Mercurial > repos > iuc > khmer_normalize_by_median
diff normalize-by-median.xml @ 7:557cc16931f4 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/khmer commit 7de685f4763d988a5a9abce4a9c2b4714daaf165"
author | iuc |
---|---|
date | Wed, 18 Dec 2019 16:01:09 -0500 |
parents | 73314e26dcfd |
children | e84073b420a8 |
line wrap: on
line diff
--- a/normalize-by-median.xml Fri Sep 07 11:01:41 2018 -0400 +++ b/normalize-by-median.xml Wed Dec 18 16:01:09 2019 -0500 @@ -1,4 +1,4 @@ -<tool id="khmer_normalize_by_median" name="Normalize By Median" version="@WRAPPER_VERSION@.0"> +<tool id="khmer_normalize_by_median" name="khmer: Normalize By Median" version="@WRAPPER_VERSION@@TOOL_VERSION@"> <description>Filter reads using digital normalization via k-mer abundances</description> <macros> <token name="@BINARY@">normalize-by-median.py</token> @@ -8,12 +8,12 @@ <expand macro="stdio" /> <expand macro="version" /> <command><![CDATA[ -set -xu && -#for $num, $input in enumerate($inputs) - ln -s ${input} sequence-${num} && -#end for +#import re +set -u && mkdir output && -cd output && + +@LINK_SEQUENCES@ +cd output/ && normalize-by-median.py ${paired_switch} ${force_single_switch} @@ -29,25 +29,26 @@ --loadgraph=${countgraph_to_load} #end if --report=${report} -../sequence-* +$gzip +@USE_SEQUENCES@ ]]> </command> <inputs> <expand macro="input_sequences_filenames" /> - <param name="paired_switch" type="boolean" checked="false" truevalue="--paired" falsevalue="" + <param argument="--paired" name="paired_switch" type="boolean" checked="false" truevalue="--paired" falsevalue="" label="Require all sequences be properly paired?" - help="(--paired) The tool will fail if given improperly paired reads and this option is selected." /> - <param name="force_single_switch" type="boolean" checked="false" truevalue="--force_single" falsevalue="" + help="The tool will fail if given improperly paired reads and this option is selected." /> + <param argument="--force_single" name="force_single_switch" type="boolean" checked="false" truevalue="--force_single" falsevalue="" label="Ignore all pairing information?" - help="(--paired) By default this tool process reads in a pair-aware manner. This option disables that behavior." /> - <param name="unpaired_reads_filename" type="data" format="fasta,fastq,fastqsanger,fastqsolexa,fastqillumina" optional="true" + help="By default this tool process reads in a pair-aware manner. This option disables that behavior." /> + <param argument="--unpaired-reads" name="unpaired_reads_filename" type="data" format="fasta,fastq,fastqsanger,fastqsolexa,fastqillumina" optional="true" label="Extra unpaired reads" - help="(--unpaired-reads) If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." /> - <param name="countgraph_to_load" type="data" format="oxlicg" optional="true" + help="If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." /> + <param argument="--loadgraph" name="countgraph_to_load" type="data" format="oxlicg" optional="true" label="Optional k-mer countgraph" - help="(--loadgraph) The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." /> - <param name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="(--savegraph)" /> - <param name="cutoff" type="integer" min="1" value="20" label="Cutoff" help="(--cutoff)" /> + help="The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." /> + <param argument="--savegraph" name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="" /> + <param argument="--cutoff" name="cutoff" type="integer" min="1" value="20" label="Cutoff" help="" /> <expand macro="tableinputs" /> </inputs> <outputs> @@ -55,19 +56,17 @@ <filter>save_countgraph == True</filter> </data> <data name="report" format="txt" label="${tool.name} report" /> - <collection name="sequences" type="list"> - <discover_datasets pattern="__name__" directory="output" /> - </collection> + <expand macro="output_sequences" extension="keep"/> </outputs> <tests> <test> - <param name="inputs" value="test-abund-read-2.fa"/> + <param name="inputs" value="test-abund-read-2.fa" ftype="fasta"/> <param name="type" value="specific" /> <param name="cutoff" value="1" /> <param name="ksize" value="17" /> <output name="report" file="normalize-by-median.report.txt" /> <output_collection name="sequences" type="list"> - <element name="sequence-0.keep"> + <element name="test-abund-read-2.fa" ftype="fasta"> <assert_contents> <has_text text="GGTTGACGGGGCTCAGGGGG" /> </assert_contents> @@ -75,13 +74,13 @@ </output_collection> </test> <test> - <param name="inputs" value="test-abund-read-2.fa" /> + <param name="inputs" value="test-abund-read-2.fa.gz" ftype="fasta.gz"/> <param name="type" value="specific" /> <param name="cutoff" value="2" /> <param name="ksize" value="17" /> <output name="report" file="normalize-by-median.c2.report.txt" /> <output_collection name="sequences" type="list"> - <element name="sequence-0.keep"> + <element name="test-abund-read-2.fa.gz" ftype="fasta.gz"> <assert_contents> <has_text text="GGTTGACGGGGCTCAGGGGG" /> <has_text text="GGTTGACGGGGCTCAGGG" /> @@ -90,14 +89,14 @@ </output_collection> </test> <test> - <param name="inputs" value="test-abund-read-paired.fa" /> + <param name="inputs" value="test-abund-read-paired.fa" ftype="fasta"/> <param name="type" value="specific" /> <param name="cutoff" value="1" /> <param name="ksize" value="17" /> <param name="paired" value="true" /> <output name="report" file="normalize-by-median.paired.report.txt" /> <output_collection name="sequences" type="list"> - <element name="sequence-0.keep"> + <element name="test-abund-read-paired.fa" ftype="fasta"> <assert_contents> <has_text text="GGTTGACGGGGCTCAGGGGG" /> <has_text text="GGTTGACGGGGCTCAGGG" />