diff normalize-by-median.xml @ 7:557cc16931f4 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/khmer commit 7de685f4763d988a5a9abce4a9c2b4714daaf165"
author iuc
date Wed, 18 Dec 2019 16:01:09 -0500
parents 73314e26dcfd
children e84073b420a8
line wrap: on
line diff
--- a/normalize-by-median.xml	Fri Sep 07 11:01:41 2018 -0400
+++ b/normalize-by-median.xml	Wed Dec 18 16:01:09 2019 -0500
@@ -1,4 +1,4 @@
-<tool id="khmer_normalize_by_median" name="Normalize By Median" version="@WRAPPER_VERSION@.0">
+<tool id="khmer_normalize_by_median" name="khmer: Normalize By Median" version="@WRAPPER_VERSION@@TOOL_VERSION@">
     <description>Filter reads using digital normalization via k-mer abundances</description>
     <macros>
         <token name="@BINARY@">normalize-by-median.py</token>
@@ -8,12 +8,12 @@
     <expand macro="stdio" />
     <expand macro="version" />
     <command><![CDATA[
-set -xu &&
-#for $num, $input in enumerate($inputs)
-    ln -s ${input} sequence-${num} &&
-#end for
+#import re
+set -u &&
 mkdir output &&
-cd output &&
+
+@LINK_SEQUENCES@
+cd output/ &&
 normalize-by-median.py
 ${paired_switch}
 ${force_single_switch}
@@ -29,25 +29,26 @@
     --loadgraph=${countgraph_to_load}
 #end if
 --report=${report}
-../sequence-*
+$gzip
+@USE_SEQUENCES@
 ]]>
     </command>
     <inputs>
         <expand macro="input_sequences_filenames" />
-        <param name="paired_switch" type="boolean" checked="false" truevalue="--paired" falsevalue=""
+        <param argument="--paired" name="paired_switch" type="boolean" checked="false" truevalue="--paired" falsevalue=""
             label="Require all sequences be properly paired?"
-            help="(--paired) The tool will fail if given improperly paired reads and this option is selected." />
-        <param name="force_single_switch" type="boolean" checked="false" truevalue="--force_single" falsevalue=""
+            help="The tool will fail if given improperly paired reads and this option is selected." />
+        <param argument="--force_single" name="force_single_switch" type="boolean" checked="false" truevalue="--force_single" falsevalue=""
             label="Ignore all pairing information?"
-            help="(--paired) By default this tool process reads in a pair-aware manner. This option disables that behavior." />
-        <param name="unpaired_reads_filename" type="data" format="fasta,fastq,fastqsanger,fastqsolexa,fastqillumina" optional="true"
+            help="By default this tool process reads in a pair-aware manner. This option disables that behavior." />
+        <param argument="--unpaired-reads" name="unpaired_reads_filename" type="data" format="fasta,fastq,fastqsanger,fastqsolexa,fastqillumina" optional="true"
             label="Extra unpaired reads"
-            help="(--unpaired-reads) If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." />
-        <param name="countgraph_to_load" type="data" format="oxlicg" optional="true"
+            help="If all but one of your sequence files are interleaved paired end reads you can include one unpaired file to be processed last without regard to pairing." />
+        <param argument="--loadgraph" name="countgraph_to_load" type="data" format="oxlicg" optional="true"
             label="Optional k-mer countgraph"
-            help="(--loadgraph) The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." />
-        <param name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="(--savegraph)" />
-        <param name="cutoff" type="integer" min="1" value="20" label="Cutoff" help="(--cutoff)" />
+            help="The inputs file(s) will be processed using the kmer counts in the specified k-mer countgraph file as a starting point." />
+        <param argument="--savegraph" name="save_countgraph" type="boolean" label="Save the k-mer countgraph(s) in a file" help="" />
+        <param argument="--cutoff" name="cutoff" type="integer" min="1" value="20" label="Cutoff" help="" />
         <expand macro="tableinputs" />
     </inputs>
     <outputs>
@@ -55,19 +56,17 @@
             <filter>save_countgraph == True</filter>
         </data>
         <data name="report" format="txt" label="${tool.name} report" />
-        <collection name="sequences" type="list">
-            <discover_datasets pattern="__name__" directory="output" />
-        </collection>
+        <expand macro="output_sequences" extension="keep"/>
     </outputs>
     <tests>
         <test>
-            <param name="inputs" value="test-abund-read-2.fa"/>
+            <param name="inputs" value="test-abund-read-2.fa" ftype="fasta"/>
             <param name="type" value="specific" />
             <param name="cutoff" value="1" />
             <param name="ksize" value="17" />
             <output name="report" file="normalize-by-median.report.txt" />
             <output_collection name="sequences" type="list">
-                <element name="sequence-0.keep">
+                <element name="test-abund-read-2.fa" ftype="fasta">
                     <assert_contents>
                         <has_text text="GGTTGACGGGGCTCAGGGGG" />
                     </assert_contents>
@@ -75,13 +74,13 @@
             </output_collection>
         </test>
         <test>
-            <param name="inputs" value="test-abund-read-2.fa" />
+            <param name="inputs" value="test-abund-read-2.fa.gz"  ftype="fasta.gz"/>
             <param name="type" value="specific" />
             <param name="cutoff" value="2" />
             <param name="ksize" value="17" />
             <output name="report" file="normalize-by-median.c2.report.txt" />
             <output_collection name="sequences" type="list">
-                <element name="sequence-0.keep">
+                <element name="test-abund-read-2.fa.gz" ftype="fasta.gz">
                     <assert_contents>
                         <has_text text="GGTTGACGGGGCTCAGGGGG" />
                         <has_text text="GGTTGACGGGGCTCAGGG" />
@@ -90,14 +89,14 @@
             </output_collection>
         </test>
         <test>
-            <param name="inputs" value="test-abund-read-paired.fa" />
+            <param name="inputs" value="test-abund-read-paired.fa" ftype="fasta"/>
             <param name="type" value="specific" />
             <param name="cutoff" value="1" />
             <param name="ksize" value="17" />
             <param name="paired" value="true" />
             <output name="report" file="normalize-by-median.paired.report.txt" />
             <output_collection name="sequences" type="list">
-                <element name="sequence-0.keep">
+                <element name="test-abund-read-paired.fa" ftype="fasta">
                     <assert_contents>
                         <has_text text="GGTTGACGGGGCTCAGGGGG" />
                         <has_text text="GGTTGACGGGGCTCAGGG" />