Mercurial > repos > iuc > khmer_normalize_by_median
comparison normalize-by-median.xml @ 10:4d23ab83ea29 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/khmer commit 238d0992c63de53623c4fc05eec8bd8d67001997
author | iuc |
---|---|
date | Thu, 03 Oct 2024 13:46:42 +0000 |
parents | b1fe2ef3d244 |
children |
comparison
equal
deleted
inserted
replaced
9:b1fe2ef3d244 | 10:4d23ab83ea29 |
---|---|
1 <tool id="khmer_normalize_by_median" name="khmer: Normalize By Median" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> | 1 <tool id="khmer_normalize_by_median" name="khmer: Normalize By Median" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@"> |
2 <description>Filter reads using digital normalization via k-mer abundances</description> | 2 <description>Filter reads using digital normalization via k-mer abundances</description> |
3 <expand macro="bio_tools"/> | |
4 <macros> | 3 <macros> |
5 <token name="@BINARY@">normalize-by-median.py</token> | 4 <token name="@BINARY@">normalize-by-median.py</token> |
6 <import>macros.xml</import> | 5 <import>macros.xml</import> |
7 </macros> | 6 </macros> |
7 <expand macro="bio_tools"/> | |
8 <expand macro="requirements" /> | 8 <expand macro="requirements" /> |
9 <expand macro="stdio" /> | 9 <expand macro="stdio" /> |
10 <expand macro="version" /> | 10 <expand macro="version" /> |
11 <command><![CDATA[ | 11 <command><![CDATA[ |
12 #import re | 12 #import re |
47 help="If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." /> | 47 help="If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." /> |
48 <param argument="--loadgraph" name="countgraph_to_load" type="data" format="oxlicg" optional="true" | 48 <param argument="--loadgraph" name="countgraph_to_load" type="data" format="oxlicg" optional="true" |
49 label="Optional k-mer countgraph" | 49 label="Optional k-mer countgraph" |
50 help="The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." /> | 50 help="The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." /> |
51 <param argument="--savegraph" name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="" /> | 51 <param argument="--savegraph" name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="" /> |
52 <param argument="--cutoff" name="cutoff" type="integer" min="1" value="20" label="Cutoff" help="" /> | 52 <param argument="--cutoff" type="integer" min="1" value="20" label="Cutoff" help="" /> |
53 <expand macro="tableinputs" /> | 53 <expand macro="tableinputs" /> |
54 </inputs> | 54 </inputs> |
55 <outputs> | 55 <outputs> |
56 <data name="countgraph" format="oxlicg" label="${tool.name} k-mer countgraph"> | 56 <data name="countgraph" format="oxlicg" label="${tool.name} on ${on_string}: k-mer countgraph"> |
57 <filter>save_countgraph == True</filter> | 57 <filter>save_countgraph == True</filter> |
58 </data> | 58 </data> |
59 <data name="report" format="txt" label="${tool.name} report" /> | 59 <data name="report" format="csv" label="${tool.name} on ${on_string}: report" /> |
60 <expand macro="output_sequences" extension="keep"/> | 60 <expand macro="output_sequences" extension="keep"/> |
61 </outputs> | 61 </outputs> |
62 <tests> | 62 <tests> |
63 <test> | 63 <test expect_num_outputs="2"> |
64 <param name="inputs" value="test-abund-read-2.fa" ftype="fasta"/> | 64 <param name="inputs" value="test-abund-read-2.fa" ftype="fasta"/> |
65 <param name="type" value="specific" /> | 65 <param name="type" value="specific" /> |
66 <param name="cutoff" value="1" /> | 66 <param name="cutoff" value="1" /> |
67 <param name="ksize" value="17" /> | 67 <param name="ksize" value="17" /> |
68 <output name="report" file="normalize-by-median.report.txt" /> | 68 <output name="report" file="normalize-by-median.report.txt" /> |
72 <has_text text="GGTTGACGGGGCTCAGGGGG" /> | 72 <has_text text="GGTTGACGGGGCTCAGGGGG" /> |
73 </assert_contents> | 73 </assert_contents> |
74 </element> | 74 </element> |
75 </output_collection> | 75 </output_collection> |
76 </test> | 76 </test> |
77 <test> | 77 <test expect_num_outputs="2"> |
78 <param name="inputs" value="test-abund-read-2.fa.gz" ftype="fasta.gz"/> | 78 <param name="inputs" value="test-abund-read-2.fa.gz" ftype="fasta.gz"/> |
79 <param name="type" value="specific" /> | 79 <param name="type" value="specific" /> |
80 <param name="cutoff" value="2" /> | 80 <param name="cutoff" value="2" /> |
81 <param name="ksize" value="17" /> | 81 <param name="ksize" value="17" /> |
82 <output name="report" file="normalize-by-median.c2.report.txt" /> | 82 <output name="report" file="normalize-by-median.c2.report.txt" /> |
87 <has_text text="GGTTGACGGGGCTCAGGG" /> | 87 <has_text text="GGTTGACGGGGCTCAGGG" /> |
88 </assert_contents> | 88 </assert_contents> |
89 </element> | 89 </element> |
90 </output_collection> | 90 </output_collection> |
91 </test> | 91 </test> |
92 <test> | 92 <test expect_num_outputs="3"> |
93 <param name="inputs" value="test-abund-read-paired.fa" ftype="fasta"/> | 93 <param name="inputs" value="test-abund-read-paired.fa" ftype="fasta"/> |
94 <param name="type" value="specific" /> | 94 <param name="type" value="specific" /> |
95 <param name="cutoff" value="1" /> | 95 <param name="cutoff" value="1" /> |
96 <param name="ksize" value="17" /> | 96 <param name="ksize" value="17" /> |
97 <param name="paired" value="true" /> | 97 <param name="paired" value="true" /> |
98 <param name="save_countgraph" value="true"/> | |
98 <output name="report" file="normalize-by-median.paired.report.txt" /> | 99 <output name="report" file="normalize-by-median.paired.report.txt" /> |
99 <output_collection name="sequences" type="list"> | 100 <output_collection name="sequences" type="list"> |
100 <element name="test-abund-read-paired.fa" ftype="fasta"> | 101 <element name="test-abund-read-paired.fa" ftype="fasta"> |
101 <assert_contents> | 102 <assert_contents> |
102 <has_text text="GGTTGACGGGGCTCAGGGGG" /> | 103 <has_text text="GGTTGACGGGGCTCAGGGGG" /> |
103 <has_text text="GGTTGACGGGGCTCAGGG" /> | 104 <has_text text="GGTTGACGGGGCTCAGGG" /> |
104 </assert_contents> | 105 </assert_contents> |
105 </element> | 106 </element> |
106 </output_collection> | 107 </output_collection> |
108 <output name="countgraph"> | |
109 <assert_contents> | |
110 <has_size size="1k"/> | |
111 </assert_contents> | |
112 </output> | |
107 </test> | 113 </test> |
108 </tests> | 114 </tests> |
109 <help><![CDATA[ | 115 <help><![CDATA[ |
110 Do digital normalization (remove mostly redundant sequences) | 116 Do digital normalization (remove mostly redundant sequences) |
111 | 117 |