Mercurial > repos > iuc > meme_fimo

changeset 5:eca84de658b0 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded
author iuc
date Fri, 17 Jun 2016 13:15:48 -0400
parents cd54079f0f72
children cdcc4bb60bc3
files fimo.xml fimo_wrapper.py test-data/fimo_output_html_1.html test-data/fimo_output_html_2.html test-data/fimo_output_xml_1.xml test-data/fimo_output_xml_2.xml test-data/meme_input_1.fasta test-data/meme_output_html_1.html test-data/meme_output_html_2.html test-data/meme_output_txt_1.txt test-data/meme_output_txt_2.txt test-data/motif1.gff test-data/prior30.plib tool_dependencies.xml
diffstat 14 files changed, 230 insertions(+), 393 deletions(-) [+]
line wrap: on
line diff
--- a/fimo.xml	Tue Mar 08 08:10:52 2016 -0500
+++ b/fimo.xml	Fri Jun 17 13:15:48 2016 -0400
@@ -1,4 +1,4 @@
-<tool id="meme_fimo" name="FIMO" version="4.11.0.2">
+<tool id="meme_fimo" name="FIMO" version="4.11.0.3">
     <description>- Scan a set of sequences for motifs.</description>
     <requirements>
         <requirement type="package" version="6.9.3">imagemagick</requirement>
@@ -6,6 +6,7 @@
     </requirements>
     <command>
         <![CDATA[
+            mkdir -p output &&
             python $__tool_directory__/fimo_wrapper.py
             --input_motifs "${input_motifs}"
             #if str($fasta_type.fasta_type_selector) == 'history':
@@ -28,10 +29,14 @@
                         --motif "${motif.motif}"
                     #end for
                 #end if
+                --output_separate_motifs ${options_type.output_separate_motifs}
                 --motif_pseudo "${options_type.motif_pseudo}"
                 ${options_type.no_qvalue}
                 ${options_type.norc}
-                ${options_type.parse_genomic_coord}
+                #if str($options_type.parse_genomic_coord_cond.parse_genomic_coord) == 'yes':
+                    --parse_genomic_coord 'yes'
+                    --remove_duplicate_coords ${options_type.parse_genomic_coord_cond.remove_duplicate_coords}
+                #end if
                 #if str($options_type.psp_cond.psp_selector) == 'yes':
                     --input_psp "${input_psp}"
                 #end if
@@ -99,10 +104,23 @@
                         </repeat>
                     </when>
                 </conditional>
+                <param name="output_separate_motifs" type="select" label="Output a dataset per motif?" help="Output a collection consisting of a separate dataset for each motif in the input">
+                    <option value="no" selected="true">No</option>
+                    <option value="yes">Yes</option>
+                </param>
                 <param name="motif_pseudo" type="float" value="0.1" label="Pseudocount to add to counts in motif matrix" help="A pseudocount to be added to each count in the motif matrix, after first multiplying by the corresponding background frequency"/>
                 <param name="no_qvalue" label="Do not compute a q-value for each p-value" type="boolean" truevalue="--no_qvalue" falsevalue="" checked="True" help="The q-value calculation is that of Benjamini and Hochberg (1995)."/>
                 <param name="norc" label="Do not score the reverse complement DNA strand" type="boolean" truevalue="--norc" falsevalue="" checked="False" />
-                <param name="parse_genomic_coord" label="Check each sequence header for UCSC style genomic coordinates" type="boolean" truevalue="--parse_genomic_coord" falsevalue="" checked="False" />
+                <conditional name="parse_genomic_coord_cond">
+                    <param name="parse_genomic_coord" label="Check each sequence header for UCSC style genomic coordinates" type="select">
+                        <option value="no" selected="true">No</option>
+                        <option value="yes">Yes</option>
+                    </param>
+                    <when value="yes">
+                        <param name="remove_duplicate_coords" type="boolean" truevalue="yes" falsevalue="no" label="Remove duplicate entries in unique GFF coordinates?" help="Remove duplicate entries as defined by the unique GFF coordinates" />
+                    </when>
+                    <when value="no"/>
+                </conditional>
                 <conditional name="psp_cond">
                     <param name="psp_selector" type="select" label="Use position-specific priors?">
                         <option value="no" selected="true">No</option>
@@ -160,6 +178,7 @@
             </actions>
         </data>
         <data format="tabular" name="gff_outfile" label="${tool.name} on ${on_string} (almost-gff)">
+            <filter>options_type['output_separate_motifs'] == 'no'</filter>
             <actions>
                 <conditional name="fasta_type.fasta_type_selector">
                     <when value="cached">
@@ -172,6 +191,10 @@
                 </conditional>
             </actions>
         </data>
+        <collection name="motifs" type="list" label="Motifs: ${tool.name} on ${on_string}">
+            <discover_datasets pattern="(?P&lt;designation&gt;.*)" directory="output" ext="gff" visible="false" />
+            <filter>options_type['output_separate_motifs'] == 'yes'</filter>
+        </collection>
         <data format="cisml" name="xml_outfile" label="${tool.name} on ${on_string} (xml)">
             <actions>
                 <conditional name="fasta_type.fasta_type_selector">
@@ -209,7 +232,7 @@
             <output name="html_outfile" file="fimo_output_html_1.html" compare="contains"/>
             <output name="txt_outfile" file="fimo_output_txt_1.txt" compare="contains"/>
             <output name="gff_outfile" file="fimo_output_almost-gff_1.txt" compare="contains"/>
-            <output name="xml_outfile" file="fimo_output_xml_1.xml" lines_diff="8"/>
+            <output name="xml_outfile" file="fimo_output_xml_1.xml" compare="contains"/>
             <output name="interval_outfile" file="fimo_output_interval_1.txt" compare="contains"/>
         </test>
         <test>
@@ -221,7 +244,24 @@
             <output name="html_outfile" file="fimo_output_html_2.html" compare="contains"/>
             <output name="txt_outfile" file="fimo_output_txt_2.txt" compare="contains"/>
             <output name="gff_outfile" file="fimo_output_almost-gff_2.txt" compare="contains"/>
-            <output name="xml_outfile" file="fimo_output_xml_2.xml" lines_diff="8"/>
+            <output name="xml_outfile" file="fimo_output_xml_2.xml" compare="contains"/>
+            <output name="interval_outfile" file="fimo_output_interval_2.txt" compare="contains"/>
+        </test>
+        <test>
+            <param name="input_motifs" value="meme_output_xml_1.xml" ftype="memexml"/>
+            <param name="fasta_type_selector" value="history"/>
+            <param name="input_database" value="phiX.fasta" ftype="fasta"/>
+            <param name="options_type_selector" value="advanced"/>
+            <param name="parse_genomic_coord" value="--parse_genomic_coord"/>
+            <param name="remove_duplicate_coords" value="yes"/>
+            <param name="output_separate_motifs" value="yes"/>
+            <param name="non_commercial_use" value="True"/>
+            <output name="html_outfile" file="fimo_output_html_2.html" compare="contains"/>
+            <output name="txt_outfile" file="fimo_output_txt_2.txt" compare="contains"/>
+            <output_collection name="motifs" type="list">
+                <element name="MOTIF1.gff" file="motif1.gff" ftype="gff" compare="contains"/>
+            </output_collection>
+            <output name="xml_outfile" file="fimo_output_xml_2.xml" compare="contains"/>
             <output name="interval_outfile" file="fimo_output_interval_2.txt" compare="contains"/>
         </test>
     </tests>
@@ -235,7 +275,7 @@
 FIMO scans a sequence database for individual matches to each of the motifs you provide (sample output for motifs and sequences).
 The name FIMO stands for 'Find Individual Motif Occurrences'.  The program searches a database of sequences for occurrences of
 known motifs, treating each motif independently.  Motifs must be in MEME Motif Format.  You can define the statistical threshold
-(p-value) for motifs and whether FIMO scans just the given sequences or their reverse complements (where applicable), too.
+(p-value) for motifs and whether FIMO scans just the given sequences or their reverse complements (where applicable).
 
