changeset 0:ed22349139ee draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/megahit_contig2fastg commit 9953444ccbe61c186bdfcb341dc000d2545e73f1
author iuc
date Fri, 16 Nov 2018 17:43:22 -0500
parents
children b910d0cbc00b
files megahit_contig2fastg.xml test-data/k21.contigs.fa
diffstat 2 files changed, 89 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/megahit_contig2fastg.xml	Fri Nov 16 17:43:22 2018 -0500
@@ -0,0 +1,87 @@
+<tool id="megahit_contig2fastg" name="megahit contig2fastg" version="@VERSION@+@GALAXY_VERSION@">
+    <description>for converting MEGAHIT's contigs (.fa) to assembly graphs (.fastg)</description>
+    <macros>
+        <token name="@GALAXY_VERSION@">galaxy1</token>
+        <token name="@VERSION@">1.1.3</token>
+    </macros>
+    <requirements>
+        <requirement type="package" version="@VERSION@">megahit</requirement>
+    </requirements>
+    <version_command>megahit --version</version_command>
+    <command detect_errors="exit_code"><![CDATA[
+        megahit_toolkit contig2fastg
+        '${kmer}'
+        '${contigs}' > '${fastg}'
+    ]]></command>
+    <inputs>
+        <param name="contigs" type="data" format="fasta" label="Contig file" help="Ex: k99.contigs.fa" />
+        <param name="kmer" type="integer" value="99" label="K-mer length" help="Usually indicated within the filename (when derived from MEGAHIT)"/>
+    </inputs>
+    <outputs>
+        <data format="txt" name="fastg" label="Assembly graph via ${tool.name} on ${on_string}" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="contigs" value="k21.contigs.fa" ftype="fasta" />
+            <param name="kmer" value="21"/>
+            <output name="fastg">
+                <assert_contents>
+                    <has_text text=">NODE_1_length_576" />
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help><![CDATA[
+
+**MEGAHIT toolkit's contig2fastg**
+
+Contig2fastg is a subprogram within the MEGAHIT toolkit. It converts MEGAHIT's contigs (.fa) to assembly graphs (.fastg) that can be utilized for protein/peptide identification via graph2pro and can also be visualized via Bandage.
+
+-----
+
+**EXAMPLE**
+
+*Command:*
+
+megahit_toolkit contig2fastg 99 intermediate_contigs/k99.contigs.fa > k99.contigs.fastg
+
+
+
+*k99.contigs.fa*
+
+>k21_1 flag=3 multi=1.0486 len=576
+
+CGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTC...
+
+
+
+*k99.contigs.fastg*
+
+>NODE_1_length_576_cov_1.0486_ID_1:NODE_1_length_576_cov_1.0486_ID_1;
+
+CGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTC...
+
+-----
+
+**MEGAHIT**
+
+MEGAHIT is a single node assembler for large and complex metagenomics NGS reads, such as soil. It makes use of succinct de Bruijn graph (SdBG) to achieve low memory assembly. MEGAHIT can optionally utilize a CUDA-enabled GPU to accelerate its SdBG contstruction. The GPU-accelerated version of MEGAHIT has been tested on NVIDIA GTX680 (4G memory) and Tesla K40c (12G memory) with CUDA 5.5, 6.0 and 6.5.
+
+--------
+
+**Project links:**
+
+MEGAHIT: https://github.com/voutcn/megahit
+
+MEGAHIT Toolkit: https://github.com/voutcn/megahit/blob/master/tools/toolkit.cpp
+
+Graph2Pro-Var: https://github.com/COL-IU/graph2pro-var
+
+Bandage: http://rrwick.github.io/Bandage/
+
+
+    ]]></help>
+    <citations>
+        <citation type="doi">10.1093/bioinformatics/btv033</citation>
+    </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/k21.contigs.fa	Fri Nov 16 17:43:22 2018 -0500
@@ -0,0 +1,2 @@
+>k21_1 flag=3 multi=1.0486 len=576
+CGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCTGAGTCCACCCGCCGTATTGCGGCAAGCCGCATTCCGGCTGATCACATGGTGCTGATGGCAGGTTTCACCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCGCAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATTAGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAAATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATCGATCCGGTCGAAAAACTGCTGGCAG