0.102   0.450   NO
+Name=TCONS_00004036	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004037 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.131
+  max. Y    12       0.170
+  max. S     1       0.342
+  mean S     1-11    0.197
+       D     1-11    0.184   0.450   NO
+Name=TCONS_00004037	SP='NO' D=0.184 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004042 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.612
+  max. Y    25       0.747
+  max. S    18       0.949
+  mean S     1-24    0.914
+       D     1-24    0.837   0.450   YES
+Name=TCONS_00004042	SP='YES' Cleavage site between pos. 24 and 25: ARA-QG D=0.837 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004043 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.437
+  max. Y    21       0.412
+  max. S     2       0.837
+  mean S     1-20    0.642
+       D     1-20    0.504   0.500   YES
+Name=TCONS_00004043	SP='YES' Cleavage site between pos. 20 and 21: LLA-GL D=0.504 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004044 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.121
+  max. Y    19       0.132
+  max. S     1       0.186
+  mean S     1-18    0.134
+       D     1-18    0.133   0.450   NO
+Name=TCONS_00004044	SP='NO' D=0.133 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004046 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.616
+  max. Y    25       0.751
+  max. S    18       0.953
+  mean S     1-24    0.919
+       D     1-24    0.842   0.450   YES
+Name=TCONS_00004046	SP='YES' Cleavage site between pos. 24 and 25: ARA-QG D=0.842 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004049 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.616
+  max. Y    25       0.751
+  max. S    18       0.953
+  mean S     1-24    0.919
+       D     1-24    0.842   0.450   YES
+Name=TCONS_00004049	SP='YES' Cleavage site between pos. 24 and 25: ARA-QG D=0.842 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004051 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.616
+  max. Y    25       0.751
+  max. S    18       0.953
+  mean S     1-24    0.919
+       D     1-24    0.842   0.450   YES
+Name=TCONS_00004051	SP='YES' Cleavage site between pos. 24 and 25: ARA-QG D=0.842 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004052 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.117
+  max. Y    12       0.107
+  max. S    55       0.115
+  mean S     1-11    0.101
+       D     1-11    0.104   0.450   NO
+Name=TCONS_00004052	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004053 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.113
+  max. Y    11       0.116
+  max. S     2       0.178
+  mean S     1-10    0.129
+       D     1-10    0.123   0.450   NO
+Name=TCONS_00004053	SP='NO' D=0.123 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004054 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    12       0.110
+  max. Y    12       0.125
+  max. S     2       0.200
+  mean S     1-11    0.126
+       D     1-11    0.125   0.450   NO
+Name=TCONS_00004054	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004055 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.112
+  max. Y    56       0.110
+  max. S    34       0.124
+  mean S     1-55    0.101
+       D     1-55    0.105   0.450   NO
+Name=TCONS_00004055	SP='NO' D=0.105 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004056 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.112
+  max. Y    56       0.110
+  max. S    34       0.124
+  mean S     1-55    0.101
+       D     1-55    0.105   0.450   NO
+Name=TCONS_00004056	SP='NO' D=0.105 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004058 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.112
+  max. Y    56       0.110
+  max. S    34       0.124
+  mean S     1-55    0.101
+       D     1-55    0.105   0.450   NO
+Name=TCONS_00004058	SP='NO' D=0.105 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004059 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.119
+  max. Y    30       0.111
+  max. S    12       0.146
+  mean S     1-29    0.105
+       D     1-29    0.108   0.450   NO
+Name=TCONS_00004059	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004060 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.110
+  max. Y    11       0.108
+  max. S     9       0.118
+  mean S     1-10    0.112
+       D     1-10    0.110   0.450   NO
+Name=TCONS_00004060	SP='NO' D=0.110 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004061 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.116
+  max. Y    11       0.130
+  max. S     2       0.208
+  mean S     1-10    0.138
+       D     1-10    0.135   0.450   NO
+Name=TCONS_00004061	SP='NO' D=0.135 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004062 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.116
+  max. Y    11       0.130
+  max. S     2       0.208
+  mean S     1-10    0.138
+       D     1-10    0.135   0.450   NO
+Name=TCONS_00004062	SP='NO' D=0.135 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004066 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.231
+  max. Y    19       0.208
+  max. S     2       0.320
+  mean S     1-18    0.166
+       D     1-18    0.186   0.450   NO
+Name=TCONS_00004066	SP='NO' D=0.186 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004067 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.230
+  max. Y    23       0.233
+  max. S    21       0.535
+  mean S     1-22    0.237
+       D     1-22    0.235   0.450   NO
+Name=TCONS_00004067	SP='NO' D=0.235 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004068 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.231
+  max. Y    19       0.208
+  max. S     2       0.320
+  mean S     1-18    0.166
+       D     1-18    0.186   0.450   NO
+Name=TCONS_00004068	SP='NO' D=0.186 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004077 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C     9       0.135
+  max. Y    11       0.116
+  max. S     1       0.149
+  mean S     1-10    0.110
+       D     1-10    0.113   0.450   NO
+Name=TCONS_00004077	SP='NO' D=0.113 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004078 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    63       0.108
+  max. Y    12       0.125
+  max. S     1       0.173
+  mean S     1-11    0.125
+       D     1-11    0.125   0.450   NO
+Name=TCONS_00004078	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004079 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    48       0.110
+  max. Y    61       0.105
+  max. S    12       0.117
+  mean S     1-60    0.099
+       D     1-60    0.102   0.450   NO
+Name=TCONS_00004079	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004080 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.109
+  max. Y    31       0.115
+  max. S    20       0.138
+  mean S     1-30    0.117
+       D     1-30    0.116   0.450   NO
+Name=TCONS_00004080	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004081 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.109
+  max. Y    31       0.115
+  max. S    20       0.138
+  mean S     1-30    0.117
+       D     1-30    0.116   0.450   NO
+Name=TCONS_00004081	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004082 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.110
+  max. Y    11       0.104
+  max. S     1       0.112
+  mean S     1-10    0.100
+       D     1-10    0.102   0.450   NO
+Name=TCONS_00004082	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004085 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.201
+  max. Y    29       0.222
+  max. S    28       0.484
+  mean S     1-28    0.227
+       D     1-28    0.225   0.450   NO
+Name=TCONS_00004085	SP='NO' D=0.225 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004086 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.114
+  max. Y    17       0.113
+  max. S     5       0.131
+  mean S     1-16    0.115
+       D     1-16    0.114   0.450   NO
+Name=TCONS_00004086	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004087 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    67       0.117
+  max. Y    12       0.129
+  max. S     3       0.193
+  mean S     1-11    0.159
+       D     1-11    0.145   0.450   NO
+Name=TCONS_00004087	SP='NO' D=0.145 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004088 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.114
+  max. Y    17       0.113
+  max. S     5       0.131
+  mean S     1-16    0.115
+       D     1-16    0.114   0.450   NO
+Name=TCONS_00004088	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004089 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.114
+  max. Y    17       0.113
+  max. S    48       0.141
+  mean S     1-16    0.115
+       D     1-16    0.114   0.450   NO
+Name=TCONS_00004089	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004090 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.114
+  max. Y    17       0.113
+  max. S     5       0.131
+  mean S     1-16    0.115
+       D     1-16    0.114   0.450   NO
+Name=TCONS_00004090	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004091 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.183
+  max. Y    24       0.260
+  max. S     1       0.587
+  mean S     1-23    0.378
+       D     1-23    0.324   0.450   NO
+Name=TCONS_00004091	SP='NO' D=0.324 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004092 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.114
+  max. Y    17       0.113
+  max. S     5       0.131
+  mean S     1-16    0.115
+       D     1-16    0.114   0.450   NO
+Name=TCONS_00004092	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004093 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.129
+  max. Y    14       0.179
+  max. S    12       0.401
+  mean S     1-13    0.283
+       D     1-13    0.235   0.450   NO
+Name=TCONS_00004093	SP='NO' D=0.235 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004102 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.158
+  max. Y    29       0.171
+  max. S     4       0.334
+  mean S     1-28    0.215
+       D     1-28    0.189   0.500   NO
+Name=TCONS_00004102	SP='NO' D=0.189 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004103 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.158
+  max. Y    29       0.171
+  max. S     4       0.334
+  mean S     1-28    0.215
+       D     1-28    0.189   0.500   NO
+Name=TCONS_00004103	SP='NO' D=0.189 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004104 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.158
+  max. Y    29       0.171
+  max. S     4       0.334
+  mean S     1-28    0.215
+       D     1-28    0.189   0.500   NO
+Name=TCONS_00004104	SP='NO' D=0.189 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004110 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.771
+  max. Y    29       0.804
+  max. S     9       0.935
+  mean S     1-28    0.853
+       D     1-28    0.830   0.450   YES
+Name=TCONS_00004110	SP='YES' Cleavage site between pos. 28 and 29: VWA-AR D=0.830 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004111 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.771
+  max. Y    29       0.804
+  max. S     9       0.935
+  mean S     1-28    0.853
+       D     1-28    0.830   0.450   YES
+Name=TCONS_00004111	SP='YES' Cleavage site between pos. 28 and 29: VWA-AR D=0.830 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004112 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.771
+  max. Y    29       0.804
+  max. S     9       0.935
+  mean S     1-28    0.853
+       D     1-28    0.830   0.450   YES
+Name=TCONS_00004112	SP='YES' Cleavage site between pos. 28 and 29: VWA-AR D=0.830 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004119 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.128
+  max. Y    65       0.110
+  max. S     3       0.126
+  mean S     1-64    0.097
+       D     1-64    0.103   0.450   NO
+Name=TCONS_00004119	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004120 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.128
+  max. Y    65       0.110
+  max. S     3       0.126
+  mean S     1-64    0.097
+       D     1-64    0.103   0.450   NO
+Name=TCONS_00004120	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004121 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.111
+  max. Y    35       0.111
+  max. S    19       0.134
+  mean S     1-34    0.110
+       D     1-34    0.111   0.450   NO
+Name=TCONS_00004121	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004122 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.111
+  max. Y    35       0.111
+  max. S    19       0.134
+  mean S     1-34    0.110
+       D     1-34    0.111   0.450   NO
+Name=TCONS_00004122	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004123 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    50       0.112
+  max. Y    50       0.108
+  max. S    43       0.121
+  mean S     1-49    0.098
+       D     1-49    0.103   0.450   NO
+Name=TCONS_00004123	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004132 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.168
+  max. Y    18       0.133
+  max. S     7       0.127
+  mean S     1-17    0.107
+       D     1-17    0.119   0.450   NO
+Name=TCONS_00004132	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004133 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    35       0.124
+  max. Y    14       0.131
+  max. S     7       0.186
+  mean S     1-13    0.154
+       D     1-13    0.144   0.450   NO
+Name=TCONS_00004133	SP='NO' D=0.144 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004142 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.201
+  max. Y    39       0.173
+  max. S    26       0.234
+  mean S     1-38    0.151
+       D     1-38    0.161   0.450   NO
+Name=TCONS_00004142	SP='NO' D=0.161 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004143 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    39       0.201
+  max. Y    39       0.173
+  max. S    26       0.234
+  mean S     1-38    0.151
+       D     1-38    0.161   0.450   NO
+Name=TCONS_00004143	SP='NO' D=0.161 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004144 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.110
+  max. Y    11       0.119
+  max. S     1       0.139
+  mean S     1-10    0.124
+       D     1-10    0.122   0.450   NO
+Name=TCONS_00004144	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004145 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.110
+  max. Y    42       0.107
+  max. S    44       0.114
+  mean S     1-41    0.098
+       D     1-41    0.102   0.450   NO
+Name=TCONS_00004145	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004146 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    31       0.328
+  max. Y    31       0.212
+  max. S     2       0.262
+  mean S     1-30    0.154
+       D     1-30    0.180   0.450   NO
+Name=TCONS_00004146	SP='NO' D=0.180 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004179 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    70       0.117
+  max. Y    11       0.147
+  max. S     2       0.247
+  mean S     1-10    0.167
+       D     1-10    0.158   0.450   NO
+Name=TCONS_00004179	SP='NO' D=0.158 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004180 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    70       0.117
+  max. Y    11       0.147
+  max. S     2       0.247
+  mean S     1-10    0.167
+       D     1-10    0.158   0.450   NO
+Name=TCONS_00004180	SP='NO' D=0.158 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004181 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    70       0.117
+  max. Y    11       0.147
+  max. S     2       0.247
+  mean S     1-10    0.167
+       D     1-10    0.158   0.450   NO
+Name=TCONS_00004181	SP='NO' D=0.158 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004182 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    64       0.108
+  max. Y    11       0.118
+  max. S     1       0.155
+  mean S     1-10    0.110
+       D     1-10    0.114   0.450   NO
+Name=TCONS_00004182	SP='NO' D=0.114 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004184 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.110
+  max. Y    11       0.114
+  max. S     4       0.137
+  mean S     1-10    0.123
+       D     1-10    0.119   0.450   NO
+Name=TCONS_00004184	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004185 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.110
+  max. Y    11       0.114
+  max. S     4       0.137
+  mean S     1-10    0.123
+       D     1-10    0.119   0.450   NO
+Name=TCONS_00004185	SP='NO' D=0.119 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004189 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.210
+  max. Y    33       0.148
+  max. S    10       0.162
+  mean S     1-32    0.110
+       D     1-32    0.127   0.450   NO
+Name=TCONS_00004189	SP='NO' D=0.127 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004190 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.123
+  max. Y    17       0.171
+  max. S    13       0.440
+  mean S     1-16    0.264
+       D     1-16    0.221   0.450   NO
+Name=TCONS_00004190	SP='NO' D=0.221 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004191 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.210
+  max. Y    33       0.148
+  max. S    10       0.162
+  mean S     1-32    0.110
+       D     1-32    0.127   0.450   NO
+Name=TCONS_00004191	SP='NO' D=0.127 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004192 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    40       0.169
+  max. Y    40       0.141
+  max. S    31       0.170
+  mean S     1-39    0.113