 .. class:: infomark
 
--- a/fimo_wrapper.py	Tue Mar 08 08:10:52 2016 -0500
+++ b/fimo_wrapper.py	Fri Jun 17 13:15:48 2016 -0400
@@ -12,6 +12,19 @@
 DNA_COMPLEMENT = string.maketrans("ACGTRYKMBDHVacgtrykmbdhv", "TGCAYRMKVHDBtgcayrmkvhdb")
 
 
+def get_stderr(tmp_stderr):
+    tmp_stderr.seek(0)
+    stderr = ''
+    try:
+        while True:
+            stderr += tmp_stderr.read(BUFFSIZE)
+            if not stderr or len(stderr) % BUFFSIZE != 0:
+                break
+    except OverflowError:
+        pass
+    return stderr
+
+
 def reverse(sequence):
     # Reverse sequence string.
     return sequence[::-1]
@@ -43,11 +56,13 @@
 parser.add_argument('--max_strand', action='store_true', help='If matches on both strands at a given position satisfy the output threshold, only report the match for the strand with the higher score')
 parser.add_argument('--max_stored_scores', dest='max_stored_scores', type=int, help='Maximum score count to store')
 parser.add_argument('--motif', dest='motifs', action='append', default=[], help='Specify motif by id')
+parser.add_argument('--output_separate_motifs', default="no", help='Output one dataset per motif')
 parser.add_argument('--motif_pseudo', dest='motif_pseudo', type=float, default=0.1, help='Pseudocount to add to counts in motif matrix')
 parser.add_argument('--no_qvalue', action='store_true', help='Do not compute a q-value for each p-value')
 parser.add_argument('--norc', action='store_true', help='Do not score the reverse complement DNA strand')
 parser.add_argument('--output_path', dest='output_path', help='Output files directory')
-parser.add_argument('--parse_genomic_coord', action='store_true', help='Check each sequence header for UCSC style genomic coordinates')
+parser.add_argument('--parse_genomic_coord', default='no', help='Check each sequence header for UCSC style genomic coordinates')
+parser.add_argument('--remove_duplicate_coords', default='no', help='Remove duplicate entries in unique GFF coordinates')
 parser.add_argument('--qv_thresh', action='store_true', help='Use q-values for the output threshold')
 parser.add_argument('--thresh', dest='thresh', type=float, help='p-value threshold')
 parser.add_argument('--gff_output', dest='gff_output', help='Gff output file')
@@ -73,7 +88,7 @@
         fimo_cmd_list.append('--no-qvalue')
     if args.norc:
         fimo_cmd_list.append('--norc')
-    if args.parse_genomic_coord:
+    if args.parse_genomic_coord == 'yes':
         fimo_cmd_list.append('--parse-genomic-coord')
     if args.qv_thresh:
         fimo_cmd_list.append('--qv-thresh')
@@ -93,22 +108,66 @@
     tmp_stderr = tempfile.NamedTemporaryFile()
     proc = subprocess.Popen(args=fimo_cmd, shell=True, stderr=tmp_stderr)
     returncode = proc.wait()
-    tmp_stderr.seek(0)
-    stderr = ''
-    try:
-        while True:
-            stderr += tmp_stderr.read(BUFFSIZE)
-            if not stderr or len(stderr) % BUFFSIZE != 0:
-                break
-    except OverflowError:
-        pass
     if returncode != 0:
+        stderr = get_stderr(tmp_stderr)
         stop_err(stderr)
 except Exception, e:
     stop_err('Error running FIMO:\n%s' % str(e))
 
 shutil.move(os.path.join(args.output_path, 'fimo.txt'), args.txt_output)
-shutil.move(os.path.join(args.output_path, 'fimo.gff'), args.gff_output)
+
+gff_file = os.path.join(args.output_path, 'fimo.gff')
+if args.remove_duplicate_coords == 'yes':
+    tmp_stderr = tempfile.NamedTemporaryFile()
+    # Identify and eliminating identical motif occurrences.  These
+    # are identical if the combination of chrom, start, end and
+    # motif id are identical.
+    cmd = 'sort -k1,1 -k4,4n -k5,5n -k9.1,9.6 -u -o %s %s' % (gff_file, gff_file)
+    proc = subprocess.Popen(args=cmd, stderr=tmp_stderr, shell=True)
+    returncode = proc.wait()
+    if returncode != 0:
+        stderr = get_stderr(tmp_stderr)
+        stop_err(stderr)
+    # Sort GFF output by a combination of chrom, score, start.
+    cmd = 'sort -k1,1 -k4,4n -k6,6n -o %s %s' % (gff_file, gff_file)
+    proc = subprocess.Popen(args=cmd, stderr=tmp_stderr, shell=True)
+    returncode = proc.wait()
+    if returncode != 0:
+        stderr = get_stderr(tmp_stderr)
+        stop_err(stderr)
+if args.output_separate_motifs == 'yes':
+    # Create the collection output directory.
+    collection_path = (os.path.join(os.getcwd(), 'output'))
+    # Keep track of motif occurrences.
+    header_line = None
+    motif_ids = []
+    file_handles = []
+    for line in open(gff_file, 'r'):
+        if line.startswith('#'):
+            if header_line is None:
+                header_line = line
+            continue
+        items = line.split('\t')
+        attribute = items[8]
+        attributes = attribute.split(';')
+        name = attributes[0]
+        motif_id = name.split('=')[1]
+        file_name = os.path.join(collection_path, 'MOTIF%s.gff' % motif_id)
+        if motif_id in motif_ids:
+            i = motif_ids.index(motif_id)
+            fh = file_handles[i]
+            fh.write(line)
+        else:
+            fh = open(file_name, 'wb')
+            if header_line is not None:
+                fh.write(header_line)
+            fh.write(line)
+            motif_ids.append(motif_id)
+            file_handles.append(fh)
+    for file_handle in file_handles:
+        file_handle.close()
+else:
+    shutil.move(gff_file, args.gff_output)
 shutil.move(os.path.join(args.output_path, 'fimo.xml'), args.xml_output)
 shutil.move(os.path.join(args.output_path, 'fimo.html'), args.html_output)
 
