FIMO Results

# HG changeset patch # User iuc # Date 1503536254 14400 # Node ID a0fa4efeeee33ada1bccd6382820362027a0e8eb planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/meme commit 3f116ddc83447056068573320c148a9bfca9aa2e diff -r 000000000000 -r a0fa4efeeee3 all_fasta.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/all_fasta.loc.sample Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,18 @@ +#This file lists the locations and dbkeys of all the fasta files +#under the "genome" directory (a directory that contains a directory +#for each build). The script extract_fasta.py will generate the file +#all_fasta.loc. This file has the format (white space characters are +#TAB characters): +# +# +# +#So, all_fasta.loc could look something like this: +# +#apiMel3 apiMel3 Honeybee (Apis mellifera): apiMel3 /path/to/genome/apiMel3/apiMel3.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /path/to/genome/hg19/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /path/to/genome/hg19/hg19full.fa +# +#Your all_fasta.loc file should contain an entry for each individual +#fasta file. So there will be multiple fasta files for each build, +#such as with hg19 above. +# diff -r 000000000000 -r a0fa4efeeee3 fimo_wrapper.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fimo_wrapper.py Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,194 @@ +#!/usr/bin/env python +import argparse +import os +import shutil +import string +import subprocess +import sys +import tempfile + +BUFFSIZE = 1048576 +# Translation table for reverse Complement, with ambiguity codes. +DNA_COMPLEMENT = string.maketrans("ACGTRYKMBDHVacgtrykmbdhv", "TGCAYRMKVHDBtgcayrmkvhdb") + + +def get_stderr(tmp_stderr): + tmp_stderr.seek(0) + stderr = '' + try: + while True: + stderr += tmp_stderr.read(BUFFSIZE) + if not stderr or len(stderr) % BUFFSIZE != 0: + break + except OverflowError: + pass + return stderr + + +def reverse(sequence): + # Reverse sequence string. + return sequence[::-1] + + +def dna_complement(sequence): + # Complement DNA sequence string. + return sequence.translate(DNA_COMPLEMENT) + + +def dna_reverse_complement(sequence): + # Returns the reverse complement of the sequence. + sequence = reverse(sequence) + return dna_complement(sequence) + + +def stop_err(msg): + sys.stderr.write(msg) + sys.exit(1) + + +parser = argparse.ArgumentParser() +parser.add_argument('--input_motifs', dest='input_motifs', help='MEME output formatted files for input to fimo') +parser.add_argument('--input_fasta', dest='input_fasta', help='Fassta sequence file') +parser.add_argument('--options_type', dest='options_type', help='Basic or Advance options') +parser.add_argument('--input_psp', dest='input_psp', default=None, help='File containing position specific priors') +parser.add_argument('--input_prior_dist', dest='input_prior_dist', default=None, help='File containing binned distribution of priors') +parser.add_argument('--alpha', dest='alpha', type=float, default=1.0, help='The alpha parameter for calculating position specific priors') +parser.add_argument('--bgfile', dest='bgfile', default=None, help='Background file type, used only if not "default"') +parser.add_argument('--max_strand', action='store_true', help='If matches on both strands at a given position satisfy the output threshold, only report the match for the strand with the higher score') +parser.add_argument('--max_stored_scores', dest='max_stored_scores', type=int, help='Maximum score count to store') +parser.add_argument('--motif', dest='motifs', action='append', default=[], help='Specify motif by id') +parser.add_argument('--output_separate_motifs', dest='output_separate_motifs', default='no', help='Output one dataset per motif') +parser.add_argument('--motif_pseudo', dest='motif_pseudo', type=float, default=0.1, help='Pseudocount to add to counts in motif matrix') +parser.add_argument('--no_qvalue', action='store_true', help='Do not compute a q-value for each p-value') +parser.add_argument('--norc', action='store_true', help='Do not score the reverse complement DNA strand') +parser.add_argument('--output_path', dest='output_path', help='Output files directory') +parser.add_argument('--parse_genomic_coord', dest='parse_genomic_coord', default='no', help='Check each sequence header for UCSC style genomic coordinates') +parser.add_argument('--remove_duplicate_coords', dest='remove_duplicate_coords', default='no', help='Remove duplicate entries in unique GFF coordinates') +parser.add_argument('--qv_thresh', action='store_true', help='Use q-values for the output threshold') +parser.add_argument('--thresh', dest='thresh', type=float, help='p-value threshold') +parser.add_argument('--gff_output', dest='gff_output', help='Gff output file') +parser.add_argument('--html_output', dest='html_output', help='HTML output file') +parser.add_argument('--interval_output', dest='interval_output', help='Interval output file') +parser.add_argument('--txt_output', dest='txt_output', help='Text output file') +parser.add_argument('--xml_output', dest='xml_output', help='XML output file') +args = parser.parse_args() + +fimo_cmd_list = ['fimo'] +if args.options_type == 'advanced': + fimo_cmd_list.append('--alpha %4f' % args.alpha) + if args.bgfile is not None: + fimo_cmd_list.append('--bgfile "%s"' % args.bgfile) + if args.max_strand: + fimo_cmd_list.append('--max-strand') + fimo_cmd_list.append('--max-stored-scores %d' % args.max_stored_scores) + if len(args.motifs) > 0: + for motif in args.motifs: + fimo_cmd_list.append('--motif "%s"' % motif) + fimo_cmd_list.append('--motif-pseudo %4f' % args.motif_pseudo) + if args.no_qvalue: + fimo_cmd_list.append('--no-qvalue') + if