+       D     1-39    0.126   0.450   NO
+Name=TCONS_00004192	SP='NO' D=0.126 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004193 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.210
+  max. Y    33       0.148
+  max. S    10       0.163
+  mean S     1-32    0.110
+       D     1-32    0.128   0.450   NO
+Name=TCONS_00004193	SP='NO' D=0.128 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004194 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    40       0.169
+  max. Y    40       0.141
+  max. S    31       0.170
+  mean S     1-39    0.113
+       D     1-39    0.126   0.450   NO
+Name=TCONS_00004194	SP='NO' D=0.126 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004196 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.210
+  max. Y    33       0.148
+  max. S    10       0.162
+  mean S     1-32    0.110
+       D     1-32    0.127   0.450   NO
+Name=TCONS_00004196	SP='NO' D=0.127 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004197 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    36       0.197
+  max. Y    36       0.140
+  max. S    13       0.165
+  mean S     1-35    0.105
+       D     1-35    0.121   0.450   NO
+Name=TCONS_00004197	SP='NO' D=0.121 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004208 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    14       0.129
+  max. Y    37       0.111
+  max. S    11       0.121
+  mean S     1-36    0.098
+       D     1-36    0.104   0.450   NO
+Name=TCONS_00004208	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004209 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    29       0.147
+  max. Y    29       0.127
+  max. S     6       0.230
+  mean S     1-28    0.117
+       D     1-28    0.121   0.450   NO
+Name=TCONS_00004209	SP='NO' D=0.121 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004210 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    36       0.116
+  max. Y    36       0.107
+  max. S    12       0.128
+  mean S     1-35    0.099
+       D     1-35    0.103   0.450   NO
+Name=TCONS_00004210	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004219 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.117
+  max. Y    62       0.106
+  max. S    30       0.122
+  mean S     1-61    0.100
+       D     1-61    0.103   0.450   NO
+Name=TCONS_00004219	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004220 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    27       0.111
+  max. Y    61       0.106
+  max. S    45       0.114
+  mean S     1-60    0.101
+       D     1-60    0.103   0.450   NO
+Name=TCONS_00004220	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004221 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.125
+  max. Y    52       0.109
+  max. S    32       0.126
+  mean S     1-51    0.104
+       D     1-51    0.107   0.450   NO
+Name=TCONS_00004221	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004224 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    16       0.113
+  max. Y    16       0.107
+  max. S    29       0.127
+  mean S     1-15    0.098
+       D     1-15    0.102   0.450   NO
+Name=TCONS_00004224	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004225 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.109
+  max. Y    67       0.107
+  max. S    45       0.132
+  mean S     1-66    0.103
+       D     1-66    0.105   0.450   NO
+Name=TCONS_00004225	SP='NO' D=0.105 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004226 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.109
+  max. Y    46       0.106
+  max. S    29       0.130
+  mean S     1-45    0.102
+       D     1-45    0.104   0.450   NO
+Name=TCONS_00004226	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004227 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.109
+  max. Y    46       0.106
+  max. S    29       0.130
+  mean S     1-45    0.102
+       D     1-45    0.104   0.450   NO
+Name=TCONS_00004227	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004228 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.118
+  max. Y    11       0.172
+  max. S     2       0.438
+  mean S     1-10    0.269
+       D     1-10    0.225   0.450   NO
+Name=TCONS_00004228	SP='NO' D=0.225 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004229 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.108
+  max. Y    11       0.109
+  max. S     1       0.127
+  mean S     1-10    0.100
+       D     1-10    0.104   0.450   NO
+Name=TCONS_00004229	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004230 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.108
+  max. Y    11       0.109
+  max. S     1       0.127
+  mean S     1-10    0.100
+       D     1-10    0.104   0.450   NO
+Name=TCONS_00004230	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004231 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.118
+  max. Y    70       0.107
+  max. S     1       0.114
+  mean S     1-69    0.098
+       D     1-69    0.102   0.450   NO
+Name=TCONS_00004231	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004232 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.111
+  max. Y    31       0.103
+  max. S    23       0.106
+  mean S     1-30    0.097
+       D     1-30    0.100   0.450   NO
+Name=TCONS_00004232	SP='NO' D=0.100 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004233 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.111
+  max. Y    31       0.103
+  max. S    23       0.106
+  mean S     1-30    0.097
+       D     1-30    0.100   0.450   NO
+Name=TCONS_00004233	SP='NO' D=0.100 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004234 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.111
+  max. Y    31       0.103
+  max. S    23       0.106
+  mean S     1-30    0.097
+       D     1-30    0.100   0.450   NO
+Name=TCONS_00004234	SP='NO' D=0.100 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004235 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    35       0.128
+  max. Y    16       0.122
+  max. S     3       0.184
+  mean S     1-15    0.141
+       D     1-15    0.132   0.450   NO
+Name=TCONS_00004235	SP='NO' D=0.132 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004236 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    35       0.128
+  max. Y    16       0.122
+  max. S     3       0.184
+  mean S     1-15    0.141
+       D     1-15    0.132   0.450   NO
+Name=TCONS_00004236	SP='NO' D=0.132 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004237 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.108
+  max. Y    13       0.116
+  max. S     1       0.157
+  mean S     1-12    0.101
+       D     1-12    0.108   0.450   NO
+Name=TCONS_00004237	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004240 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.118
+  max. Y    26       0.125
+  max. S     8       0.190
+  mean S     1-25    0.130
+       D     1-25    0.128   0.450   NO
+Name=TCONS_00004240	SP='NO' D=0.128 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004241 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    21       0.142
+  max. Y    17       0.184
+  max. S    14       0.365
+  mean S     1-16    0.243
+       D     1-16    0.216   0.450   NO
+Name=TCONS_00004241	SP='NO' D=0.216 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004265 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.219
+  max. Y    33       0.274
+  max. S    31       0.564
+  mean S     1-32    0.319
+       D     1-32    0.298   0.450   NO
+Name=TCONS_00004265	SP='NO' D=0.298 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004266 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    55       0.108
+  max. Y    12       0.106
+  max. S    33       0.124
+  mean S     1-11    0.098
+       D     1-11    0.102   0.450   NO
+Name=TCONS_00004266	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004267 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    43       0.110
+  max. Y    43       0.110
+  max. S     2       0.128
+  mean S     1-42    0.108
+       D     1-42    0.109   0.450   NO
+Name=TCONS_00004267	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004268 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.114
+  max. Y    12       0.108
+  max. S     1       0.112
+  mean S     1-11    0.106
+       D     1-11    0.107   0.450   NO
+Name=TCONS_00004268	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004269 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.109
+  max. Y    58       0.105
+  max. S     7       0.114
+  mean S     1-57    0.097
+       D     1-57    0.100   0.450   NO
+Name=TCONS_00004269	SP='NO' D=0.100 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004270 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    16       0.133
+  max. Y    16       0.119
+  max. S    11       0.124
+  mean S     1-15    0.108
+       D     1-15    0.113   0.450   NO
+Name=TCONS_00004270	SP='NO' D=0.113 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004271 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.112
+  max. Y    18       0.106
+  max. S    57       0.120
+  mean S     1-17    0.102
+       D     1-17    0.104   0.450   NO
+Name=TCONS_00004271	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004272 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.115
+  max. Y    24       0.111
+  max. S    13       0.133
+  mean S     1-23    0.107
+       D     1-23    0.109   0.450   NO
+Name=TCONS_00004272	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004273 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.173
+  max. Y    17       0.127
+  max. S    15       0.119
+  mean S     1-16    0.092
+       D     1-16    0.108   0.450   NO
+Name=TCONS_00004273	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004274 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    18       0.111
+  max. Y    18       0.113
+  max. S    13       0.171
+  mean S     1-17    0.118
+       D     1-17    0.116   0.450   NO
+Name=TCONS_00004274	SP='NO' D=0.116 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004276 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    36       0.126
+  max. Y    39       0.116
+  max. S    50       0.233
+  mean S     1-38    0.104
+       D     1-38    0.109   0.450   NO
+Name=TCONS_00004276	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004277 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    66       0.139
+  max. Y    11       0.134
+  max. S     2       0.274
+  mean S     1-10    0.170
+       D     1-10    0.148   0.500   NO
+Name=TCONS_00004277	SP='NO' D=0.148 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004278 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.496
+  max. Y    22       0.681
+  max. S     7       0.958
+  mean S     1-21    0.934
+       D     1-21    0.818   0.450   YES
+Name=TCONS_00004278	SP='YES' Cleavage site between pos. 21 and 22: AAA-VY D=0.818 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004279 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.496
+  max. Y    22       0.681
+  max. S     7       0.958
+  mean S     1-21    0.934
+       D     1-21    0.818   0.450   YES
+Name=TCONS_00004279	SP='YES' Cleavage site between pos. 21 and 22: AAA-VY D=0.818 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004280 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.496
+  max. Y    22       0.681
+  max. S     7       0.958
+  mean S     1-21    0.934
+       D     1-21    0.818   0.450   YES
+Name=TCONS_00004280	SP='YES' Cleavage site between pos. 21 and 22: AAA-VY D=0.818 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004281 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.496
+  max. Y    22       0.681
+  max. S     7       0.958
+  mean S     1-21    0.934
+       D     1-21    0.818   0.450   YES
+Name=TCONS_00004281	SP='YES' Cleavage site between pos. 21 and 22: AAA-VY D=0.818 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004288 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.127
+  max. Y    25       0.120
+  max. S     3       0.161
+  mean S     1-24    0.115
+       D     1-24    0.117   0.450   NO
+Name=TCONS_00004288	SP='NO' D=0.117 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004289 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.168
+  max. Y    23       0.183
+  max. S     2       0.377
+  mean S     1-22    0.198
+       D     1-22    0.191   0.450   NO
+Name=TCONS_00004289	SP='NO' D=0.191 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004290 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    37       0.115
+  max. Y    13       0.108
+  max. S    11       0.137
+  mean S     1-12    0.108
+       D     1-12    0.108   0.450   NO
+Name=TCONS_00004290	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004291 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.114
+  max. Y    17       0.108
+  max. S     1       0.115
+  mean S     1-16    0.099
+       D     1-16    0.103   0.450   NO
+Name=TCONS_00004291	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004293 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.125
+  max. Y    11       0.127
+  max. S     1       0.175
+  mean S     1-10    0.130
+       D     1-10    0.129   0.450   NO
+Name=TCONS_00004293	SP='NO' D=0.129 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004294 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.125
+  max. Y    11       0.127
+  max. S     1       0.175
+  mean S     1-10    0.130
+       D     1-10    0.129   0.450   NO
+Name=TCONS_00004294	SP='NO' D=0.129 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004295 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.125
+  max. Y    11       0.127
+  max. S     1       0.175
+  mean S     1-10    0.130
+       D     1-10    0.129   0.450   NO
+Name=TCONS_00004295	SP='NO' D=0.129 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004296 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.125
+  max. Y    11       0.127
+  max. S     1       0.175
+  mean S     1-10    0.130
+       D     1-10    0.129   0.450   NO
+Name=TCONS_00004296	SP='NO' D=0.129 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004297 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.125
+  max. Y    11       0.127
+  max. S     1       0.175
+  mean S     1-10    0.130
+       D     1-10    0.129   0.450   NO
+Name=TCONS_00004297	SP='NO' D=0.129 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004298 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.125
+  max. Y    11       0.127
+  max. S     1       0.175
+  mean S     1-10    0.130
+       D     1-10    0.129   0.450   NO
+Name=TCONS_00004298	SP='NO' D=0.129 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004310 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.134
+  max. Y    23       0.185
+  max. S     2       0.374
+  mean S     1-22    0.254
+       D     1-22    0.222   0.450   NO
+Name=TCONS_00004310	SP='NO' D=0.222 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004311 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    58       0.107
+  max. Y    58       0.103
+  max. S    43       0.106
+  mean S     1-57    0.093
+       D     1-57    0.098   0.450   NO
+Name=TCONS_00004311	SP='NO' D=0.098 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004317 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.133
+  max. Y    51       0.113
+  max. S    32       0.166
+  mean S     1-50    0.101
+       D     1-50    0.107   0.450   NO
+Name=TCONS_00004317	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004318 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.133
+  max. Y    51       0.113
+  max. S    32       0.166
+  mean S     1-50    0.101
+       D     1-50    0.107   0.450   NO
+Name=TCONS_00004318	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004319 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    30       0.120
+  max. Y    11       0.136
+  max. S     4       0.282
+  mean S     1-10    0.176
+       D     1-10    0.157   0.450   NO
+Name=TCONS_00004319	SP='NO' D=0.157 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004320 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    46       0.113
+  max. Y    36       0.111
+  max. S    19       0.144
+  mean S     1-35    0.105
+       D     1-35    0.108   0.450   NO
+Name=TCONS_00004320	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004321 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    46       0.113
+  max. Y    36       0.111
+  max. S    19       0.144
+  mean S     1-35    0.105
+       D     1-35    0.108   0.450   NO
+Name=TCONS_00004321	SP='NO' D=0.108 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004322 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    19       0.151
+  max. Y    19       0.187
+  max. S     3       0.322
+  mean S     1-18    0.215
+       D     1-18    0.202   0.450   NO
+Name=TCONS_00004322	SP='NO' D=0.202 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004323 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    34       0.119
+  max. Y    21       0.116
+  max. S     4       0.145
+  mean S     1-20    0.125
+       D     1-20    0.121   0.450   NO
+Name=TCONS_00004323	SP='NO' D=0.121 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004324 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    36       0.109
+  max. Y    12       0.168
+  max. S     1       0.336
+  mean S     1-11    0.257
+       D     1-11    0.204   0.500   NO
+Name=TCONS_00004324	SP='NO' D=0.204 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004325 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.132
+  max. Y    20       0.130
+  max. S     2       0.155
+  mean S     1-19    0.124