--- a/test-data/fimo_output_html_1.html	Tue Mar 08 08:10:52 2016 -0500
+++ b/test-data/fimo_output_html_1.html	Fri Jun 17 13:15:48 2016 -0400
@@ -41,12 +41,10 @@
 <hr>
 <div style="padding-left: 0.75in; line-height: 1em; font-family: monospace;">
 <p>
-  DATABASE /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat
   <br />
   Database contains 1 sequences, 5386 residues
 </p>
 <p>
-  MOTIFS /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat (Protein)
   <table>
     <thead>
       <tr>
@@ -98,3 +96,5 @@
 probability of a random sequence of the same length as the motif
 matching that position of the sequence with as good or better a score.
 </li>
+<li>
+The score for the match of a position in a sequence to a motif
--- a/test-data/fimo_output_html_2.html	Tue Mar 08 08:10:52 2016 -0500
+++ b/test-data/fimo_output_html_2.html	Fri Jun 17 13:15:48 2016 -0400
@@ -41,12 +41,10 @@
 <hr>
 <div style="padding-left: 0.75in; line-height: 1em; font-family: monospace;">
 <p>
-  DATABASE /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat
   <br />
   Database contains 1 sequences, 5386 residues
 </p>
 <p>
-  MOTIFS /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat (Protein)
   <table>
     <thead>
       <tr>
@@ -98,3 +96,5 @@
 probability of a random sequence of the same length as the motif
 matching that position of the sequence with as good or better a score.
 </li>
+<li>
+The score for the match of a position in a sequence to a motif
--- a/test-data/fimo_output_xml_1.xml	Tue Mar 08 08:10:52 2016 -0500
+++ b/test-data/fimo_output_xml_1.xml	Fri Jun 17 13:15:48 2016 -0400
@@ -4,11 +4,7 @@
   xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
   xsi:schemaLocation=  xmlns:fimo="http://noble.gs.washington.edu/schema/fimo"
 >
-<command-line>fimo --o /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1973/dataset_2713_files --verbosity 1 /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat</command-line>
 <settings>
-<setting name="output directory">/Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1973/dataset_2713_files</setting>
-<setting name="MEME file name">/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat</setting>
-<setting name="sequence file name">/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat</setting>
 <setting name="allow clobber">false</setting>
 <setting name="compute q-values">true</setting>
 <setting name="parse genomic coord.">false</setting>
--- a/test-data/fimo_output_xml_2.xml	Tue Mar 08 08:10:52 2016 -0500
+++ b/test-data/fimo_output_xml_2.xml	Fri Jun 17 13:15:48 2016 -0400
@@ -4,14 +4,9 @@
   xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
   xsi:schemaLocation=  xmlns:fimo="http://noble.gs.washington.edu/schema/fimo"
 >
-<command-line>fimo --alpha 1.000000 --max-stored-scores 100000 --motif-pseudo 0.100000 --no-qvalue --thresh 0.000100 --o /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1978/dataset_2738_files --verbosity 1 /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat</command-line>
 <settings>
-<setting name="output directory">/Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1978/dataset_2738_files</setting>
-<setting name="MEME file name">/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2540.dat</setting>
-<setting name="sequence file name">/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2541.dat</setting>
 <setting name="allow clobber">false</setting>
 <setting name="compute q-values">false</setting>
-<setting name="parse genomic coord.">false</setting>
 <setting name="text only">false</setting>
 <setting name="scan both strands">false</setting>
 <setting name="output threshold">0.0001</setting>
--- a/test-data/meme_input_1.fasta	Tue Mar 08 08:10:52 2016 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,66 +0,0 @@
->chr21_19617074_19617124_+
-AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA
->chr21_26934381_26934431_+
-GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT
->chr21_28217753_28217803_-
-CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA
->chr21_31710037_31710087_-
-AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT
->chr21_31744582_31744632_-
-CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA
->chr21_31768316_31768366_+
-AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT
->chr21_31914206_31914256_-
-TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC
->chr21_31933633_31933683_-
-TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT
->chr21_31962741_31962791_-
-ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA
->chr21_31964683_31964733_+
-TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC
->chr21_31973364_31973414_+
-aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC
->chr21_31992870_31992920_+
-CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT
->chr21_32185595_32185645_-
-TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA
->chr21_32202076_32202126_-
-TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT
->chr21_32253899_32253949_-
-AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC
->chr21_32410820_32410870_-
-TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG
->chr21_36411748_36411798_-
-ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt
->chr21_37838750_37838800_-
-gatggttttataaggggcctcaccctcggctcagccctcattcttctcct
->chr21_45705687_45705737_+
-CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC
->chr21_45971413_45971463_-
-CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca
->chr21_45978668_45978718_-
-CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca
->chr21_45993530_45993580_+
-CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC
->chr21_46020421_46020471_+
-GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc
->chr21_46031920_46031970_+
-GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC
->chr21_46046964_46047014_+
-ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca
->chr21_46057197_46057247_+
-ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC
->chr21_46086869_46086919_-
-GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC
->chr21_46102103_46102153_-
-AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT
->chr21_47517957_47518007_+
-CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
->chr21_47517957_47518007_+
-CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
->chr21_47517957_47518007_+
-CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG
->chr21_47575506_47575556_-
-TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
->chr21_47575506_47575556_-
-TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG
--- a/test-data/meme_output_html_1.html	Tue Mar 08 08:10:52 2016 -0500
+++ b/test-data/meme_output_html_1.html	Fri Jun 17 13:15:48 2016 -0400
@@ -12,9 +12,6 @@
         "stop_reason": "Stopped because requested number of motifs (1) found.",
         "cmd": [
           "meme",
-          "/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat",
-          "-o",
-          "/Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1912/dataset_2530_files",
           "-nostatus"
         ],
         "options": {
--- a/test-data/meme_output_html_2.html	Tue Mar 08 08:10:52 2016 -0500
+++ b/test-data/meme_output_html_2.html	Fri Jun 17 13:15:48 2016 -0400
@@ -12,15 +12,6 @@
         "stop_reason": "Stopped because requested number of motifs (1) found.",
         "cmd": [
           "meme",
-          "/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat",
-          "-o",
-          "/Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1929/dataset_2578_files",
-          "-nostatus", "-sf", "Galaxy_FASTA_Input", "-dna", "-mod", "zoops",
-          "-nmotifs", "1", "-wnsites", "0.8", "-minw", "8", "-maxw", "50",
-          "-wg", "11", "-ws", "1", "-maxiter", "50", "-distance", "0.001",
-          "-prior", "dirichlet", "-b", "0.01", "-plib",
-          "/Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2577.dat",
-          "-spmap", "uni", "-spfuzz", "0.5"
         ],
         "options": {
           "mod": "zoops",
--- a/test-data/meme_output_txt_1.txt	Tue Mar 08 08:10:52 2016 -0500
+++ b/test-data/meme_output_txt_1.txt	Fri Jun 17 13:15:48 2016 -0400
@@ -28,7 +28,7 @@
 ********************************************************************************
 TRAINING SET
 ********************************************************************************
-DATAFILE= /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat
+DATAFILE=
 ALPHABET= ACDEFGHIKLMNPQRSTVWY
 Sequence name            Weight Length  Sequence name            Weight Length  
 -------------            ------ ------  -------------            ------ ------  
@@ -55,7 +55,7 @@
 This information can also be useful in the event you wish to report a
 problem with the MEME software.
 
