# HG changeset patch
# User iuc
# Date 1581890625 18000
# Node ID 7f7d8b0c85171f16dcc5faac22b11708ccb39e1a
# Parent  402b67d1af7df7efd9ec30a7b25ca4126f2e4454
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mash commit 24f4271bd62a3d96fec812eae2ad607f6a7f723c"

diff -r 402b67d1af7d -r 7f7d8b0c8517 macros.xml
--- a/macros.xml	Wed Jan 23 15:59:25 2019 -0500
+++ b/macros.xml	Sun Feb 16 17:03:45 2020 -0500
@@ -3,4 +3,21 @@
     <token name="@INTYPES@">
         fasta,fasta.gz,fastq,fastq.gz,fastqsanger,fastqsanger.gz
     </token>
+    
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1186/s13059-016-0997-x</citation>
+        </citations>
+    </xml>
+
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@TOOL_VERSION@">mash</requirement>
+        </requirements>
+    </xml>
+
+    <xml name="version_command">
+        <version_command>mash --version</version_command>
+    </xml>
+
 </macros>
diff -r 402b67d1af7d -r 7f7d8b0c8517 mash_screen.xml
--- a/mash_screen.xml	Wed Jan 23 15:59:25 2019 -0500
+++ b/mash_screen.xml	Sun Feb 16 17:03:45 2020 -0500
@@ -1,12 +1,10 @@
-<tool id="mash_screen" name="mash screen" version="@TOOL_VERSION@+galaxy1" profile="19.01">
-    <description>determines how well query sequences are contained within a pool of sequences.</description>
+<tool id="mash_screen" name="mash screen" version="@TOOL_VERSION@+galaxy2" profile="19.01">
+    <description>determines how well query sequences are contained within a pool of sequences</description>
     <macros>
         <import>macros.xml</import>
     </macros>
-    <requirements>
-        <requirement type="package" version="@TOOL_VERSION@">mash</requirement>
-    </requirements>
-    <version_command>mash --version</version_command>
+    <expand macro="requirements" />
+    <expand macro="version_command" />
     <command detect_errors="exit_code"><![CDATA[
         ln -s '$queries' queries.msh &&
         mash screen
@@ -44,9 +42,10 @@
             </when>
         </conditional>
         <param name="queries" type="data" format="msh" />
-        <param type="boolean" name="winner_takes_all" argument="-w" truevalue="-w" falsevalue=""/>
-        <param type="float" name="minimum_identity_to_report" argument="-i" value="0." min="-1." max="1." />
-        <param type="float" name="maximum_p_value_to_report" argument="-v" value="1." min="0." max="1."/>
+        <param name="winner_takes_all" argument="-w" type="boolean" checked="true" truevalue="-w" falsevalue="" label="'Winner takes all' to remove redundancy in the result"
+            help="If this option is not enabled, every matching strain from the same species of the reference database is reported in the result."/>
+        <param type="float" name="minimum_identity_to_report" argument="-i" value="0." min="-1." max="1." label="Minimum identity to report" />
+        <param type="float" name="maximum_p_value_to_report" argument="-v" value="1." min="0." max="1." label="Maximum p-value to report" />
     </inputs>
     <outputs>
         <data name="output" format="tabular" />
@@ -73,7 +72,8 @@
         </test>
     </tests>
     <help><![CDATA[
-Description:
+
+**What it does**
 
   Determine how well query sequences are contained within a pool of sequences.
   The queries must be formatted as a single Mash sketch file (.msh), created
@@ -85,18 +85,5 @@
   query-comment], where median-multiplicity is computed for shared hashes, based
   on the number of observations of those hashes within the pool.
   ]]></help>
-    <citations>
-        <citation type="bibtex">
-@article{ondov2016mash,
-  title={Mash: fast genome and metagenome distance estimation using MinHash},
-  author={Ondov, Brian D and Treangen, Todd J and Melsted, P{\'a}ll and Mallonee, Adam B and Bergman, Nicholas H and Koren, Sergey and Phillippy, Adam M},
-  journal={Genome biology},
-  volume={17},
-  number={1},
-  pages={132},
-  year={2016},
-  publisher={BioMed Central}
-  }
-        </citation>
-    </citations>
+    <expand macro="citations"/>
 </tool>
diff -r 402b67d1af7d -r 7f7d8b0c8517 test-data/ERR024951_seqtk_sample_1000_1.sketch.msh
Binary file test-data/ERR024951_seqtk_sample_1000_1.sketch.msh has changed
diff -r 402b67d1af7d -r 7f7d8b0c8517 test-data/test_assembly.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_assembly.fasta	Sun Feb 16 17:03:45 2020 -0500
@@ -0,0 +1,3 @@
+>test
+GCATGTCGATCTGTGTGCTAGTCGTAGTCGATCGATCTGATCGATCTGTCAGTCAGTAGT
+CTCAGCGATGCATTATTATATTATATTATCGATCGATGCTGATCGATTATATTCGATCTG
diff -r 402b67d1af7d -r 7f7d8b0c8517 test-data/test_assembly.sketch.msh
Binary file test-data/test_assembly.sketch.msh has changed