+       D     1-19    0.126   0.450   NO
+Name=TCONS_00004325	SP='NO' D=0.126 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004326 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    27       0.126
+  max. Y    11       0.127
+  max. S     1       0.181
+  mean S     1-10    0.131
+       D     1-10    0.129   0.450   NO
+Name=TCONS_00004326	SP='NO' D=0.129 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004327 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    59       0.110
+  max. Y    59       0.107
+  max. S    35       0.120
+  mean S     1-58    0.100
+       D     1-58    0.104   0.450   NO
+Name=TCONS_00004327	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004328 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.251
+  max. Y    28       0.179
+  max. S    27       0.182
+  mean S     1-27    0.132
+       D     1-27    0.154   0.450   NO
+Name=TCONS_00004328	SP='NO' D=0.154 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004329 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    59       0.110
+  max. Y    59       0.107
+  max. S    35       0.120
+  mean S     1-58    0.100
+       D     1-58    0.104   0.450   NO
+Name=TCONS_00004329	SP='NO' D=0.104 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004330 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.251
+  max. Y    28       0.179
+  max. S    27       0.182
+  mean S     1-27    0.132
+       D     1-27    0.154   0.450   NO
+Name=TCONS_00004330	SP='NO' D=0.154 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004332 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.251
+  max. Y    28       0.182
+  max. S    27       0.184
+  mean S     1-27    0.135
+       D     1-27    0.157   0.450   NO
+Name=TCONS_00004332	SP='NO' D=0.157 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004333 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    28       0.251
+  max. Y    28       0.179
+  max. S    27       0.182
+  mean S     1-27    0.132
+       D     1-27    0.154   0.450   NO
+Name=TCONS_00004333	SP='NO' D=0.154 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004334 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    50       0.114
+  max. Y    17       0.110
+  max. S     1       0.131
+  mean S     1-16    0.108
+       D     1-16    0.109   0.450   NO
+Name=TCONS_00004334	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004335 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    60       0.109
+  max. Y    12       0.109
+  max. S     3       0.136
+  mean S     1-11    0.113
+       D     1-11    0.111   0.450   NO
+Name=TCONS_00004335	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004336 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    60       0.109
+  max. Y    12       0.109
+  max. S     3       0.136
+  mean S     1-11    0.113
+       D     1-11    0.111   0.450   NO
+Name=TCONS_00004336	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004337 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    60       0.109
+  max. Y    12       0.109
+  max. S     3       0.136
+  mean S     1-11    0.113
+       D     1-11    0.111   0.450   NO
+Name=TCONS_00004337	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004338 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    60       0.109
+  max. Y    12       0.109
+  max. S     3       0.136
+  mean S     1-11    0.113
+       D     1-11    0.111   0.450   NO
+Name=TCONS_00004338	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004340 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    60       0.109
+  max. Y    12       0.109
+  max. S     3       0.136
+  mean S     1-11    0.113
+       D     1-11    0.111   0.450   NO
+Name=TCONS_00004340	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004342 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    60       0.109
+  max. Y    12       0.109
+  max. S     3       0.136
+  mean S     1-11    0.113
+       D     1-11    0.111   0.450   NO
+Name=TCONS_00004342	SP='NO' D=0.111 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004343 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.108
+  max. Y    12       0.111
+  max. S     3       0.173
+  mean S     1-11    0.122
+       D     1-11    0.117   0.450   NO
+Name=TCONS_00004343	SP='NO' D=0.117 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004344 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.110
+  max. Y    60       0.122
+  max. S    56       0.197
+  mean S     1-59    0.109
+       D     1-59    0.117   0.500   NO
+Name=TCONS_00004344	SP='NO' D=0.117 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004345 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.121
+  max. Y    22       0.133
+  max. S     7       0.197
+  mean S     1-21    0.146
+       D     1-21    0.140   0.450   NO
+Name=TCONS_00004345	SP='NO' D=0.140 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004346 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.172
+  max. Y    12       0.246
+  max. S     1       0.655
+  mean S     1-11    0.442
+       D     1-11    0.352   0.450   NO
+Name=TCONS_00004346	SP='NO' D=0.352 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004347 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.172
+  max. Y    12       0.246
+  max. S     1       0.655
+  mean S     1-11    0.442
+       D     1-11    0.352   0.450   NO
+Name=TCONS_00004347	SP='NO' D=0.352 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004348 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    70       0.146
+  max. Y    56       0.122
+  max. S    52       0.228
+  mean S     1-55    0.106
+       D     1-55    0.116   0.500   NO
+Name=TCONS_00004348	SP='NO' D=0.116 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004349 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    25       0.172
+  max. Y    12       0.246
+  max. S     1       0.655
+  mean S     1-11    0.442
+       D     1-11    0.352   0.450   NO
+Name=TCONS_00004349	SP='NO' D=0.352 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004356 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    23       0.125
+  max. Y    11       0.137
+  max. S    20       0.235
+  mean S     1-10    0.153
+       D     1-10    0.146   0.450   NO
+Name=TCONS_00004356	SP='NO' D=0.146 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004357 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.134
+  max. Y    18       0.120
+  max. S    12       0.151
+  mean S     1-17    0.124
+       D     1-17    0.122   0.450   NO
+Name=TCONS_00004357	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004359 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.134
+  max. Y    18       0.120
+  max. S    12       0.151
+  mean S     1-17    0.124
+       D     1-17    0.122   0.450   NO
+Name=TCONS_00004359	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004360 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.134
+  max. Y    18       0.120
+  max. S    12       0.151
+  mean S     1-17    0.124
+       D     1-17    0.122   0.450   NO
+Name=TCONS_00004360	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004361 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.109
+  max. Y    40       0.113
+  max. S    22       0.151
+  mean S     1-39    0.106
+       D     1-39    0.109   0.450   NO
+Name=TCONS_00004361	SP='NO' D=0.109 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004362 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.134
+  max. Y    18       0.120
+  max. S    12       0.151
+  mean S     1-17    0.124
+       D     1-17    0.122   0.450   NO
+Name=TCONS_00004362	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004363 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.134
+  max. Y    18       0.120
+  max. S    12       0.151
+  mean S     1-17    0.124
+       D     1-17    0.122   0.450   NO
+Name=TCONS_00004363	SP='NO' D=0.122 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004368 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.254
+  max. Y    22       0.384
+  max. S     4       0.743
+  mean S     1-21    0.621
+       D     1-21    0.478   0.500   NO
+Name=TCONS_00004368	SP='NO' D=0.478 D-cutoff=0.500 Networks=SignalP-TM
+>TCONS_00004369 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    49       0.112
+  max. Y    11       0.112
+  max. S     1       0.133
+  mean S     1-10    0.109
+       D     1-10    0.110   0.450   NO
+Name=TCONS_00004369	SP='NO' D=0.110 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004375 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    62       0.113
+  max. Y    35       0.108
+  max. S    28       0.126
+  mean S     1-34    0.105
+       D     1-34    0.106   0.450   NO
+Name=TCONS_00004375	SP='NO' D=0.106 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004376 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.108
+  max. Y    44       0.102
+  max. S    25       0.112
+  mean S     1-43    0.093
+       D     1-43    0.098   0.450   NO
+Name=TCONS_00004376	SP='NO' D=0.098 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004377 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.108
+  max. Y    44       0.102
+  max. S    25       0.112
+  mean S     1-43    0.093
+       D     1-43    0.098   0.450   NO
+Name=TCONS_00004377	SP='NO' D=0.098 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004378 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.110
+  max. Y    33       0.105
+  max. S    11       0.119
+  mean S     1-32    0.100
+       D     1-32    0.102   0.450   NO
+Name=TCONS_00004378	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004379 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.110
+  max. Y    33       0.105
+  max. S    11       0.119
+  mean S     1-32    0.100
+       D     1-32    0.102   0.450   NO
+Name=TCONS_00004379	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004380 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.110
+  max. Y    22       0.103
+  max. S    11       0.108
+  mean S     1-21    0.097
+       D     1-21    0.100   0.450   NO
+Name=TCONS_00004380	SP='NO' D=0.100 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004381 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.108
+  max. Y    44       0.102
+  max. S    25       0.112
+  mean S     1-43    0.093
+       D     1-43    0.098   0.450   NO
+Name=TCONS_00004381	SP='NO' D=0.098 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004382 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    33       0.110
+  max. Y    33       0.105
+  max. S    11       0.119
+  mean S     1-32    0.100
+       D     1-32    0.102   0.450   NO
+Name=TCONS_00004382	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004383 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.116
+  max. Y    12       0.157
+  max. S     4       0.254
+  mean S     1-11    0.212
+       D     1-11    0.187   0.450   NO
+Name=TCONS_00004383	SP='NO' D=0.187 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004384 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    17       0.116
+  max. Y    12       0.157
+  max. S     4       0.254
+  mean S     1-11    0.212
+       D     1-11    0.187   0.450   NO
+Name=TCONS_00004384	SP='NO' D=0.187 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004390 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    35       0.130
+  max. Y    12       0.125
+  max. S    41       0.169
+  mean S     1-11    0.130
+       D     1-11    0.127   0.450   NO
+Name=TCONS_00004390	SP='NO' D=0.127 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004391 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    47       0.108
+  max. Y    47       0.106
+  max. S    33       0.116
+  mean S     1-46    0.100
+       D     1-46    0.103   0.450   NO
+Name=TCONS_00004391	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004398 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.141
+  max. Y    26       0.129
+  max. S     2       0.181
+  mean S     1-25    0.123
+       D     1-25    0.126   0.450   NO
+Name=TCONS_00004398	SP='NO' D=0.126 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004399 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    26       0.141
+  max. Y    26       0.129
+  max. S     2       0.181
+  mean S     1-25    0.123
+       D     1-25    0.126   0.450   NO
+Name=TCONS_00004399	SP='NO' D=0.126 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004410 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.170
+  max. Y    24       0.260
+  max. S     1       0.674
+  mean S     1-23    0.408
+       D     1-23    0.340   0.450   NO
+Name=TCONS_00004410	SP='NO' D=0.340 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004412 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.170
+  max. Y    24       0.260
+  max. S     1       0.674
+  mean S     1-23    0.408
+       D     1-23    0.340   0.450   NO
+Name=TCONS_00004412	SP='NO' D=0.340 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004413 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    61       0.109
+  max. Y    61       0.108
+  max. S    41       0.138
+  mean S     1-60    0.098
+       D     1-60    0.102   0.450   NO
+Name=TCONS_00004413	SP='NO' D=0.102 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004414 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.170
+  max. Y    24       0.260
+  max. S     1       0.674
+  mean S     1-23    0.408
+       D     1-23    0.340   0.450   NO
+Name=TCONS_00004414	SP='NO' D=0.340 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004415 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.170
+  max. Y    24       0.260
+  max. S     1       0.674
+  mean S     1-23    0.408
+       D     1-23    0.340   0.450   NO
+Name=TCONS_00004415	SP='NO' D=0.340 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004421 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.161
+  max. Y    24       0.123
+  max. S     1       0.119
+  mean S     1-23    0.094
+       D     1-23    0.107   0.450   NO
+Name=TCONS_00004421	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004422 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    24       0.161
+  max. Y    24       0.123
+  max. S     1       0.119
+  mean S     1-23    0.094
+       D     1-23    0.107   0.450   NO
+Name=TCONS_00004422	SP='NO' D=0.107 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004428 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    41       0.117
+  max. Y    41       0.109
+  max. S    40       0.147
+  mean S     1-40    0.098
+       D     1-40    0.103   0.450   NO
+Name=TCONS_00004428	SP='NO' D=0.103 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004429 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.127
+  max. Y    16       0.290
+  max. S    14       0.785
+  mean S     1-15    0.705
+       D     1-15    0.514   0.450   YES
+Name=TCONS_00004429	SP='YES' Cleavage site between pos. 15 and 16: LAA-HA D=0.514 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004431 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    20       0.127
+  max. Y    16       0.290
+  max. S    14       0.785
+  mean S     1-15    0.705
+       D     1-15    0.514   0.450   YES
+Name=TCONS_00004431	SP='YES' Cleavage site between pos. 15 and 16: LAA-HA D=0.514 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004433 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    21       0.176
+  max. Y    21       0.296
+  max. S     1       0.671
+  mean S     1-20    0.479
+       D     1-20    0.395   0.450   NO
+Name=TCONS_00004433	SP='NO' D=0.395 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004434 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    31       0.111
+  max. Y    11       0.151
+  max. S     2       0.264
+  mean S     1-10    0.177
+       D     1-10    0.165   0.450   NO
+Name=TCONS_00004434	SP='NO' D=0.165 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004435 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    51       0.109
+  max. Y    67       0.103
+  max. S    65       0.104
+  mean S     1-66    0.094
+       D     1-66    0.098   0.450   NO
+Name=TCONS_00004435	SP='NO' D=0.098 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004436 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    21       0.176
+  max. Y    21       0.296
+  max. S     1       0.671
+  mean S     1-20    0.479
+       D     1-20    0.395   0.450   NO
+Name=TCONS_00004436	SP='NO' D=0.395 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004439 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    67       0.199
+  max. Y    67       0.142
+  max. S    54       0.116
+  mean S     1-66    0.096
+       D     1-66    0.117   0.450   NO
+Name=TCONS_00004439	SP='NO' D=0.117 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004440 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    22       0.590
+  max. Y    22       0.271
+  max. S    18       0.161
+  mean S     1-21    0.124
+       D     1-21    0.192   0.450   NO
+Name=TCONS_00004440	SP='NO' D=0.192 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004441 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.125
+  max. Y    42       0.110
+  max. S     8       0.133
+  mean S     1-41    0.101
+       D     1-41    0.105   0.450   NO
+Name=TCONS_00004441	SP='NO' D=0.105 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004442 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    42       0.125
+  max. Y    42       0.110
+  max. S     8       0.133
+  mean S     1-41    0.101
+       D     1-41    0.105   0.450   NO
+Name=TCONS_00004442	SP='NO' D=0.105 D-cutoff=0.450 Networks=SignalP-noTM
+>TCONS_00004443 
+# Measure  Position  Value    Cutoff   signal peptide?