-command: meme /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat -o /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1912/dataset_2530_files -nostatus 
+command: meme 
 
 model:  mod=         zoops    nmotifs=         1    evt=           inf
 object function=  E-value of product of p-values
@@ -267,7 +267,7 @@
 
 
 
-Time  0.53 secs.
+Time
 
 ********************************************************************************
 
@@ -320,6 +320,6 @@
 Stopped because requested number of motifs (1) found.
 ********************************************************************************
 
-CPU: MacBook-Pro-2.local
+CPU:
 
 ********************************************************************************
--- a/test-data/meme_output_txt_2.txt	Tue Mar 08 08:10:52 2016 -0500
+++ b/test-data/meme_output_txt_2.txt	Fri Jun 17 13:15:48 2016 -0400
@@ -55,7 +55,7 @@
 This information can also be useful in the event you wish to report a
 problem with the MEME software.
 
-command: meme /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2490.dat -o /Users/gvk/work/git_workspace/galaxy/database/job_working_directory/001/1929/dataset_2578_files -nostatus -sf Galaxy_FASTA_Input -dna -mod zoops -nmotifs 1 -wnsites 0.8 -minw 8 -maxw 50 -wg 11 -ws 1 -maxiter 50 -distance 0.001 -prior dirichlet -b 0.01 -plib /Users/gvk/work/git_workspace/galaxy/database/files/002/dataset_2577.dat -spmap uni -spfuzz 0.5 
+command: meme 
 
 model:  mod=         zoops    nmotifs=         1    evt=           inf
 object function=  E-value of product of p-values
@@ -69,7 +69,7 @@
 data:   n=            1500    N=              30    shuffle=        -1
 strands: +
 sample: seed=            0    ctfrac=         -1    maxwords=       -1
-Dirichlet mixture priors file: dataset_2577.dat
+Dirichlet mixture priors file:
 Letter frequencies in dataset:
 A 0.294 C 0.231 G 0.257 T 0.217 
 Background letter frequencies (from dataset with add-one prior applied):
@@ -261,7 +261,7 @@
 
 
 
-Time  0.17 secs.
+Time  
 
 ********************************************************************************
 
@@ -314,6 +314,6 @@
 Stopped because requested number of motifs (1) found.
 ********************************************************************************
 
-CPU: dot1x-cb-51.aset.psu.edu
+CPU:
 