+  max. C    65       0.107
+  max. Y    12       0.119
+  max. S     1       0.138
+  mean S     1-11    0.130
+       D     1-11    0.125   0.450   NO
+Name=TCONS_00004443	SP='NO' D=0.125 D-cutoff=0.450 Networks=SignalP-noTM
\ No newline at end of file
diff -r 000000000000 -r f3fefb6d8254 test-data/test01.RData
Binary file test-data/test01.RData has changed
diff -r 000000000000 -r f3fefb6d8254 test-data/test02_counts.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test02_counts.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,355 @@
+gene_names	cancer0	cancer1	health0	health1
+AADACL3	1.33294716142329	1.60935135697703	0	0
+AADACL4	0.16565689184278	0.245447543814652	0	0
+ACAP3	66.9545762637869	99.4728681831285	1393.95324090613	1183.58827790662
+ACOT7	455.514031889104	625.643253171647	7395.10823740127	2889.86502433136
+ACTL8	2.25786678564214	2.8385206089638	6.29646468356414	9.65386190076367
+AGMAT	14.1868697001226	20.8082199337387	56.2113078807145	41.8419006164206
+AGRN	223.424831149421	331.946548429751	2144.12485688125	3783.10646304681
+AGTRAP	187.400533886563	314.973593315019	1943.78534029914	2390.03265356525
+AJAP1	8.63047529957261	13.8464275492248	2.78718070452411	0
+AKR7A2	83.7117317539189	130.289924823431	3829.83857542184	3540.61290523654
+AKR7A3	1.86761600752251	3.58107135446447	19.1848890894377	15.2519579815619
+AKR7L	1.63323529019925	1.78518588259504	12.0382831872031	11.9429611381668
+ALDH4A1	80.0692491307954	115.615849240505	588.92974612004	641.316225550933
+ALPL	598.739713486774	931.026396105693	12.5179727486086	145.603586056744
+ANGPTL7	0.111187468282468	0.164742599508691	11.7533214949055	12.3890347339164
+APITD1	27.9435627190935	40.1067500091512	802.720467188703	663.18564778364
+ARHGEF10L	80.3813346280653	125.687632167421	575.337403596391	982.752730025466
+ARHGEF16	44.2754028984311	66.8497008399258	8.93761413278206	2.14380019716824
+ARHGEF19	115.733727841445	189.932215231752	192.61472131494	216.922297485954
+ASAP3	88.368604104536	144.185270660234	977.339687032257	832.468754427446
+ATAD3A	170.332210340393	256.909438164756	2909.59238880021	1787.85567999184
+ATAD3B	115.009269719842	186.922563175749	1204.49289913673	580.698972738788
+ATAD3C	9.18645892844685	11.1689876678097	20.3511517744843	14.9657017546822
+ATP13A2	173.079288123976	259.826155166127	778.918736405516	778.83424421371
+AURKAIP1	431.089374951588	734.107961651523	9367.79479097331	6368.53564372911
+B3GALT6	34.5537089926203	48.0941285791035	1107.4652590036	1344.53791709811
+C1orf126	0.748005384270891	2.19315673139357	0	2.02937495588995
+C1orf127	0.219649529265469	1.31728558966594	0.73417113252224	0
+C1orf128	157.021218105179	205.564314627884	2055.87258399552	1840.70695418312
+C1orf130	0.270304535188066	0.445000989755816	0	0.293709236838892
+C1orf144	169.905131358614	236.936379177537	6169.84439356059	6172.79967616817
+C1orf151	81.934540083501	106.83864564802	2316.80019551674	1742.26068228731
+C1orf158	0.306319741118665	0	0	0
+C1orf159	25.4472609092091	27.0936925692478	255.003897423656	260.387760636754
+C1orf167	0.852445327466635	1.62734609336196	4.28017084616318	20.8037404760945
+C1orf170	1.12825925747856	4.0128035997215	42.2830759803238	44.6208842491559
+C1orf174	65.3123327213875	103.529715471474	1150.25066664382	1553.57631620601
+C1orf187	38.4882619397459	66.6560127067159	22.7498270005338	2.90670998197146
+C1orf200	0.140010077377323	0	0	0
+C1orf201	16.9572193953188	29.7070533850009	301.219367711266	379.623514344136
+C1orf211	14.6209036697657	26.998386277083	1.41183164282385	8.65855898698444
+C1orf213	0.518508587606857	1.88619698952573	76.5600381962453	156.763728464001
+C1orf222	0.381237303744296	0.529475492302115	0	0
+C1orf70	7.51184976845881	19.8485556995299	239.879629899723	290.034472160915
+C1orf86	225.001393970245	375.819392770559	3491.25500640192	2865.04772849532
+C1orf89	5.10917443855593	12.0376749429161	202.484599015937	212.283237977287
+C1orf93	100.534745697611	160.074553609957	1576.8889615254	1358.37868843451
+CAD	1.78359239559776	5.00082342629287	0	13.4392425305562
+CALML6	2.92860771428337	5.65982936080012	0	2.10905502038753
+CAMK2N1	14.2906082102419	26.1322888570167	8126.76185609601	16305.1258047596
+CAMTA1	200.588720737929	253.543060947236	3055.15380157953	4100.09091814611
+CAPZB	619.112320909139	991.572432852428	20316.4731362545	24041.0162369706
+CASP9	51.1870965570691	80.3510692413285	340.999216471908	304.57891159937
+CASZ1	13.6330268070182	19.042062635585	8.81866733613576	9.75816312925625
+CCDC27	0.0573867205178809	1.02033468450467	0.75773394235314	0
+CCNL2	154.506479643163	214.761548556505	1152.06879708577	1771.98482377448
+CDA	13.5485774691298	33.1982874601624	176.302023749904	350.510461917004
+CDC2L1	290.944540530384	454.207969292801	3112.41609597224	1859.4524654607
+CDC2L2	170.977132360159	246.928776496558	2067.4280282674	2282.26157605437
+CDC42	203.801007690173	285.200666437615	11564.694795414	10973.3271896535
+CELA2B	0.159866211673547	0.236811104138174	0	0
+CHD5	3.05969618009437	5.29226916471859	5.15789578430315	4.14182197419077
+CLCN6	47.6704636085561	60.4197458667943	574.076737032054	768.141520213874
+CLCNKA	2.63522828591018	8.68236787500691	0.678927560712282	0
+CLCNKB	5.15929663864343	12.8715185272746	2.32675789513133	1.78445080716628
+CLSTN1	202.476075380806	319.632083851152	5093.23897792429	6042.3182160338
+CORT	2.88722197591461	5.85418514894763	8.23077012212674	22.4610665654388
+CPSF3L	295.347158226512	486.168636281702	3790.65155484617	3288.19390910512
+CROCC	78.3541158913447	107.947902278446	165.209683502876	225.026477190003
+CTNNBIP1	77.4633730300185	121.027354039037	541.243734816617	627.657026575342
+CTRC	0	0	2.62147985845083	10.0482914559178
+Cort	1.39537707894365	1.30434109573608	5.2816642560574	0.0151412578013478
+DDI2	32.8160456278053	49.5573033486735	254.874844668067	460.575319357691
+DDOST	604.449663575025	907.98657543851	13665.5007422144	15397.9137626485
+DFFA	130.006170003179	214.639755373536	1325.04655393129	1333.60627430197
+DFFB	13.2342440141516	16.2498596905303	127.460095995143	151.574760997069
+DHRS3	87.0464324268709	116.72890181231	1019.4715318943	889.744275630948
+DNAJC11	170.344114526107	239.921012121094	2130.43084610145	1817.86818341584
+DNAJC16	19.7622965555186	25.9568339296646	344.527403240069	532.271145389955
+DVL1	134.516467764835	206.683713511138	2152.3813715147	1328.47243311826
+DVL1L1	3.31326839123532	6.78391259724545	59.8262158993051	60.6810257420504
+E2F2	10.4399946081232	18.7092348544285	97.2088092893749	35.6406449776233
+ECE1	66.4571391530656	104.799250566661	6832.6483396322	8161.51962989564
+EFHD2	53.7957629609978	89.4533777139045	2778.28294353325	2216.78314141543
+EIF4G3	88.0324265767771	124.576532306832	2013.10224443396	2895.59135213179
+ENO1	6558.87666660173	9380.2303936004	93534.3399845077	69650.8820586366
+EPHA2	77.3221844026497	91.3520663119398	1390.10455203221	695.561720381493
+EPHA8	7.41680618002836	20.4553678887687	0	0
+EPHB2	32.3112950981041	60.4351378257855	1707.12636087386	423.970018570528
+ERRFI1	61.8103776457282	74.6154646346554	2062.3064004349	3271.74502949025
+ESPN	19.6610267100338	39.4634680663325	0.451453505296478	0
+ESPNP	0.129073180931436	1.10615167601148	0	0
+EXOSC10	173.284597941512	227.633522955699	1944.55712530741	1802.75580392237
+FAM131C	2.24876951909219	6.27872574545493	58.9032768191879	46.1727202863332
+FAM132A	3.84947896587315	9.98135157830029	128.448491513426	40.4669321823919
+FAM41C	0.302278489637574	0.335905814000472	4.95347952144023	12.1516309778703
+FAM43B	5.46152884081911	6.47372226696996	2.51816321877196	0.965224952857359
+FBLIM1	111.14573835528	181.165870005859	1673.86297734934	4009.68470407822
+FBXO2	154.152795959943	320.494643776912	53.5029060412522	114.375666849763
+FBXO42	32.5697215584544	48.16155042074	573.623814141438	758.468180724696
+FBXO44	66.872920433567	104.857828313577	440.70354833884	534.287933783485
+FBXO6	3.50735527954742	4.06973374654982	375.388875588851	452.825103479876
+FHAD1	0.921397741797418	1.65506633667102	3.92992882180617	4.53163220334661
+FUCA1	17.0659023558552	22.5859660704193	173.703225947981	150.186453191324
+GABRD	4.99857114177978	7.69856396630753	0.865565912204043	0
+GALE	66.7029801712116	108.438476102006	1069.52511368286	649.188753095255
+GLTPD1	23.9392818646217	32.0156695513129	930.45330751506	848.58426405939
+GNB1	552.837447538731	914.810470156843	17713.2729458483	20611.8841648059
+GPR153	29.2904210431041	54.7774980860172	1159.24045408154	570.753283504249
+GPR157	6.9246933142833	13.2614200369664	130.905914635676	92.9695489365082
+GRHL3	3.17376836133494	4.12271726299763	0.648123796243081	0.993719066619065
+H6PD	9.73184391540445	18.8086651865309	1098.37928461226	1470.23075215424
+HES2	0.860500532694876	1.72024884210958	2.59604614402101	1.53614188010627
+HES3	187.003719783718	265.680001103292	0	0
+HES4	3.26807877298495	9.21672514534727	11.5504692743939	65.2732181635511
+HES5	0.413503700004359	0.45950633170621	0	0
+HMGCL	39.2773527873122	73.3597815846527	1688.82684523087	2363.0312070757
+HNRNPR	358.051830999552	557.471771442898	6385.71855992608	5229.07227596313
+HP1BP3	139.453393502231	177.816028016673	4186.94412612279	6078.47421848083
+HSPB7	0.394310461505414	2.0187516214347	948.162427438671	726.090182906317
+HSPG2	121.689737329714	194.674360059929	2789.41615140344	9015.0255999021
+HTR1D	13.8118225729494	29.5527048447396	0	0
+HTR6	2.35343259159145	4.61791075618961	0	0
+ICMT	166.884696441074	229.758550167118	2794.81710553285	3198.04879103838
+ID3	449.723045510507	491.937275449614	1856.58321013501	1565.24977053587
+IFFO2	11.1211442814015	15.5015656767494	254.481027389179	450.177925257366
+IGSF21	48.2382101870424	74.0827603487169	0	0
+IL22RA1	0.705781326914609	1.48216703986439	5.34585936395826	2.75585835305596
+IL28RA	26.6775412932847	37.2044611745628	0	0.262706833151213
+ISG15	119.116629191387	201.703582003596	3105.38902825296	4422.52033006602
+KCNAB2	14.472866871752	26.0071232987046	98.0568372347768	139.265892445833
+KIAA0090	75.0221900923905	106.982092747177	2619.54097689511	2814.94479083254
+KIAA0495	53.1784425108188	75.9934182768027	301.178753240637	296.492504087296
+KIAA0562	23.4536077035124	30.4155950084256	552.955561310365	757.122210924832
+KIAA1751	0.124854649064705	0.147995553518561	0	0
+KIAA2013	87.6070922762549	142.540272990766	2235.34892030079	1016.20334845621
+KIF17	15.2331384334259	40.1105728721002	62.825982814168	237.073941704818
+KIF1B	78.4463774846293	111.037884709977	958.82950446031	1462.83998698116
+KLHDC7A	29.4976583180273	34.0128833944181	0	1.70197917290678
+KLHL17	88.4149865150737	139.743229547414	402.664189240798	385.634425836106
+KLHL21	45.7081683780084	64.1115115382759	1140.79410997292	1285.06857702427
+LDLRAD2	3.59538453721335	6.68521812139144	76.1340375265393	338.51369086515
+LRRC38	0.997683514322432	1.47823110632106	0	0
+LRRC47	167.727959048214	235.517074003772	1609.60980616476	1612.38422270307
+LUZP1	54.5077436444742	74.5740215696991	793.059726494864	1259.65975718178
+LYPLA2	339.908534559412	474.507682586206	1769.12671671444	899.71679762656
+LZIC	24.5909618538249	35.5038220040877	1005.55759760837	1328.64742363139
+MAD2L2	797.802503952905	1305.4448801087	3002.54966649886	2339.60499136296
+MASP2	6.94294362970907	10.4836075684965	17.3641720890563	16.8953743526098
+MEGF6	24.9133362230742	41.5314394969293	107.890965396316	259.377741818583
+MFAP2	570.353630763356	951.524946192844	4072.22816859979	1290.37024329098
+MFN2	109.138239264186	175.569198648429	3384.37411958815	3187.33975186549
+MIB2	72.1921445934075	105.877740006373	548.104608562341	842.319837122101
+MIIP	152.156382122545	219.249266599866	749.357895700436	551.454150999317
+MMEL1	1.35218731641887	2.59812893600714	1.9457853553284	6.10731690978305
+MMP23B	7.44397573330445	13.7807209705557	42.2011921224724	16.2670454373069
+MORN1	12.1189773398316	22.5921149570219	117.104726780606	115.439591842647
+MRPL20	575.672594221529	786.216186065711	10475.7619523782	9030.95571681375
+MRTO4	115.820605846853	175.534021130212	2266.6396732955	1473.2148439687
+MST1	11.436606389674	26.2428762056621	18.1752386648597	15.1154146036243
+MSTP9	4.88016781424482	7.61152114597714	3.65209942678968	3.55005851843959
+MTHFR	24.4475063276812	29.9700789192959	582.652443982103	920.313167786806
+MTOR	124.73936895399	181.787722378907	941.518274269282	910.65217053747
+MUL1	43.3272006808776	62.561780331408	1786.27725008401	1654.45029118442
+MXRA8	17.1568275470348	30.24735314324	16870.3622806594	15899.5507870047
+MYOM3	0.310421878415021	0.976053727109405	0	0
+NADK	147.791664362847	198.074254201433	1436.260234407	1430.74198842295
+NBL1	20.0871324682544	36.2462919848782	15872.8448293203	8582.52849084122
+NBPF1	51.5703448730042	58.6048802693097	1706.92782325294	2229.62017496562
+NBPF3	7.68495419423518	9.85151423019643	363.760809561629	869.632664928996
+NECAP2	65.7636829492125	96.2138649556517	3701.02434454676	5026.27670642801
+NIPAL3	18.8632148299027	24.5281240302511	1308.81945494026	2494.67782270471
+NMNAT1	4.78702557232616	7.04611074195382	314.687302277864	420.645042396772
+NOC2L	234.728893985379	312.96361094634	3237.14842462	1785.16903474856
+NOL9	25.584267048995	30.1478510202841	399.044328237984	433.83104623246
+NPHP4	25.0160670907537	31.4174022684124	132.796837435761	130.998815020073
+NPPA	0.710192088474257	2.89406878186218	13.429851621239	27.4507568623061
+NPPB	0.705955005423599	1.74331524334027	0	0
+OTUD3	19.974820095962	26.6627640369539	85.6445817254726	116.089955401405
+PADI1	0.185516840463236	1.24182414771582	0	1.11316504418009
+PADI2	7.51899928234925	12.2918361015747	0	2.02472269658805
+PADI3	0.869450628853144	3.30460477762227	0	0.728834344112798
+PADI4	0.383826315779788	1.10110298423884	0	0
+PADI6	0	0.0707671159325972	0	0
+PANK4	41.8970367940307	68.1135465099719	638.532122052508	500.8015989744
+PARK7	1077.81774511544	1540.15324809546	24362.6961564898	24307.5268486402
+PAX7	0.21145536824581	0.0816882815741125	0	0
+PDPN	204.703088605948	309.476711243959	165.120606833283	85.5475350277717
+PER3	10.0624111654097	27.5498566921273	236.275948645371	607.667822838314
+PEX10	58.1307855336005	80.7060283478488	1151.06186639986	930.452221357871
+PEX14	73.4945032707565	107.881910331134	1371.46977439048	1094.01402382356
+PGD	890.161300907484	1280.00698110311	19121.666094945	12476.1466550127
+PHF13	77.8551548549547	121.472277853625	742.138646029597	1030.19031622626
+PIK3CD	50.9607746055481	82.4895572377791	183.485391801705	221.213373384644
+PINK1	50.0818469155858	85.5475963290434	2692.36077455866	4317.35515886264
+PLA2G2A	3.74974538819337	7.92256771625009	22.9259041929206	6.51597423568075
+PLA2G2F	0	0.122170264426813	0	0
+PLA2G5	0.201088163638666	0	277.115482877212	55.4248127286894
+PLCH2	0.193540142248261	0.544784065319548	5.22902173840885	0.616837768527375
+PLEKHG5	42.2674777253159	83.4115088410516	107.045403068473	55.8901444256815
+PLEKHM2	93.8608844360673	140.071313747926	2597.10278065526	2783.72448827927
+PLEKHN1	2.5736879406531	4.40844119860827	80.117711730481	53.72785611922
+PLOD1	109.603259722424	181.797773098397	7647.61830726864	16571.3813969054
+PNRC2	143.027070406672	152.609586312322	2011.01065422974	2090.32021814912
+PQLC2	38.0703573702872	61.4706383280928	714.709789866736	633.259418304438
+PRAMEF12	0	0.279456665890625	0	0
+PRAMEF17	0	0.106673490789535	0	0
+PRDM16	0.611027729076883	0.984067740086007	7.62453585986095	11.4951548439442
+PRDM2	18.6581906890874	28.2475997148451	394.131386140751	725.046460696322
+PRKCZ	117.712024291513	181.492407113477	53.2817718056418	161.944015592889
+PTCHD2	9.26750946108815	13.0498685446334	1.20260777463017	0
+PUSL1	94.6023146270327	149.809078960288	1102.09270198373	867.275989488539
+Pex14	13.4164623711511	17.5741837703391	583.441949667253	549.700888764663
+RAP1GAP	20.2795577553702	34.2314656737353	1.93869267311573	2.97246652674793
+RBP7	27.4187934555505	47.5241092022853	22.1452327263775	21.8273080337132
+RCAN3	17.5062860157843	22.073693461388	305.126521225719	626.138147907035
+RCC2	609.224891778857	1055.45297526727	1398.04583673645	985.098041731445
+RER1	95.2926149754708	147.338450580103	4103.2887729276	4944.55939763565
+RERE	124.283460004597	168.245837014558	1692.02943382284	3015.46946770012
+RNF186	0	0.132978736376042	0	0
+RNF207	8.17889719501219	15.6369991218838	54.0689440848903	102.812840504349
+RPL11	9264.50338715238	15259.6279877625	120354.990597382	151466.498386692
+RPL22	548.222657612127	767.825253908004	9672.8039620794	12962.5458958234
+RSC1A1	35.1225700307662	41.556494504802	304.983855853392	560.365515506551
+SAMD11	0.975266140467855	0.759252887568278	45.0300230436727	49.0319495170954
+SCNN1D	7.71336638783454	15.5462142033146	63.1275559900522	82.3917376076902
+SDF4	227.240662691068	321.830494596159	11192.2468917904	9591.92021655629
+SDHB	197.976221969527	275.147419909074	5863.32070994542	6298.70789527058
+SFRS13A	205.264479559859	266.370449636862	2681.6216041	2951.10917707711
+SH2D5	32.9533496689486	61.4520589305865	461.673162743305	234.472126490938
+SKI	92.3897739483106	127.413509412446	1927.52535349287	1842.60449966352
+SLC25A33	24.6601200693325	47.4403292762466	384.468466133855	215.085637104663
+SLC25A34	1.29825648901777	1.62759915612056	13.5765083834194	18.5813260646421
+SLC2A5	0.260483267812907	0.67541240881633	16.3041560887102	277.689332454979
+SLC2A7	0.0850275751047418	0	0	1.50881939106148
+SLC35E2	148.195682693737	196.923064964221	2067.76811117078	1857.68513708358
+SLC45A1	4.67322725382105	7.40698541480283	209.893713081992	276.198152896982
+SNORA59B	70.9971332886744	105.042223120801	0	7.63837259791362
+SPATA21	0	0	0	0.421441602389182
+SPEN	44.739917755163	69.6967143068591	370.216859396859	705.713648864823
+SPSB1	9.36693255552896	17.1492196077962	1069.35809905486	928.952594894819
+SRM	630.872113478932	863.35788109659	13885.6472427043	10515.013041803
+SRRM1	206.293153123351	341.575191544788	1880.1932053956	1866.94085134705
+SSU72	421.885125021761	622.441135221715	7183.53255691694	7971.41981761877
+TARDBP	338.973195508834	354.890905209488	3389.02992475779	2875.62970311353
+TAS1R1	0.104532874176939	0.301336364312904	2.07586161450828	11.4261958512478
+TAS1R3	0.383670837382131	0.355294728760446	3.17808783001526	6.82179031203873
+TCEA3	0.342791887378255	2.05463807432979	697.871844834797	1162.76725857631
+TCEB3	66.3457181111293	88.7236236880408	1421.63855158543	1400.03239874456
+THAP3	26.4479436136909	46.4358316540248	610.415901745808	659.114263612162
+TMCO4	7.28461701024201	13.4397549602983	686.596981615835	762.544823154734
+TMEM201	46.7212584959948	75.1142315893713	483.629851870259	264.737194782622
+TMEM51	27.3222662946233	43.5463020104048	615.525571093196	1028.81703236019
+TMEM52	34.5935874213324	56.6517060030079	23.2189296396117	29.6663247082648
+TMEM82	3.19694443891178	6.78513304175502	0	0
+TNFRSF14	0.233903600408319	1.19403444932786	757.172163875933	1281.49260022451
+TNFRSF18	4.12474694120627	6.74051502630256	22.6557540136091	11.4285119276378
+TNFRSF1B	3.51012702902294	7.00504996329246	1111.85800567783	2122.80867549515
+TNFRSF25	36.1105818392679	73.3724221591833	36.5881699419189	13.7686477624628
+TNFRSF4	0.075773999356543	0.36081311219213	6.79357920008104	6.51002491319665
+TNFRSF8	49.9796942851226	84.6089111769997	17.6154690266992	1.17529172475299
+TNFRSF9	0	0.0882052937257451	1.77370767678915	1.35973512662098
+TP73	8.46926746361882	14.4749941618466	9.64068706122226	1.35103553637155
+TPRG1L	58.8362301900852	92.7512700467242	3064.62673856174	3092.21092371814
+TTLL10	1.73177686366537	3.49901213493462	0	0
+UBE2J2	92.7379743475829	120.035383920751	2709.58020944209	1804.1917777818
+UBE4B	143.430326774727	197.625746659229	1536.28340626825	1782.38757239439
+UBIAD1	38.0149429703894	53.8574982983691	437.664397219596	318.157130986608
+UBR4	303.552035743086	376.94301475077	2252.79227409763	2605.89428690059
+UBXN10	1.79331869688632	3.80448449056755	1.0834421848588	0
+USP48	103.071349941227	139.574695134501	1549.29896497382	1952.07166035945
+UTS2	0	0.258346565417903	0	0
+VAMP3	57.7621237024533	96.0518545365503	6927.79406589322	9354.18929334716
+VPS13D	20.9475855266294	26.9671254093864	348.297196578629	471.117674983028
+VWA1	63.5031219959163	96.7039488066364	383.721886311972	706.734015743318
+VWA5B1	2.22741438314528	3.57990475309504	0	1.31365883581771
+WDR8	77.6406065347677	100.805988437263	661.677527392987	517.991532067406
+WNT4	7.61041931023364	15.2001517783147	0	1.79395742579473
+XLOC_000001	0	0.111620060073064	12.3070651310389	24.7883212671309
+XLOC_000004	163547.84518143	150008.962644156	31341.9338316771	0
+XLOC_000005	81.6040495959105	129.579530457555	63.7204722280739	45.7340910165949
+XLOC_000008	10486.3888872409	17994.197953533	52511.5387324361	107256.201346603
+XLOC_000009	807.284193808201	1261.03685290273	3024.76545173384	55503.7467702334
+XLOC_000011	3765.29512811875	6046.71027033079	18029.8531686299	67873.1683200467
+XLOC_000012	24.6631346886458	31.479230346221	333.581836425517	327.453659925217
+XLOC_000013	3.27907501233071	5.33084777462007	65.2509443529865	106.528467987978
+XLOC_000014	2.81993899604295	5.76710284364781	0.528120197752992	0.80972368775293
+XLOC_000020	3.78219361228549	6.37245767856051	127.598339288124	28.6749805291911
+XLOC_000021	0.241006945522658	0.238060264989136	0	0
+XLOC_000031	66.3390004948641	102.79660522321	554.345368683344	744.921366497279
+XLOC_000032	6.63384782773452	14.1293911983091	0	0
+XLOC_000037	0.812922956153769	2.81045038524391	0	11.0785611874907