 ********************************************************************************
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/motif1.gff	Fri Jun 17 13:15:48 2016 -0400
@@ -0,0 +1,100 @@
+##gff-version 3
+phiX174	fimo	polypeptide_motif	1	11	78.3	+	.	Name=1;ID=1-57-phiX174;pvalue=1.46e-08;sequence=GAGTTTTATCG;
+phiX174	fimo	polypeptide_motif	3	13	57.5	+	.	Name=1;ID=1-471-phiX174;pvalue=1.79e-06;sequence=GTTTTATCGCT;
+phiX174	fimo	polypeptide_motif	7	17	 45	+	.	Name=1;ID=1-1378-phiX174;pvalue=3.18e-05;sequence=TATCGCTTCCA;
+phiX174	fimo	polypeptide_motif	10	20	53.9	+	.	Name=1;ID=1-605-phiX174;pvalue=4.1e-06;sequence=CGCTTCCATGA;
+phiX174	fimo	polypeptide_motif	17	27	40.2	+	.	Name=1;ID=1-1887-phiX174;pvalue=9.55e-05;sequence=ATGACGCAGAA;
+phiX174	fimo	polypeptide_motif	18	28	45.3	+	.	Name=1;ID=1-1349-phiX174;pvalue=2.98e-05;sequence=TGACGCAGAAG;
+phiX174	fimo	polypeptide_motif	19	29	55.8	+	.	Name=1;ID=1-527-phiX174;pvalue=2.6e-06;sequence=GACGCAGAAGT;
+phiX174	fimo	polypeptide_motif	21	31	41.5	+	.	Name=1;ID=1-1705-phiX174;pvalue=7.07e-05;sequence=CGCAGAAGTTA;
+phiX174	fimo	polypeptide_motif	22	32	44.6	+	.	Name=1;ID=1-1404-phiX174;pvalue=3.44e-05;sequence=GCAGAAGTTAA;
+phiX174	fimo	polypeptide_motif	24	34	79.1	+	.	Name=1;ID=1-53-phiX174;pvalue=1.23e-08;sequence=AGAAGTTAACA;
+phiX174	fimo	polypeptide_motif	25	35	45.3	+	.	Name=1;ID=1-1347-phiX174;pvalue=2.97e-05;sequence=GAAGTTAACAC;
+phiX174	fimo	polypeptide_motif	26	36	59.2	+	.	Name=1;ID=1-417-phiX174;pvalue=1.19e-06;sequence=AAGTTAACACT;
+phiX174	fimo	polypeptide_motif	30	40	44.7	+	.	Name=1;ID=1-1399-phiX174;pvalue=3.4e-05;sequence=TAACACTTTCG;
+phiX174	fimo	polypeptide_motif	37	47	72.4	+	.	Name=1;ID=1-98-phiX174;pvalue=5.79e-08;sequence=TTCGGATATTT;
+phiX174	fimo	polypeptide_motif	39	49	65.3	+	.	Name=1;ID=1-213-phiX174;pvalue=2.92e-07;sequence=CGGATATTTCT;
+phiX174	fimo	polypeptide_motif	41	51	55.3	+	.	Name=1;ID=1-548-phiX174;pvalue=2.97e-06;sequence=GATATTTCTGA;
+phiX174	fimo	polypeptide_motif	43	53	58.4	+	.	Name=1;ID=1-442-phiX174;pvalue=1.43e-06;sequence=TATTTCTGATG;
+phiX174	fimo	polypeptide_motif	46	56	53.7	+	.	Name=1;ID=1-617-phiX174;pvalue=4.23e-06;sequence=TTCTGATGAGT;
+phiX174	fimo	polypeptide_motif	50	60	45.4	+	.	Name=1;ID=1-1333-phiX174;pvalue=2.86e-05;sequence=GATGAGTCGAA;
+phiX174	fimo	polypeptide_motif	51	61	48.4	+	.	Name=1;ID=1-1094-phiX174;pvalue=1.44e-05;sequence=ATGAGTCGAAA;
+phiX174	fimo	polypeptide_motif	52	62	83.9	+	.	Name=1;ID=1-22-phiX174;pvalue=4.06e-09;sequence=TGAGTCGAAAA;
+phiX174	fimo	polypeptide_motif	53	63	53.9	+	.	Name=1;ID=1-601-phiX174;pvalue=4.03e-06;sequence=GAGTCGAAAAA;
+phiX174	fimo	polypeptide_motif	54	64	62.9	+	.	Name=1;ID=1-297-phiX174;pvalue=5.16e-07;sequence=AGTCGAAAAAT;
+phiX174	fimo	polypeptide_motif	55	65	52.8	+	.	Name=1;ID=1-675-phiX174;pvalue=5.26e-06;sequence=GTCGAAAAATT;
+phiX174	fimo	polypeptide_motif	56	66	41.4	+	.	Name=1;ID=1-1713-phiX174;pvalue=7.2e-05;sequence=TCGAAAAATTA;
+phiX174	fimo	polypeptide_motif	58	68	43.4	+	.	Name=1;ID=1-1500-phiX174;pvalue=4.56e-05;sequence=GAAAAATTATC;
+phiX174	fimo	polypeptide_motif	59	69	59.6	+	.	Name=1;ID=1-409-phiX174;pvalue=1.1e-06;sequence=AAAAATTATCT;
+phiX174	fimo	polypeptide_motif	61	71	61.8	+	.	Name=1;ID=1-329-phiX174;pvalue=6.52e-07;sequence=AAATTATCTTG;
+phiX174	fimo	polypeptide_motif	63	73	59.2	+	.	Name=1;ID=1-419-phiX174;pvalue=1.2e-06;sequence=ATTATCTTGAT;
+phiX174	fimo	polypeptide_motif	65	75	53.3	+	.	Name=1;ID=1-643-phiX174;pvalue=4.66e-06;sequence=TATCTTGATAA;
+phiX174	fimo	polypeptide_motif	66	76	51.8	+	.	Name=1;ID=1-737-phiX174;pvalue=6.54e-06;sequence=ATCTTGATAAA;
+phiX174	fimo	polypeptide_motif	67	77	73.2	+	.	Name=1;ID=1-89-phiX174;pvalue=4.78e-08;sequence=TCTTGATAAAG;
+phiX174	fimo	polypeptide_motif	69	79	63.8	+	.	Name=1;ID=1-268-phiX174;pvalue=4.15e-07;sequence=TTGATAAAGCA;
+phiX174	fimo	polypeptide_motif	71	81	40.2	+	.	Name=1;ID=1-1882-phiX174;pvalue=9.49e-05;sequence=GATAAAGCAGG;
+phiX174	fimo	polypeptide_motif	73	83	45.4	+	.	Name=1;ID=1-1334-phiX174;pvalue=2.87e-05;sequence=TAAAGCAGGAA;
+phiX174	fimo	polypeptide_motif	74	84	50.9	+	.	Name=1;ID=1-832-phiX174;pvalue=8.05e-06;sequence=AAAGCAGGAAT;
+phiX174	fimo	polypeptide_motif	76	86	52.2	+	.	Name=1;ID=1-710-phiX174;pvalue=5.96e-06;sequence=AGCAGGAATTA;
+phiX174	fimo	polypeptide_motif	78	88	51.8	+	.	Name=1;ID=1-741-phiX174;pvalue=6.65e-06;sequence=CAGGAATTACT;
+phiX174	fimo	polypeptide_motif	79	89	 45	+	.	Name=1;ID=1-1369-phiX174;pvalue=3.16e-05;sequence=AGGAATTACTA;
+phiX174	fimo	polypeptide_motif	80	90	43.3	+	.	Name=1;ID=1-1511-phiX174;pvalue=4.63e-05;sequence=GGAATTACTAC;
+phiX174	fimo	polypeptide_motif	81	91	59.8	+	.	Name=1;ID=1-402-phiX174;pvalue=1.05e-06;sequence=GAATTACTACT;
+phiX174	fimo	polypeptide_motif	82	92	46.9	+	.	Name=1;ID=1-1205-phiX174;pvalue=2.03e-05;sequence=AATTACTACTG;
+phiX174	fimo	polypeptide_motif	88	98	41.2	+	.	Name=1;ID=1-1744-phiX174;pvalue=7.51e-05;sequence=TACTGCTTGTT;
+phiX174	fimo	polypeptide_motif	91	101	53.6	+	.	Name=1;ID=1-621-phiX174;pvalue=4.33e-06;sequence=TGCTTGTTTAC;
+phiX174	fimo	polypeptide_motif	92	102	44.8	+	.	Name=1;ID=1-1388-phiX174;pvalue=3.31e-05;sequence=GCTTGTTTACG;
+phiX174	fimo	polypeptide_motif	93	103	43.2	+	.	Name=1;ID=1-1525-phiX174;pvalue=4.82e-05;sequence=CTTGTTTACGA;
+phiX174	fimo	polypeptide_motif	95	105	61.9	+	.	Name=1;ID=1-327-phiX174;pvalue=6.5e-07;sequence=TGTTTACGAAT;
+phiX174	fimo	polypeptide_motif	96	106	42.9	+	.	Name=1;ID=1-1553-phiX174;pvalue=5.08e-05;sequence=GTTTACGAATT;