+XLOC_000040	8.10149269013884	22.8466494281188	75.3048419278165	137.119740832445
+XLOC_000041	10.6716692892124	12.5415749436575	50.4399805977379	144.564809256974
+XLOC_000042	0.320111031048259	0.711445563448921	20.3091064417467	4.67074141893955
+XLOC_000046	13.0167464005023	20.4435223979407	95.0999386735299	135.299685478186
+XLOC_000058	7.94858977433594	18.9457857167227	57.347962726739	72.2257309492687
+XLOC_000060	3.70976322927918	3.59047057195943	4.47183702697288	5.00770314140861
+XLOC_000064	1.80705064391604	3.84646419215375	0.340359169837346	0
+XLOC_000099	26.9427447128	34.947787485532	11.9362517122089	2.28760719149588
+XLOC_000129	18.772462633958	29.3468930311443	353.587071781866	758.240294777622
+XLOC_000138	38.8700741575041	51.7940496915431	202.53853151081	344.095867778729
+XLOC_000148	1.57031994775796	2.0703046333356	2.54033057482786	0.518381268897529
+XLOC_000158	1.63670091555161	4.29047267335988	0	0
+XLOC_000173	1.06214651959231	1.12407426258865	0.669622554351972	7.18675196052498
+XLOC_000174	529.705405954172	9418.1343848515	3679.99023128108	22568.9992411476
+XLOC_000179	53.0677442654029	80.9418864284067	485.640103066908	724.628699874925
+XLOC_000187	1.0725849356793	1.29123388065767	26.360772631746	15.4131952005694
+XLOC_000188	485.665022302667	730.200923926726	2500.18608736872	2893.71714995025
+XLOC_000190	0.114539036581279	0.169708372845532	0	0
+XLOC_001217	130.676612377691	209.33874703643	2027.34232722767	1140.52321249461
+XLOC_001218	1.11065103222938	4.57113901513204	9.52791266360871	0
+XLOC_001219	0.28644580395248	0.462998956729158	11.3705108476242	19.898838698614
+XLOC_001220	76.2580000478759	118.977904648644	17.6627820045462	27.9729729298378
+XLOC_001222	126.034325977775	193.513860913044	87.3738347178654	163.72394213182
+XLOC_001223	163547.84518143	150008.962644156	31341.9338316771	0
+XLOC_001225	163547.84518143	150008.962644156	31341.9338316771	0
+XLOC_001227	28.4239434935344	44.1599898071085	42.4480653881083	73.0480407662068
+XLOC_001228	2.96779776535697	2.72934466849826	37.1746781190191	53.9434758606289
+XLOC_001230	1.04098840207296	0	9.44420723023971	7.24002040593887
+XLOC_001235	0.643193954521966	1.20378544200498	0	0
+XLOC_001241	4.11476546544828	7.20519927331771	27.1926538485809	19.1088966517602
+XLOC_001249	9.59909351607688	12.2964666116257	170.271058414378	55.3105894310116
+XLOC_001255	43.8864481692447	57.2375911584504	656.756902666893	1708.04361756199
+XLOC_001261	0.90538512843992	1.62893626076707	0	0
+XLOC_001262	2.57484095100331	8.57724811776433	32.879450200818	28.7871005595427
+XLOC_001265	102.124501928649	178.840887319719	260.853867089462	140.036931233652
+XLOC_001269	0.11275216952578	0.222119105968671	10.1892351170661	27.5651269941468
+XLOC_001271	0	0	0.739963735624112	0
+XLOC_001272	0	0	3.40547383237821	18.2746745328208
+XLOC_001279	0	0.196093126802293	0	0
+XLOC_001300	29.1309548025757	32.8750060677505	61.2454109786738	99.1536701126289
+XLOC_001302	26.859308595584	46.1638520055266	48.8092380588883	91.298890695025
+XLOC_001321	304.286653369147	352.220285459156	2808.34205445117	1561.66669448542
+XLOC_001325	38.3463137232589	44.5659670836712	223.97284590171	244.287622687443
+XLOC_001335	0.500183500127258	0.594266737589076	5.3417274447352	0.450899882954414
+XLOC_001338	1730.03542846583	3865.41697747869	28354.734013617	17953.5236839171
+XLOC_001339	7.23103916627791	10.251015971773	43.8346808379212	47.6814554489967
+XLOC_001349	23.8440839846515	29.2782663595089	51.1774249153872	102.986302873693
+XLOC_001350	1.4752288850076	2.1408032514761	0.816249598627034	1.00664968225117
+XLOC_001351	21.2015565220575	33.3290832161605	1407.51704323402	2617.27714122475
+XLOC_001353	83.4951990071602	149.319321757687	624.002928066391	695.456434884007
+XLOC_001356	50.2094341503045	115.190039740662	230.807964129475	606.651426727153
+XLOC_001372	1.91582617937623	2.83861034753068	14.2153949190097	24.2174693160748
+XLOC_001379	0.0910349755442975	0.134883347719491	0	5.64750205253292
+XLOC_001388	0.0532721212125523	0.236667522431167	0.70418227693387	0.539833038602494
+XLOC_001389	6.75542956098647	11.622221273691	475.397331693707	735.365654745429
+XLOC_001394	0	0.325668438290865	0	0
+XLOC_001401	0.184850759376464	0.27372057669569	0	0
+XLOC_001404	6.91245087404029	18.7625395631549	84.3316006411086	171.862029782374
+ZBTB17	39.465672732615	62.8537160424089	792.615674949323	724.307200079801
+ZBTB40	36.5722648528181	24.6063437546859	225.002031996727	308.369466259324
+ZBTB48	38.6672531811893	60.54808278606	285.548786027533	290.958457686854
+ZNF436	1.88956101189413	3.81408651722365	381.877284921004	509.309870434116
diff -r 000000000000 -r f3fefb6d8254 test-data/test02_samples_annotation.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test02_samples_annotation.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,5 @@
+sampleID	condition
+cancer0	cancer
+cancer1	cancer
+health0	health
+health1	health
diff -r 000000000000 -r f3fefb6d8254 test-data/test03_cancer_counts.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test03_cancer_counts.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,355 @@
+Geneid	cancer0
+AADACL3	1.33294716142329
+AADACL4	0.16565689184278
+ACAP3	66.9545762637869
+ACOT7	455.514031889104
+ACTL8	2.25786678564214
+AGMAT	14.1868697001226
+AGRN	223.424831149421
+AGTRAP	187.400533886563
+AJAP1	8.63047529957261
+AKR7A2	83.7117317539189
+AKR7A3	1.86761600752251
+AKR7L	1.63323529019925
+ALDH4A1	80.0692491307954
+ALPL	598.739713486774
+ANGPTL7	0.111187468282468
+APITD1	27.9435627190935
+ARHGEF10L	80.3813346280653
+ARHGEF16	44.2754028984311
+ARHGEF19	115.733727841445
+ASAP3	88.368604104536
+ATAD3A	170.332210340393
+ATAD3B	115.009269719842
+ATAD3C	9.18645892844685
+ATP13A2	173.079288123976
+AURKAIP1	431.089374951588
+B3GALT6	34.5537089926203
+C1orf126	0.748005384270891
+C1orf127	0.219649529265469
+C1orf128	157.021218105179
+C1orf130	0.270304535188066
+C1orf144	169.905131358614
+C1orf151	81.934540083501
+C1orf158	0.306319741118665
+C1orf159	25.4472609092091
+C1orf167	0.852445327466635
+C1orf170	1.12825925747856
+C1orf174	65.3123327213875
+C1orf187	38.4882619397459
+C1orf200	0.140010077377323
+C1orf201	16.9572193953188
+C1orf211	14.6209036697657
+C1orf213	0.518508587606857
+C1orf222	0.381237303744296
+C1orf70	7.51184976845881
+C1orf86	225.001393970245
+C1orf89	5.10917443855593
+C1orf93	100.534745697611
+CAD	1.78359239559776
+CALML6	2.92860771428337
+CAMK2N1	14.2906082102419
+CAMTA1	200.588720737929
+CAPZB	619.112320909139
+CASP9	51.1870965570691
+CASZ1	13.6330268070182
+CCDC27	0.0573867205178809
+CCNL2	154.506479643163
+CDA	13.5485774691298
+CDC2L1	290.944540530384
+CDC2L2	170.977132360159
+CDC42	203.801007690173
+CELA2B	0.159866211673547
+CHD5	3.05969618009437
+CLCN6	47.6704636085561
+CLCNKA	2.63522828591018
+CLCNKB	5.15929663864343
+CLSTN1	202.476075380806
+CORT	2.88722197591461
+CPSF3L	295.347158226512
+CROCC	78.3541158913447
+CTNNBIP1	77.4633730300185
+CTRC	0
+Cort	1.39537707894365
+DDI2	32.8160456278053
+DDOST	604.449663575025
+DFFA	130.006170003179
+DFFB	13.2342440141516
+DHRS3	87.0464324268709
+DNAJC11	170.344114526107
+DNAJC16	19.7622965555186
+DVL1	134.516467764835
+DVL1L1	3.31326839123532
+E2F2	10.4399946081232
+ECE1	66.4571391530656
+EFHD2	53.7957629609978
+EIF4G3	88.0324265767771
+ENO1	6558.87666660173
+EPHA2	77.3221844026497
+EPHA8	7.41680618002836
+EPHB2	32.3112950981041
+ERRFI1	61.8103776457282
+ESPN	19.6610267100338
+ESPNP	0.129073180931436
+EXOSC10	173.284597941512
+FAM131C	2.24876951909219
+FAM132A	3.84947896587315
+FAM41C	0.302278489637574
+FAM43B	5.46152884081911
+FBLIM1	111.14573835528
+FBXO2	154.152795959943
+FBXO42	32.5697215584544
+FBXO44	66.872920433567
+FBXO6	3.50735527954742
+FHAD1	0.921397741797418
+FUCA1	17.0659023558552
+GABRD	4.99857114177978
+GALE	66.7029801712116
+GLTPD1	23.9392818646217
+GNB1	552.837447538731
+GPR153	29.2904210431041
+GPR157	6.9246933142833
+GRHL3	3.17376836133494
+H6PD	9.73184391540445
+HES2	0.860500532694876
+HES3	187.003719783718
+HES4	3.26807877298495
+HES5	0.413503700004359
+HMGCL	39.2773527873122
+HNRNPR	358.051830999552
+HP1BP3	139.453393502231
+HSPB7	0.394310461505414
+HSPG2	121.689737329714
+HTR1D	13.8118225729494
+HTR6	2.35343259159145
+ICMT	166.884696441074
+ID3	449.723045510507
+IFFO2	11.1211442814015
+IGSF21	48.2382101870424
+IL22RA1	0.705781326914609
+IL28RA	26.6775412932847
+ISG15	119.116629191387
+KCNAB2	14.472866871752
+KIAA0090	75.0221900923905
+KIAA0495	53.1784425108188
+KIAA0562	23.4536077035124
+KIAA1751	0.124854649064705
+KIAA2013	87.6070922762549
+KIF17	15.2331384334259
+KIF1B	78.4463774846293
+KLHDC7A	29.4976583180273
+KLHL17	88.4149865150737
+KLHL21	45.7081683780084
+LDLRAD2	3.59538453721335
+LRRC38	0.997683514322432
+LRRC47	167.727959048214
+LUZP1	54.5077436444742
+LYPLA2	339.908534559412
+LZIC	24.5909618538249
+MAD2L2	797.802503952905
+MASP2	6.94294362970907
+MEGF6	24.9133362230742
+MFAP2	570.353630763356
+MFN2	109.138239264186
+MIB2	72.1921445934075
+MIIP	152.156382122545
+MMEL1	1.35218731641887
+MMP23B	7.44397573330445
+MORN1	12.1189773398316
+MRPL20	575.672594221529
+MRTO4	115.820605846853
+MST1	11.436606389674
+MSTP9	4.88016781424482
+MTHFR	24.4475063276812
+MTOR	124.73936895399
+MUL1	43.3272006808776
+MXRA8	17.1568275470348
+MYOM3	0.310421878415021
+NADK	147.791664362847
+NBL1	20.0871324682544
+NBPF1	51.5703448730042
+NBPF3	7.68495419423518
+NECAP2	65.7636829492125
+NIPAL3	18.8632148299027
+NMNAT1	4.78702557232616
+NOC2L	234.728893985379
+NOL9	25.584267048995
+NPHP4	25.0160670907537
+NPPA	0.710192088474257
+NPPB	0.705955005423599
+OTUD3	19.974820095962
+PADI1	0.185516840463236
+PADI2	7.51899928234925
+PADI3	0.869450628853144
+PADI4	0.383826315779788
+PADI6	0
+PANK4	41.8970367940307
+PARK7	1077.81774511544
+PAX7	0.21145536824581
+PDPN	204.703088605948
+PER3	10.0624111654097
+PEX10	58.1307855336005
+PEX14	73.4945032707565
+PGD	890.161300907484
+PHF13	77.8551548549547
+PIK3CD	50.9607746055481
+PINK1	50.0818469155858
+PLA2G2A	3.74974538819337
+PLA2G2F	0
+PLA2G5	0.201088163638666
+PLCH2	0.193540142248261
+PLEKHG5	42.2674777253159
+PLEKHM2	93.8608844360673
+PLEKHN1	2.5736879406531
+PLOD1	109.603259722424
+PNRC2	143.027070406672
+PQLC2	38.0703573702872
+PRAMEF12	0
+PRAMEF17	0
+PRDM16	0.611027729076883
+PRDM2	18.6581906890874
+PRKCZ	117.712024291513
+PTCHD2	9.26750946108815
+PUSL1	94.6023146270327
+Pex14	13.4164623711511
+RAP1GAP	20.2795577553702
+RBP7	27.4187934555505
+RCAN3	17.5062860157843
+RCC2	609.224891778857
+RER1	95.2926149754708
+RERE	124.283460004597
+RNF186	0
+RNF207	8.17889719501219
+RPL11	9264.50338715238
+RPL22	548.222657612127
+RSC1A1	35.1225700307662
+SAMD11	0.975266140467855
+SCNN1D	7.71336638783454
+SDF4	227.240662691068
+SDHB	197.976221969527
+SFRS13A	205.264479559859
+SH2D5	32.9533496689486
+SKI	92.3897739483106
+SLC25A33	24.6601200693325
+SLC25A34	1.29825648901777
+SLC2A5	0.260483267812907
+SLC2A7	0.0850275751047418
+SLC35E2	148.195682693737
+SLC45A1	4.67322725382105
+SNORA59B	70.9971332886744
+SPATA21	0
+SPEN	44.739917755163
+SPSB1	9.36693255552896
+SRM	630.872113478932
+SRRM1	206.293153123351
+SSU72	421.885125021761
+TARDBP	338.973195508834
+TAS1R1	0.104532874176939
+TAS1R3	0.383670837382131
+TCEA3	0.342791887378255
+TCEB3	66.3457181111293
+THAP3	26.4479436136909
+TMCO4	7.28461701024201
+TMEM201	46.7212584959948
+TMEM51	27.3222662946233
+TMEM52	34.5935874213324
+TMEM82	3.19694443891178
+TNFRSF14	0.233903600408319
+TNFRSF18	4.12474694120627
+TNFRSF1B	3.51012702902294
+TNFRSF25	36.1105818392679
+TNFRSF4	0.075773999356543
+TNFRSF8	49.9796942851226
+TNFRSF9	0
+TP73	8.46926746361882
+TPRG1L	58.8362301900852
+TTLL10	1.73177686366537
+UBE2J2	92.7379743475829
+UBE4B	143.430326774727
+UBIAD1	38.0149429703894
+UBR4	303.552035743086
+UBXN10	1.79331869688632
+USP48	103.071349941227
+UTS2	0
+VAMP3	57.7621237024533
+VPS13D	20.9475855266294
+VWA1	63.5031219959163
+VWA5B1	2.22741438314528
+WDR8	77.6406065347677
+WNT4	7.61041931023364
+XLOC_000001	0
+XLOC_000004	163547.84518143
+XLOC_000005	81.6040495959105
+XLOC_000008	10486.3888872409
+XLOC_000009	807.284193808201
+XLOC_000011	3765.29512811875
+XLOC_000012	24.6631346886458
+XLOC_000013	3.27907501233071
+XLOC_000014	2.81993899604295
+XLOC_000020	3.78219361228549
+XLOC_000021	0.241006945522658
+XLOC_000031	66.3390004948641
+XLOC_000032	6.63384782773452
+XLOC_000037	0.812922956153769
+XLOC_000040	8.10149269013884
+XLOC_000041	10.6716692892124
+XLOC_000042	0.320111031048259
+XLOC_000046	13.0167464005023
+XLOC_000058	7.94858977433594
+XLOC_000060	3.70976322927918
+XLOC_000064	1.80705064391604
+XLOC_000099	26.9427447128
+XLOC_000129	18.772462633958
+XLOC_000138	38.8700741575041
+XLOC_000148	1.57031994775796
+XLOC_000158	1.63670091555161
+XLOC_000173	1.06214651959231
+XLOC_000174	529.705405954172
+XLOC_000179	53.0677442654029
+XLOC_000187	1.0725849356793
+XLOC_000188	485.665022302667
+XLOC_000190	0.114539036581279
+XLOC_001217	130.676612377691
+XLOC_001218	1.11065103222938
+XLOC_001219	0.28644580395248
+XLOC_001220	76.2580000478759
+XLOC_001222	126.034325977775
+XLOC_001223	163547.84518143
+XLOC_001225	163547.84518143
+XLOC_001227	28.4239434935344
+XLOC_001228	2.96779776535697
+XLOC_001230	1.04098840207296
+XLOC_001235	0.643193954521966
+XLOC_001241	4.11476546544828
+XLOC_001249	9.59909351607688
+XLOC_001255	43.8864481692447
+XLOC_001261	0.90538512843992
+XLOC_001262	2.57484095100331
+XLOC_001265	102.124501928649
+XLOC_001269	0.11275216952578
+XLOC_001271	0
+XLOC_001272	0
+XLOC_001279	0
+XLOC_001300	29.1309548025757
+XLOC_001302	26.859308595584
+XLOC_001321	304.286653369147
+XLOC_001325	38.3463137232589
+XLOC_001335	0.500183500127258
+XLOC_001338	1730.03542846583
+XLOC_001339	7.23103916627791
+XLOC_001349	23.8440839846515
+XLOC_001350	1.4752288850076
+XLOC_001351	21.2015565220575
+XLOC_001353	83.4951990071602
+XLOC_001356	50.2094341503045
+XLOC_001372	1.91582617937623
+XLOC_001379	0.0910349755442975
+XLOC_001388	0.0532721212125523
+XLOC_001389	6.75542956098647
+XLOC_001394	0
+XLOC_001401	0.184850759376464
+XLOC_001404	6.91245087404029
+ZBTB17	39.465672732615
+ZBTB40	36.5722648528181
+ZBTB48	38.6672531811893
+ZNF436	1.88956101189413
diff -r 000000000000 -r f3fefb6d8254 test-data/test03_health_counts.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test03_health_counts.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,355 @@
+Geneid	health0
+AADACL3	0
+AADACL4	0
+ACAP3	1393.95324090613
+ACOT7	7395.10823740127
+ACTL8	6.29646468356414
+AGMAT	56.2113078807145
+AGRN	2144.12485688125
+AGTRAP	1943.78534029914
+AJAP1	2.78718070452411
+AKR7A2	3829.83857542184
+AKR7A3	19.1848890894377
+AKR7L	12.0382831872031
+ALDH4A1	588.92974612004
+ALPL	12.5179727486086
+ANGPTL7	11.7533214949055
+APITD1	802.720467188703
+ARHGEF10L	575.337403596391
+ARHGEF16	8.93761413278206
+ARHGEF19	192.61472131494
+ASAP3	977.339687032257
+ATAD3A	2909.59238880021
+ATAD3B	1204.49289913673
+ATAD3C	20.3511517744843
+ATP13A2	778.918736405516
+AURKAIP1	9367.79479097331
+B3GALT6	1107.4652590036
+C1orf126	0
+C1orf127	0.73417113252224
+C1orf128	2055.87258399552
+C1orf130	0
+C1orf144	6169.84439356059
+C1orf151	2316.80019551674
+C1orf158	0
+C1orf159	255.003897423656
+C1orf167	4.28017084616318
+C1orf170	42.2830759803238
+C1orf174	1150.25066664382
+C1orf187	22.7498270005338
+C1orf200	0
+C1orf201	301.219367711266
+C1orf211	1.41183164282385
+C1orf213	76.5600381962453
+C1orf222	0
+C1orf70	239.879629899723
+C1orf86	3491.25500640192
+C1orf89	202.484599015937
+C1orf93	1576.8889615254
+CAD	0
+CALML6	0
+CAMK2N1	8126.76185609601
+CAMTA1	3055.15380157953
+CAPZB	20316.4731362545
+CASP9	340.999216471908
+CASZ1	8.81866733613576
+CCDC27	0.75773394235314
+CCNL2	1152.06879708577
+CDA	176.302023749904
+CDC2L1	3112.41609597224
+CDC2L2	2067.4280282674
+CDC42	11564.694795414
+CELA2B	0
+CHD5	5.15789578430315
+CLCN6	574.076737032054
+CLCNKA	0.678927560712282
+CLCNKB	2.32675789513133
+CLSTN1	5093.23897792429
+CORT	8.23077012212674
+CPSF3L	3790.65155484617
+CROCC	165.209683502876
+CTNNBIP1	541.243734816617
+CTRC	2.62147985845083
+Cort	5.2816642560574
+DDI2	254.874844668067
+DDOST	13665.5007422144
+DFFA	1325.04655393129
+DFFB	127.460095995143
+DHRS3	1019.4715318943
+DNAJC11	2130.43084610145
+DNAJC16	344.527403240069
+DVL1	2152.3813715147
+DVL1L1	59.8262158993051
+E2F2	97.2088092893749
+ECE1	6832.6483396322
+EFHD2	2778.28294353325
+EIF4G3	2013.10224443396
+ENO1	93534.3399845077
+EPHA2	1390.10455203221
+EPHA8	0
+EPHB2	1707.12636087386
+ERRFI1	2062.3064004349
+ESPN	0.451453505296478
+ESPNP	0
+EXOSC10	1944.55712530741
+FAM131C	58.9032768191879
+FAM132A	128.448491513426
+FAM41C	4.95347952144023
+FAM43B	2.51816321877196
+FBLIM1	1673.86297734934
+FBXO2	53.5029060412522
+FBXO42	573.623814141438
+FBXO44	440.70354833884
+FBXO6	375.388875588851
+FHAD1	3.92992882180617
+FUCA1	173.703225947981
+GABRD	0.865565912204043
+GALE	1069.52511368286
+GLTPD1	930.45330751506
+GNB1	17713.2729458483
+GPR153	1159.24045408154
+GPR157	130.905914635676
+GRHL3	0.648123796243081
+H6PD	1098.37928461226
+HES2	2.59604614402101
+HES3	0
+HES4	11.5504692743939
+HES5	0
+HMGCL	1688.82684523087
+HNRNPR	6385.71855992608
+HP1BP3	4186.94412612279
+HSPB7	948.162427438671
+HSPG2	2789.41615140344
+HTR1D	0
+HTR6	0
+ICMT	2794.81710553285
+ID3	1856.58321013501
+IFFO2	254.481027389179
+IGSF21	0
+IL22RA1	5.34585936395826
+IL28RA	0
+ISG15	3105.38902825296
+KCNAB2	98.0568372347768
+KIAA0090	2619.54097689511
+KIAA0495	301.178753240637
+KIAA0562	552.955561310365
+KIAA1751	0
+KIAA2013	2235.34892030079
+KIF17	62.825982814168
+KIF1B	958.82950446031
+KLHDC7A	0
+KLHL17	402.664189240798
+KLHL21	1140.79410997292
+LDLRAD2	76.1340375265393
+LRRC38	0
+LRRC47	1609.60980616476
+LUZP1	793.059726494864
+LYPLA2	1769.12671671444
+LZIC	1005.55759760837
+MAD2L2	3002.54966649886
+MASP2	17.3641720890563
+MEGF6	107.890965396316
+MFAP2	4072.22816859979
+MFN2	3384.37411958815
+MIB2	548.104608562341
+MIIP	749.357895700436
+MMEL1	1.9457853553284
+MMP23B	42.2011921224724
+MORN1	117.104726780606
+MRPL20	10475.7619523782
+MRTO4	2266.6396732955
+MST1	18.1752386648597
+MSTP9	3.65209942678968
+MTHFR	582.652443982103
+MTOR	941.518274269282
+MUL1	1786.27725008401
+MXRA8	16870.3622806594
+MYOM3	0
+NADK	1436.260234407
+NBL1	15872.8448293203
+NBPF1	1706.92782325294
+NBPF3	363.760809561629
+NECAP2	3701.02434454676
+NIPAL3	1308.81945494026
+NMNAT1	314.687302277864
+NOC2L	3237.14842462
+NOL9	399.044328237984
+NPHP4	132.796837435761
+NPPA	13.429851621239
+NPPB	0
+OTUD3	85.6445817254726
+PADI1	0
+PADI2	0
+PADI3	0
+PADI4	0
+PADI6	0
+PANK4	638.532122052508
+PARK7	24362.6961564898
+PAX7	0
+PDPN	165.120606833283
+PER3	236.275948645371
+PEX10	1151.06186639986
+PEX14	1371.46977439048
+PGD	19121.666094945
+PHF13	742.138646029597
+PIK3CD	183.485391801705
+PINK1	2692.36077455866
+PLA2G2A	22.9259041929206
+PLA2G2F	0
+PLA2G5	277.115482877212
+PLCH2	5.22902173840885
+PLEKHG5	107.045403068473
+PLEKHM2	2597.10278065526
+PLEKHN1	80.117711730481
+PLOD1	7647.61830726864
+PNRC2	2011.01065422974
+PQLC2	714.709789866736
+PRAMEF12	0
+PRAMEF17	0
+PRDM16	7.62453585986095
+PRDM2	394.131386140751
+PRKCZ	53.2817718056418
+PTCHD2	1.20260777463017
+PUSL1	1102.09270198373
+Pex14	583.441949667253
+RAP1GAP	1.93869267311573
+RBP7	22.1452327263775
+RCAN3	305.126521225719
+RCC2	1398.04583673645
+RER1	4103.2887729276
+RERE	1692.02943382284
+RNF186	0
+RNF207	54.0689440848903
+RPL11	120354.990597382
+RPL22	9672.8039620794
+RSC1A1	304.983855853392
+SAMD11	45.0300230436727
+SCNN1D	63.1275559900522
+SDF4	11192.2468917904
+SDHB	5863.32070994542
+SFRS13A	2681.6216041
+SH2D5	461.673162743305
+SKI	1927.52535349287
+SLC25A33	384.468466133855
+SLC25A34	13.5765083834194
+SLC2A5	16.3041560887102
+SLC2A7	0
+SLC35E2	2067.76811117078
+SLC45A1	209.893713081992
+SNORA59B	0
+SPATA21	0
+SPEN	370.216859396859
+SPSB1	1069.35809905486
+SRM	13885.6472427043
+SRRM1	1880.1932053956
+SSU72	7183.53255691694
+TARDBP	3389.02992475779
+TAS1R1	2.07586161450828
+TAS1R3	3.17808783001526
+TCEA3	697.871844834797
+TCEB3	1421.63855158543
+THAP3	610.415901745808
+TMCO4	686.596981615835
+TMEM201	483.629851870259
+TMEM51	615.525571093196
+TMEM52	23.2189296396117
+TMEM82	0
+TNFRSF14	757.172163875933
+TNFRSF18	22.6557540136091
+TNFRSF1B	1111.85800567783
+TNFRSF25	36.5881699419189
+TNFRSF4	6.79357920008104
+TNFRSF8	17.6154690266992
+TNFRSF9	1.77370767678915
+TP73	9.64068706122226
+TPRG1L	3064.62673856174
+TTLL10	0
+UBE2J2	2709.58020944209
+UBE4B	1536.28340626825
+UBIAD1	437.664397219596
+UBR4	2252.79227409763
+UBXN10	1.0834421848588
+USP48	1549.29896497382
+UTS2	0
+VAMP3	6927.79406589322
+VPS13D	348.297196578629
+VWA1	383.721886311972
+VWA5B1	0
+WDR8	661.677527392987
+WNT4	0
+XLOC_000001	12.3070651310389
+XLOC_000004	31341.9338316771
+XLOC_000005	63.7204722280739
+XLOC_000008	52511.5387324361
+XLOC_000009	3024.76545173384
+XLOC_000011	18029.8531686299
+XLOC_000012	333.581836425517
+XLOC_000013	65.2509443529865
+XLOC_000014	0.528120197752992
+XLOC_000020	127.598339288124
+XLOC_000021	0
+XLOC_000031	554.345368683344
+XLOC_000032	0
+XLOC_000037	0
+XLOC_000040	75.3048419278165
+XLOC_000041	50.4399805977379
+XLOC_000042	20.3091064417467
+XLOC_000046	95.0999386735299
+XLOC_000058	57.347962726739
+XLOC_000060	4.47183702697288
+XLOC_000064	0.340359169837346
+XLOC_000099	11.9362517122089
+XLOC_000129	353.587071781866
+XLOC_000138	202.53853151081
+XLOC_000148	2.54033057482786
+XLOC_000158	0
+XLOC_000173	0.669622554351972
+XLOC_000174	3679.99023128108
+XLOC_000179	485.640103066908
+XLOC_000187	26.360772631746
+XLOC_000188	2500.18608736872
+XLOC_000190	0