+phiX174	fimo	polypeptide_motif	98	108	45.4	+	.	Name=1;ID=1-1340-phiX174;pvalue=2.9e-05;sequence=TTACGAATTAA;
+phiX174	fimo	polypeptide_motif	99	109	73.5	+	.	Name=1;ID=1-88-phiX174;pvalue=4.48e-08;sequence=TACGAATTAAA;
+phiX174	fimo	polypeptide_motif	100	110	 53	+	.	Name=1;ID=1-661-phiX174;pvalue=4.99e-06;sequence=ACGAATTAAAT;
+phiX174	fimo	polypeptide_motif	102	112	75.6	+	.	Name=1;ID=1-72-phiX174;pvalue=2.75e-08;sequence=GAATTAAATCG;
+phiX174	fimo	polypeptide_motif	104	114	52.2	+	.	Name=1;ID=1-713-phiX174;pvalue=6.05e-06;sequence=ATTAAATCGAA;
+phiX174	fimo	polypeptide_motif	106	116	59.6	+	.	Name=1;ID=1-407-phiX174;pvalue=1.09e-06;sequence=TAAATCGAAGT;
+phiX174	fimo	polypeptide_motif	112	122	41.6	+	.	Name=1;ID=1-1683-phiX174;pvalue=6.85e-05;sequence=GAAGTGGACTG;
+phiX174	fimo	polypeptide_motif	114	124	45.3	+	.	Name=1;ID=1-1342-phiX174;pvalue=2.92e-05;sequence=AGTGGACTGCT;
+phiX174	fimo	polypeptide_motif	118	128	56.2	+	.	Name=1;ID=1-512-phiX174;pvalue=2.38e-06;sequence=GACTGCTGGCG;
+phiX174	fimo	polypeptide_motif	122	132	51.4	+	.	Name=1;ID=1-774-phiX174;pvalue=7.15e-06;sequence=GCTGGCGGAAA;
+phiX174	fimo	polypeptide_motif	123	133	43.1	+	.	Name=1;ID=1-1533-phiX174;pvalue=4.93e-05;sequence=CTGGCGGAAAA;
+phiX174	fimo	polypeptide_motif	124	134	48.6	+	.	Name=1;ID=1-1085-phiX174;pvalue=1.38e-05;sequence=TGGCGGAAAAT;
+phiX174	fimo	polypeptide_motif	125	135	68.3	+	.	Name=1;ID=1-146-phiX174;pvalue=1.49e-07;sequence=GGCGGAAAATG;
+phiX174	fimo	polypeptide_motif	126	136	46.4	+	.	Name=1;ID=1-1243-phiX174;pvalue=2.27e-05;sequence=GCGGAAAATGA;
+phiX174	fimo	polypeptide_motif	128	138	58.3	+	.	Name=1;ID=1-446-phiX174;pvalue=1.48e-06;sequence=GGAAAATGAGA;
+phiX174	fimo	polypeptide_motif	129	139	43.2	+	.	Name=1;ID=1-1522-phiX174;pvalue=4.78e-05;sequence=GAAAATGAGAA;
+phiX174	fimo	polypeptide_motif	130	140	54.1	+	.	Name=1;ID=1-595-phiX174;pvalue=3.92e-06;sequence=AAAATGAGAAA;
+phiX174	fimo	polypeptide_motif	131	141	 76	+	.	Name=1;ID=1-68-phiX174;pvalue=2.49e-08;sequence=AAATGAGAAAA;
+phiX174	fimo	polypeptide_motif	132	142	51.2	+	.	Name=1;ID=1-800-phiX174;pvalue=7.57e-06;sequence=AATGAGAAAAT;
+phiX174	fimo	polypeptide_motif	133	143	56.2	+	.	Name=1;ID=1-513-phiX174;pvalue=2.41e-06;sequence=ATGAGAAAATT;
+phiX174	fimo	polypeptide_motif	134	144	41.1	+	.	Name=1;ID=1-1761-phiX174;pvalue=7.83e-05;sequence=TGAGAAAATTC;
+phiX174	fimo	polypeptide_motif	135	145	50.3	+	.	Name=1;ID=1-910-phiX174;pvalue=9.39e-06;sequence=GAGAAAATTCG;
+phiX174	fimo	polypeptide_motif	136	146	43.3	+	.	Name=1;ID=1-1517-phiX174;pvalue=4.66e-05;sequence=AGAAAATTCGA;
+phiX174	fimo	polypeptide_motif	139	149	54.2	+	.	Name=1;ID=1-588-phiX174;pvalue=3.75e-06;sequence=AAATTCGACCT;
+phiX174	fimo	polypeptide_motif	141	151	42.2	+	.	Name=1;ID=1-1625-phiX174;pvalue=6.01e-05;sequence=ATTCGACCTAT;
+phiX174	fimo	polypeptide_motif	143	153	 50	+	.	Name=1;ID=1-938-phiX174;pvalue=9.94e-06;sequence=TCGACCTATCC;
+phiX174	fimo	polypeptide_motif	145	155	44.6	+	.	Name=1;ID=1-1403-phiX174;pvalue=3.42e-05;sequence=GACCTATCCTT;
+phiX174	fimo	polypeptide_motif	155	165	51.3	+	.	Name=1;ID=1-787-phiX174;pvalue=7.35e-06;sequence=TGCGCAGCTCG;
+phiX174	fimo	polypeptide_motif	157	167	51.1	+	.	Name=1;ID=1-807-phiX174;pvalue=7.68e-06;sequence=CGCAGCTCGAG;
+phiX174	fimo	polypeptide_motif	159	169	44.5	+	.	Name=1;ID=1-1420-phiX174;pvalue=3.56e-05;sequence=CAGCTCGAGAA;
+phiX174	fimo	polypeptide_motif	160	170	 40	+	.	Name=1;ID=1-1921-phiX174;pvalue=9.89e-05;sequence=AGCTCGAGAAG;
+phiX174	fimo	polypeptide_motif	166	176	60.9	+	.	Name=1;ID=1-365-phiX174;pvalue=8.02e-07;sequence=AGAAGCTCTTA;
+phiX174	fimo	polypeptide_motif	168	178	62.3	+	.	Name=1;ID=1-311-phiX174;pvalue=5.87e-07;sequence=AAGCTCTTACT;
+phiX174	fimo	polypeptide_motif	181	191	49.9	+	.	Name=1;ID=1-946-phiX174;pvalue=1.01e-05;sequence=GCGACCTTTCG;
+phiX174	fimo	polypeptide_motif	187	197	52.5	+	.	Name=1;ID=1-694-phiX174;pvalue=5.64e-06;sequence=TTTCGCCATCA;
+phiX174	fimo	polypeptide_motif	191	201	46.6	+	.	Name=1;ID=1-1232-phiX174;pvalue=2.2e-05;sequence=GCCATCAACTA;
+phiX174	fimo	polypeptide_motif	194	204	76.4	+	.	Name=1;ID=1-67-phiX174;pvalue=2.29e-08;sequence=ATCAACTAACG;
+phiX174	fimo	polypeptide_motif	201	211	40.1	+	.	Name=1;ID=1-1908-phiX174;pvalue=9.77e-05;sequence=AACGATTCTGT;
+phiX174	fimo	polypeptide_motif	203	213	 63	+	.	Name=1;ID=1-291-phiX174;pvalue=5e-07;sequence=CGATTCTGTCA;
+phiX174	fimo	polypeptide_motif	205	215	53.8	+	.	Name=1;ID=1-610-phiX174;pvalue=4.16e-06;sequence=ATTCTGTCAAA;
+phiX174	fimo	polypeptide_motif	206	216	59.1	+	.	Name=1;ID=1-421-phiX174;pvalue=1.23e-06;sequence=TTCTGTCAAAA;
+phiX174	fimo	polypeptide_motif	207	217	 68	+	.	Name=1;ID=1-153-phiX174;pvalue=1.58e-07;sequence=TCTGTCAAAAA;
+phiX174	fimo	polypeptide_motif	209	219	49.6	+	.	Name=1;ID=1-988-phiX174;pvalue=1.09e-05;sequence=TGTCAAAAACT;
+phiX174	fimo	polypeptide_motif	210	220	40.8	+	.	Name=1;ID=1-1810-phiX174;pvalue=8.33e-05;sequence=GTCAAAAACTG;
+phiX174	fimo	polypeptide_motif	213	223	59.7	+	.	Name=1;ID=1-404-phiX174;pvalue=1.06e-06;sequence=AAAAACTGACG;
+phiX174	fimo	polypeptide_motif	223	233	 42	+	.	Name=1;ID=1-1654-phiX174;pvalue=6.36e-05;sequence=GCGTTGGATGA;
+phiX174	fimo	polypeptide_motif	225	235	61.4	+	.	Name=1;ID=1-349-phiX174;pvalue=7.16e-07;sequence=GTTGGATGAGG;
+phiX174	fimo	polypeptide_motif	227	237	40.3	+	.	Name=1;ID=1-1874-phiX174;pvalue=9.32e-05;sequence=TGGATGAGGAG;
+phiX174	fimo	polypeptide_motif	228	238	49.9	+	.	Name=1;ID=1-947-phiX174;pvalue=1.01e-05;sequence=GGATGAGGAGA;