+XLOC_001217	2027.34232722767
+XLOC_001218	9.52791266360871
+XLOC_001219	11.3705108476242
+XLOC_001220	17.6627820045462
+XLOC_001222	87.3738347178654
+XLOC_001223	31341.9338316771
+XLOC_001225	31341.9338316771
+XLOC_001227	42.4480653881083
+XLOC_001228	37.1746781190191
+XLOC_001230	9.44420723023971
+XLOC_001235	0
+XLOC_001241	27.1926538485809
+XLOC_001249	170.271058414378
+XLOC_001255	656.756902666893
+XLOC_001261	0
+XLOC_001262	32.879450200818
+XLOC_001265	260.853867089462
+XLOC_001269	10.1892351170661
+XLOC_001271	0.739963735624112
+XLOC_001272	3.40547383237821
+XLOC_001279	0
+XLOC_001300	61.2454109786738
+XLOC_001302	48.8092380588883
+XLOC_001321	2808.34205445117
+XLOC_001325	223.97284590171
+XLOC_001335	5.3417274447352
+XLOC_001338	28354.734013617
+XLOC_001339	43.8346808379212
+XLOC_001349	51.1774249153872
+XLOC_001350	0.816249598627034
+XLOC_001351	1407.51704323402
+XLOC_001353	624.002928066391
+XLOC_001356	230.807964129475
+XLOC_001372	14.2153949190097
+XLOC_001379	0
+XLOC_001388	0.70418227693387
+XLOC_001389	475.397331693707
+XLOC_001394	0
+XLOC_001401	0
+XLOC_001404	84.3316006411086
+ZBTB17	792.615674949323
+ZBTB40	225.002031996727
+ZBTB48	285.548786027533
+ZNF436	381.877284921004
diff -r 000000000000 -r f3fefb6d8254 test-data/test04.RData
Binary file test-data/test04.RData has changed
diff -r 000000000000 -r f3fefb6d8254 test-data/test04_summary.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test04_summary.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,2 @@
+Comparison	nrIsoforms	nrSwitches	nrGenes
+cancer vs health	91	70	54
diff -r 000000000000 -r f3fefb6d8254 test-data/test06_consequences_enrichment.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test06_consequences_enrichment.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,6 @@
+condition_1	condition_2	conseqPair	feature	propOfRelevantEvents	propCiLo	propCiHi	propPval	nUp	nDown	propQval	Significant
+cancer	health	NMD_status	NMD insensitive (paired with NMD sensitive)	0.333333333333333	0.00840375865961264	0.905700675949754	1	1	2	1	FALSE
+cancer	health	intron_retention	Intron retention gain (paired with Intron retention loss)	0.25	0.0548606445279928	0.571858461878189	0.14599609375	3	9	0.72998046875	FALSE
+cancer	health	isoform_length	Length gain (paired with Length loss)	0.423076923076923	0.233521983127443	0.630819619076033	0.557197093963623	11	15	0.928661823272706	FALSE
+cancer	health	tss	Tss more downstream (paired with Tss more upstream)	0.575757575757576	0.392153016187885	0.745238177265304	0.486850241664797	19	14	0.928661823272706	FALSE
+cancer	health	tts	Tts more downstream (paired with Tts more upstream)	0.5	0.210944638239297	0.789055361760703	1	6	6	1	FALSE
diff -r 000000000000 -r f3fefb6d8254 test-data/test06_consequences_summary.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test06_consequences_summary.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,19 @@
+Comparison	featureCompared	switchConsequence	nrGenesWithConsequences	nrIsoWithConsequences
+cancer vs health	Intron
+retention	Intron retention gain	3	5
+cancer vs health	Intron
+retention	Intron retention loss	9	11
+cancer vs health	Isoform seq
+similarity	Length gain	11	17
+cancer vs health	Isoform seq
+similarity	Length loss	15	26
+cancer vs health	NMD
+status	NMD insensitive	1	3
+cancer vs health	NMD
+status	NMD sensitive	2	2
+cancer vs health	Tss	Tss more downstream	19	30
+cancer vs health	Tss	Tss more upstream	14	29
+cancer vs health	Tts	Tts more downstream	6	13
+cancer vs health	Tts	Tts more upstream	6	8
+cancer vs health	ORF
+genomic	Any consequence	0	0
diff -r 000000000000 -r f3fefb6d8254 test-data/test06_splicing_enrichment.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test06_splicing_enrichment.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,22 @@
+condition_1	condition_2	AStype	nUp	nDown	propUp	propUpCiLo	propUpCiHi	propUpPval	propUpQval	Significant	Comparison
+cancer	health	A3 gain (paired with A3 loss)	15	8	0.652173913043478	0.427343963036494	0.83623640162505	0.210039615631104	0.367569327354431	FALSE	cancer
+vs
+health
+cancer	health	A5 gain (paired with A5 loss)	9	6	0.6	0.322869766206282	0.836635676140487	0.60723876953125	0.60723876953125	FALSE	cancer
+vs
+health
+cancer	health	ATSS gain (paired with ATSS loss)	19	13	0.59375	0.406449246576476	0.763015899448257	0.377085587475449	0.495082259178162	FALSE	cancer
+vs
+health
+cancer	health	ATTS gain (paired with ATTS loss)	4	11	0.266666666666667	0.0778715462910436	0.551003241036971	0.11846923828125	0.340657552083334	FALSE	cancer
+vs
+health
+cancer	health	ES (paired with EI)	10	15	0.4	0.211254806465142	0.61334650374316	0.42435622215271	0.495082259178162	FALSE	cancer
+vs
+health
+cancer	health	IR gain (paired with IR loss)	3	9	0.25	0.0548606445279928	0.571858461878189	0.14599609375	0.340657552083334	FALSE	cancer
+vs
+health
+cancer	health	MES (paired with MEI)	2	8	0.2	0.0252107263268334	0.556095462307641	0.109375	0.340657552083334	FALSE	cancer
+vs
+health
diff -r 000000000000 -r f3fefb6d8254 test-data/test06_splicing_summary.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test06_splicing_summary.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,17 @@
+Comparison	AStype	splicingResult	nrGenesWithConsequences	nrIsoWithConsequences
+cancer vs health	A3	A3 in isoform used less	16	19
+cancer vs health	A3	A3 in isoform used more	23	30
+cancer vs health	A5	A5 in isoform used less	11	13
+cancer vs health	A5	A5 in isoform used more	14	16
+cancer vs health	ATSS	ATSS in isoform used less	20	26
+cancer vs health	ATSS	ATSS in isoform used more	26	34
+cancer vs health	ATTS	ATTS in isoform used less	14	14
+cancer vs health	ATTS	ATTS in isoform used more	6	6
+cancer vs health	ES	ES in isoform used less	28	32
+cancer vs health	ES	ES in isoform used more	21	25
+cancer vs health	IR	IR in isoform used less	10	10
+cancer vs health	IR	IR in isoform used more	3	4
+cancer vs health	MEE	MEE in isoform used less	0	0
+cancer vs health	MEE	MEE in isoform used more	0	0
+cancer vs health	MES	MES in isoform used less	9	10
+cancer vs health	MES	MES in isoform used more	3	5
diff -r 000000000000 -r f3fefb6d8254 test-data/test06_switching.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test06_switching.tabular	Tue Jan 24 18:37:14 2023 +0000
@@ -0,0 +1,55 @@
+gene_ref	gene_id	gene_name	condition_1	condition_2	gene_switch_q_value	switchConsequencesGene	Rank
+geneComp_00000066	CLSTN1	CLSTN1	cancer	health	2.63840734749711e-51	FALSE	1
+geneComp_00000167	NADK	NADK	cancer	health	5.98021460938895e-40	TRUE	2
+geneComp_00000210	PRKCZ	PRKCZ	cancer	health	4.18324640310234e-37	TRUE	3
+geneComp_00000222	RPL11	RPL11	cancer	health	2.39911661782576e-29	TRUE	4
+geneComp_00000227	SDF4	SDF4	cancer	health	2.62564234344567e-28	TRUE	5
+geneComp_00000243	SRRM1	SRRM1	cancer	health	7.11497254534458e-22	TRUE	6
+geneComp_00000017	ARHGEF10L	ARHGEF10L	cancer	health	7.07643322536192e-20	TRUE	7
+geneComp_00000080	DVL1	DVL1	cancer	health	2.7041623161036e-19	TRUE	8
+geneComp_00000138	KIF1B	KIF1B	cancer	health	8.83353225639552e-16	TRUE	9
+geneComp_00000058	CDC2L1	CDC2L1	cancer	health	5.02785283461027e-13	NA	10
+geneComp_00000019	ARHGEF19	ARHGEF19	cancer	health	3.43190474162283e-12	TRUE	11
+geneComp_00000254	TMEM52	TMEM52	cancer	health	9.43836095793092e-12	TRUE	12
+geneComp_00000101	FBXO44	FBXO44	cancer	health	1.25146337218935e-11	TRUE	13
+geneComp_00000189	PER3	PER3	cancer	health	2.618343550887e-11	TRUE	14
+geneComp_00000219	RERE	RERE	cancer	health	9.86048379542823e-11	TRUE	15
+geneComp_00000003	ACAP3	ACAP3	cancer	health	3.66320856918666e-08	TRUE	16
+geneComp_00000281	XLOC_000005	NA	cancer	health	6.83756168564135e-08	TRUE	17
+geneComp_00000301	XLOC_000129	NA	cancer	health	1.89169990108601e-07	TRUE	18
+geneComp_00000085	EIF4G3	EIF4G3	cancer	health	9.53210349628728e-07	TRUE	19
+geneComp_00000277	WDR8	WDR8	cancer	health	2.4050379356366e-06	TRUE	20
+geneComp_00000200	PLEKHG5	PLEKHG5	cancer	health	2.65200395744161e-06	TRUE	21
+geneComp_00000165	MXRA8	MXRA8	cancer	health	4.09018221463055e-06	TRUE	22
+geneComp_00000194	PIK3CD	PIK3CD	cancer	health	4.26262542329329e-06	TRUE	23
+geneComp_00000118	HNRNPR	HNRNPR	cancer	health	4.43094440336388e-06	NA	24
+geneComp_00000323	XLOC_001249	NA	cancer	health	5.97869364244676e-06	TRUE	25
+geneComp_00000342	XLOC_001353	NA	cancer	health	1.47897331984417e-05	TRUE	26
+geneComp_00000153	MIB2	MIB2	cancer	health	1.85010676533132e-05	TRUE	27
+geneComp_00000004	ACOT7	ACOT7	cancer	health	2.22089528793497e-05	TRUE	28
+geneComp_00000119	HP1BP3	HP1BP3	cancer	health	3.95360727622295e-05	TRUE	29
+geneComp_00000352	ZBTB40	ZBTB40	cancer	health	7.08120622533635e-05	FALSE	30
+geneComp_00000069	CROCC	CROCC	cancer	health	0.00035468174423336	NA	31
+geneComp_00000142	LDLRAD2	LDLRAD2	cancer	health	0.000443465792700213	TRUE	32
+geneComp_00000053	CASP9	CASP9	cancer	health	0.0004985861544369	TRUE	33
+geneComp_00000077	DHRS3	DHRS3	cancer	health	0.00050532341155672	TRUE	34
+geneComp_00000261	TNFRSF8	TNFRSF8	cancer	health	0.00069495698171926	TRUE	35
+geneComp_00000267	UBE4B	UBE4B	cancer	health	0.00069495698171926	TRUE	36
+geneComp_00000285	XLOC_000012	NA	cancer	health	0.00069495698171926	TRUE	37
+geneComp_00000083	ECE1	ECE1	cancer	health	0.000730501167981291	TRUE	38
+geneComp_00000172	NIPAL3	NIPAL3	cancer	health	0.000884959331769316	TRUE	39
+geneComp_00000252	TMEM201	TMEM201	cancer	health	0.00130127619274632	TRUE	40
+geneComp_00000106	GALE	GALE	cancer	health	0.00190711749673494	TRUE	41
+geneComp_00000056	CCNL2	CCNL2	cancer	health	0.00213211505312704	TRUE	42
+geneComp_00000156	MMP23B	MMP23B	cancer	health	0.00220763192701029	TRUE	43
+geneComp_00000223	RPL22	RPL22	cancer	health	0.00414604315547501	TRUE	44
+geneComp_00000140	KLHL17	KLHL17	cancer	health	0.0043156399415831	NA	45
+geneComp_00000131	KCNAB2	KCNAB2	cancer	health	0.00450582195570915	TRUE	46
+geneComp_00000169	NBPF1	NBPF1	cancer	health	0.00603768129678154	NA	47
+geneComp_00000132	KIAA0090	KIAA0090	cancer	health	0.00637311306884828	NA	48
+geneComp_00000216	RCAN3	RCAN3	cancer	health	0.00655117020038015	TRUE	49
+geneComp_00000160	MST1	MST1	cancer	health	0.00970833700285509	TRUE	50
+geneComp_00000137	KIF17	KIF17	cancer	health	0.020741914385789	TRUE	51
+geneComp_00000229	SFRS13A	SFRS13A	cancer	health	0.035326111600384	TRUE	52
+geneComp_00000257	TNFRSF18	TNFRSF18	cancer	health	0.0453089266879188	TRUE	53
+geneComp_00000256	TNFRSF14	TNFRSF14	cancer	health	0.0490680824638558	TRUE	54
diff -r 000000000000 -r f3fefb6d8254 test-data/test08_single_gene.pdf
Binary file test-data/test08_single_gene.pdf has changed
diff -r 000000000000 -r f3fefb6d8254 test-data/transcriptome.fasta.gz
Binary file test-data/transcriptome.fasta.gz has changed