+phiX174	fimo	polypeptide_motif	229	239	 45	+	.	Name=1;ID=1-1370-phiX174;pvalue=3.16e-05;sequence=GATGAGGAGAA;
+phiX174	fimo	polypeptide_motif	230	240	44.8	+	.	Name=1;ID=1-1395-phiX174;pvalue=3.33e-05;sequence=ATGAGGAGAAG;
--- a/test-data/prior30.plib	Tue Mar 08 08:10:52 2016 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,275 +0,0 @@
-Alphabet= ACDEFGHIKLMNPQRSTVWY
-NumDistr= 30
-Number= 0
-Mixture= 0.055795
-B= 5.623820
-Alpha= 0.0855491 0.0221831 0.0111063 0.0209959 0.0505726 0.025437 0.0155389 0.132951 0.0247865 0.150287 0.0577239 0.0209317 0.0166629 0.0220905 0.0244295 0.0497608 0.070277 0.157532 0.0102219 0.0309633 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=    HMM9.4 reestimated in henikoff29.2
-
-Number= 1
-Mixture= 0.198333
-B= 0.097240
-Alpha= 0.0562629 0.0329597 0.0692513 0.0385232 0.0400041 0.143573 0.0428939 0.0226244 0.0442102 0.0665467 0.0117853 0.0447655 0.0833299 0.0395825 0.0611271 0.0588852 0.0513472 0.0317153 0.0237865 0.0368161 
-FullUpdate= 1
-QUpdate= 1
-StructID=       24
-Comment=      Outside
-
-Number= 2
-Mixture= 0.043566
-B= 1.648336
-Alpha= 0.0144564 0.00845337 0.00785519 0.00864933 0.255959 0.0110815 0.0509526 0.0234533 0.0120443 0.0561967 0.015111 0.0190974 0.00857653 0.0167812 0.0164918 0.0197108 0.0151013 0.0252782 0.050139 0.364613 
-FullUpdate= 1
-QUpdate= 1
-StructID=       26
-Comment=       Inside
-
-Number= 3
-Mixture= 0.060170
-B= 2.595432
-Alpha= 0.0452144 0.00587917 0.169731 0.0751478 0.00749471 0.0845832 0.0369819 0.00610072 0.0548186 0.011029 0.00382749 0.212785 0.0206532 0.0416705 0.0280716 0.117267 0.0533742 0.00943157 0.00216149 0.0137784 
-FullUpdate= 1
-QUpdate= 1
-StructID=       19
-Comment=      Outside Alpha
-
-Number= 4
-Mixture= 0.065466
-B= 3.112271
-Alpha= 0.0361167 0.0049157 0.0134924 0.0461325 0.00557631 0.0209043 0.0302551 0.016425 0.307554 0.0338255 0.0139435 0.0360733 0.0127659 0.0873761 0.222668 0.0369042 0.0354442 0.0228891 0.00434827 0.0123906 
-FullUpdate= 1
-QUpdate= 1
-StructID=       21
-Comment=       Outside Beta
-
-Number= 5
-Mixture= 0.067614
-B= 2.053644
-Alpha= 0.0194362 0.00765176 0.00188738 0.00372898 0.0849894 0.00421787 0.00400459 0.152735 0.00407958 0.4568 0.106051 0.00304386 0.00545956 0.00900935 0.00605071 0.00519029 0.016255 0.0861045 0.00787965 0.0154248 
-FullUpdate= 1
-QUpdate= 1
-StructID=       22
-Comment=      Inside alpha
-
-Number= 6
-Mixture= 0.080724
-B= 2.138987
-Alpha= 0.0423172 0.0153891 0.00409306 0.00565735 0.0197117 0.00590607 0.00139926 0.307863 0.00544884 0.115721 0.0285808 0.00522771 0.00474851 0.00328193 0.00351054 0.00892385 0.0348922 0.380003 0.00117673 0.00614917 
-FullUpdate= 1
-QUpdate= 1
-StructID=       23
-Comment=       Inside beta
-
-Number= 7
-Mixture= 0.051030
-B= 3.878926
-Alpha= 0.0548123 0.000759746 0.144127 0.46019 0.00249502 0.0192754 0.0106535 0.00938765 0.0562429 0.0163148 0.00717389 0.0245612 0.0177482 0.0744802 0.0199233 0.0323535 0.0257651 0.018574 0.00087086 0.00429088 
-FullUpdate= 1
-QUpdate= 1
-StructID=       23
-Comment=      Alpha helix
-
-Number= 8
-Mixture= 0.103529
-B= 1.486325
-Alpha= 0.315754 0.0384546 0.0116388 0.0133665 0.0111126 0.107921 0.00752325 0.0154885 0.0111281 0.0231087 0.011626 0.0228375 0.0304785 0.0166632 0.0156345 0.186379 0.0954421 0.0546691 0.00351538 0.00725682 
-FullUpdate= 1
-QUpdate= 1
-StructID=       23
-Comment=      Beta strand
-
-Number= 9
-Mixture= 0.062940
-B= 8.221215
-Alpha= 0.0869919 0.00672577 0.0600995 0.10763 0.0153489 0.0378086 0.0325335 0.023388 0.113765 0.041623 0.0196906 0.0625344 0.0262599 0.0788667 0.0707399 0.0886634 0.0666777 0.0361472 0.00484308 0.0196629 
-FullUpdate= 1
-QUpdate= 1
-StructID=       23
-Comment=      Other
-
-Number= 10
-Mixture= 0.012518
-B= 38.955631
-Alpha= 0.732922 0.0145131 0.00623235 0.00951423 0.00717778 0.0289521 0.00351664 0.0125081 0.00886593 0.0183651 0.00832812 0.00670968 0.00364556 0.00622169 0.00812899 0.0582399 0.0205067 0.0394327 0.00207485 0.00414489 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      A
-
-Number= 11
-Mixture= 0.004953
-B= 381.562195
-Alpha= 0.00563239 0.959814 0.00144129 0.00213042 0.00158645 0.00168393 0.000989765 0.00325263 0.00148501 0.00343924 0.00168673 0.00159054 0.00121534 0.00129942 0.00195209 0.00296106 0.0039912 0.00266944 0.000327808 0.000851203 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      C
-
-Number= 12
-Mixture= 0.013849
-B= 90.727570
-Alpha= 0.00897115 0.00169015 0.859473 0.0360829 0.00269485 0.00606504 0.00469816 0.00400134 0.0047981 0.00514968 0.00208395 0.029754 0.00241276 0.0045506 0.00433816 0.0088208 0.00511143 0.00527448 0.00104469 0.00298475 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     D 
-
-Number= 13
-Mixture= 0.008388
-B= 404.591034
-Alpha= 0.00241514 0.000413991 0.0122981 0.96369 0.000665578 0.00187461 0.00106904 0.00149214 0.00121548 0.00129791 0.000554145 0.00253496 0.000624495 0.00316839 0.00115045 0.00171781 0.001468 0.0014564 0.000278652 0.000614791 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      E 
-
-Number= 14
-Mixture= 0.008064
-B= 83.323669
-Alpha= 0.00839779 0.00428348 0.00298116 0.00358128 0.850936 0.00329382 0.00196832 0.0130534 0.00320345 0.0351883 0.00729724 0.00287304 0.00358482 0.00218728 0.00264753 0.00833798 0.00418729 0.0120684 0.00448366 0.025446 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     F 
-
-Number= 15
-Mixture= 0.032205
-B= 32.644871
-Alpha= 0.0234448 0.00236512 0.0112957 0.00811395 0.00248143 0.868718 0.00345598 0.00342985 0.00859682 0.0040966 0.00239339 0.012342 0.00423123 0.00440054 0.00795347 0.0165095 0.0065024 0.00550512 0.00140604 0.00275817 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     G 
-
-Number= 16
-Mixture= 0.005033
-B= 35.520824
-Alpha= 0.0100058 0.00386024 0.0131498 0.0108984 0.0122851 0.00738691 0.722249 0.00521193 0.00686054 0.0150103 0.00673014 0.0367074 0.00625526 0.0429912 0.0234127 0.0187246 0.0128445 0.00837399 0.00390723 0.0331349 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     H 
-
-Number= 17
-Mixture= 0.007454
-B= 101.265472
-Alpha= 0.0106938 0.00267663 0.00404166 0.00466637 0.00838963 0.00372808 0.00182575 0.681615 0.0059102 0.0770333 0.0184335 0.004676 0.0027124 0.00372663 0.00418165 0.00773357 0.0109237 0.140679 0.00140417 0.00494911 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     I 
-
-Number= 18
-Mixture= 0.009400
-B= 150.415985
-Alpha= 0.00688657 0.00169711 0.00222738 0.00346887 0.00115861 0.00302866 0.00209171 0.00400905 0.903944 0.0037747 0.00186061 0.00449531 0.00249618 0.00324487 0.041775 0.00392196 0.00461714 0.00296607 0.000893256 0.00144282 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      K 
-
-Number= 19
-Mixture= 0.017057
-B= 31.896633
-Alpha= 0.0114646 0.00367926 0.00296188 0.00596126 0.0190009 0.00382486 0.00338381 0.0401936 0.00650072 0.790038 0.031659 0.00392791 0.0050046 0.00753591 0.00771818 0.00748621 0.0101555 0.0312597 0.00242405 0.00581952 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     L 
-
-Number= 20
-Mixture= 0.002761
-B= 201.346268
-Alpha= 0.00353933 0.00165628 0.0014931 0.00161065 0.00279831 0.00194259 0.00101868 0.00969101 0.00211316 0.0217036 0.928022 0.00162899 0.0015681 0.0015629 0.00138977 0.00294601 0.00311476 0.00723178 0.00156295 0.00340569 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     M 
-
-Number= 21
-Mixture= 0.005734
-B= 108.343185
-Alpha= 0.0067512 0.00239062 0.0140378 0.0043452 0.00365788 0.00689345 0.0148828 0.00715373 0.00789036 0.00614036 0.00289697 0.858995 0.00399721 0.00770961 0.00570515 0.0238176 0.011602 0.00591549 0.00167893 0.00353897 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     N 
-
-Number= 22
-Mixture= 0.022818
-B= 15.153304
-Alpha= 0.0417987 0.00360232 0.0113792 0.0152366 0.00564775 0.0123795 0.00606957 0.0091353 0.0165122 0.0167265 0.00490487 0.00915437 0.755604 0.0131375 0.012587 0.0283392 0.0189623 0.0140029 0.0012848 0.00353553 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     P 
-
-Number= 23
-Mixture= 0.005931
-B= 79.417511
-Alpha= 0.0142993 0.00266984 0.0053289 0.0321605 0.0028715 0.00426743 0.0257509 0.00565307 0.0106106 0.0161186 0.00955753 0.0104696 0.00638107 0.807311 0.0149106 0.0111968 0.00889459 0.00681482 0.00206658 0.00266624 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     Q 
-
-Number= 24
-Mixture= 0.011491
-B= 93.103897
-Alpha= 0.00756896 0.00314197 0.00296652 0.00327634 0.00194604 0.00467894 0.00721049 0.00406061 0.0277257 0.00663852 0.00217868 0.00577047 0.00473306 0.00953551 0.889701 0.00650859 0.00506022 0.00294281 0.00205549 0.00230062 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=      R 
-
-Number= 25
-Mixture= 0.008219
-B= 47.504795
-Alpha= 0.0284818 0.00697155 0.00749796 0.00604665 0.00515171 0.00954817 0.00380684 0.00637929 0.0104463 0.00908885 0.00471437 0.0194592 0.00711823 0.00611827 0.00979722 0.707416 0.139256 0.00656298 0.0015377 0.00460086 
-FullUpdate= 1
-QUpdate= 1
-StructID=    0
-Comment=     S 
-
-Number= 26
-Mixture= 0.019050
-B= 14.027470
-Alpha= 0.0247201 0.00718027 0.00845584 0.0076239 0.00600101 0.0073401 0.00492149 0.0173757 0.0129878 0.0125773 0.0100452 0.0230424 0.00659406 0.0110314 0.0112037 0.107763 0.690341 0.0249364 0.00193884 0.00392074 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     T 
-
-Number= 27
-Mixture= 0.007047
-B= 76.958153
-Alpha= 0.0447488 0.00734525 0.00576457 0.00805666 0.00714188 0.00593389 0.0041663 0.0688592 0.00714299 0.0255115 0.00800708 0.00501678 0.00632646 0.00492002 0.00812967 0.0100074 0.0240134 0.745035 0.00126243 0.00261056 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     V 
-
-Number= 28
-Mixture= 0.003957
-B= 150.973328
-Alpha= 0.00517343 0.00213336 0.00350645 0.00390297 0.018439 0.0041919 0.0023655 0.00404231 0.00420998 0.0171406 0.00379068 0.00363696 0.00245861 0.00387467 0.00502035 0.00465674 0.00417283 0.00620977 0.888513 0.012561 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     W 
-
-Number= 29
-Mixture= 0.004904
-B= 30.653225
-Alpha= 0.0342049 0.00809912 0.0126852 0.0174701 0.156033 0.0118268 0.0431342 0.0204751 0.0164439 0.0363664 0.0129811 0.0131986 0.0103037 0.0116235 0.0159032 0.0287792 0.0176143 0.024986 0.0131845 0.494687 
-FullUpdate= 1
-QUpdate= 1
-StructID=      0
-Comment=     Y 
-
-/* $Header$ */
-/* $Header$ */
-/* $Header$ */
--- a/tool_dependencies.xml	Tue Mar 08 08:10:52 2016 -0500
+++ b/tool_dependencies.xml	Fri Jun 17 13:15:48 2016 -0400
@@ -4,6 +4,6 @@
         <repository changeset_revision="942ae5bafee3" name="package_imagemagick_6_9_3" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" />
     </package>
     <package name="meme" version="4.11.0">
-        <repository changeset_revision="738dc831aeac" name="package_meme_4_11_0" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="5774a0e96d6f" name="package_meme_4_11_0" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>