args.norc: + fimo_cmd_list.append('--norc') + if args.parse_genomic_coord == 'yes': + fimo_cmd_list.append('--parse-genomic-coord') + if args.qv_thresh: + fimo_cmd_list.append('--qv-thresh') + fimo_cmd_list.append('--thresh %4f' % args.thresh) + if args.input_psp is not None: + fimo_cmd_list.append('--psp "%s"' % args.input_psp) + if args.input_prior_dist is not None: + fimo_cmd_list.append('--prior-dist "%s"' % args.input_prior_dist) +fimo_cmd_list.append('--o "%s"' % (args.output_path)) +fimo_cmd_list.append('--verbosity 1') +fimo_cmd_list.append(args.input_motifs) +fimo_cmd_list.append(args.input_fasta) + +fimo_cmd = ' '.join(fimo_cmd_list) + +try: + tmp_stderr = tempfile.NamedTemporaryFile() + proc = subprocess.Popen(args=fimo_cmd, shell=True, stderr=tmp_stderr) + returncode = proc.wait() + if returncode != 0: + stderr = get_stderr(tmp_stderr) + stop_err(stderr) +except Exception as e: + stop_err('Error running FIMO:\n%s' % e) + +shutil.move(os.path.join(args.output_path, 'fimo.txt'), args.txt_output) + +gff_file = os.path.join(args.output_path, 'fimo.gff') +if args.remove_duplicate_coords == 'yes': + tmp_stderr = tempfile.NamedTemporaryFile() + # Identify and eliminating identical motif occurrences. These + # are identical if the combination of chrom, start, end and + # motif id are identical. + cmd = 'sort -k1,1 -k4,4n -k5,5n -k9.1,9.6 -u -o %s %s' % (gff_file, gff_file) + proc = subprocess.Popen(args=cmd, stderr=tmp_stderr, shell=True) + returncode = proc.wait() + if returncode != 0: + stderr = get_stderr(tmp_stderr) + stop_err(stderr) + # Sort GFF output by a combination of chrom, score, start. + cmd = 'sort -k1,1 -k4,4n -k6,6n -o %s %s' % (gff_file, gff_file) + proc = subprocess.Popen(args=cmd, stderr=tmp_stderr, shell=True) + returncode = proc.wait() + if returncode != 0: + stderr = get_stderr(tmp_stderr) + stop_err(stderr) +if args.output_separate_motifs == 'yes': + # Create the collection output directory. + collection_path = (os.path.join(os.getcwd(), 'output')) + # Keep track of motif occurrences. + header_line = None + motif_ids = [] + file_handles = [] + for line in open(gff_file, 'r'): + if line.startswith('#'): + if header_line is None: + header_line = line + continue + items = line.split('\t') + attribute = items[8] + attributes = attribute.split(';') + name = attributes[0] + motif_id = name.split('=')[1] + file_name = os.path.join(collection_path, 'MOTIF%s.gff' % motif_id) + if motif_id in motif_ids: + i = motif_ids.index(motif_id) + fh = file_handles[i] + fh.write(line) + else: + fh = open(file_name, 'wb') + if header_line is not None: + fh.write(header_line) + fh.write(line) + motif_ids.append(motif_id) + file_handles.append(fh) + for file_handle in file_handles: + file_handle.close() +else: + shutil.move(gff_file, args.gff_output) +shutil.move(os.path.join(args.output_path, 'fimo.xml'), args.xml_output) +shutil.move(os.path.join(args.output_path, 'fimo.html'), args.html_output) + +out_file = open(args.interval_output, 'wb') +out_file.write("#%s\n" % "\t".join(("chr", "start", "end", "pattern name", "score", "strand", "matched sequence", "p-value", "q-value"))) +for line in open(args.txt_output): + if line.startswith('#'): + continue + fields = line.rstrip("\n\r").split("\t") + start, end = int(fields[2]), int(fields[3]) + sequence = fields[7] + if start > end: + # Flip start and end and set strand. + start, end = end, start + strand = "-" + # We want sequences relative to strand; FIMO always provides + stranded sequence. + sequence = dna_reverse_complement(sequence) + else: + strand = "+" + # Make 0-based start position. + start -= 1 + out_file.write("%s\n" % "\t".join([fields[1], str(start), str(end), fields[0], fields[4], strand, sequence, fields[5], fields[6]])) +out_file.close() diff -r 000000000000 -r a0fa4efeeee3 macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,11 @@ + + + 4.11.2 + + + graphicsmagick + meme + + + + diff -r 000000000000 -r a0fa4efeeee3 meme_psp_gen.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/meme_psp_gen.xml Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,140 @@ + + - perform discriminative motif discovery + + macros.xml + + + '$output_tabular' +#end if +> '$output_psp' + ]]> + + + +

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

+ + value == True + + + + + + adv['report_scores_cond']['report_scores'] == 'yes' + + + + + + + + + + + + + + + + +.. class:: warningmark + +**WARNING: This tool is only available for non-commercial use. Use for educational, research and non-profit purposes is permitted. +Before using, be sure to review, agree, and comply with the license.** + +psp-gen is used to allow MEME to perform discriminative motif discovery—to find motifs overrepresented in one set of sequences compared to in another set. +It takes two files as input—the sequence file to be input to MEME, (the "primary" file) and a "control" sequence file of sequences believed not to contain +the same motifs as in the "primary" file. psp-gen creates a file for use by MEME that encapsulates information about probable discriminative motifs. psp-gen +records its chosen motif width in the file, and MEME is able to adjust the data when it tries different motif widths. + +.. class:: infomark + +For detailed information on psp-gen, click here_, or view the license_. + +.. _here: http://meme-suite.org/doc/psp-gen.html?man_type=web +.. _license: http://meme-suite.org/doc/copyright.html?man_type=web + +----- + +**Required options** + +* **Primary sequence file** - a file containing FASTA formatted sequences which are to be used as the primary set in PSP calculation. +* **Control sequence file** - a file containing FASTA formatted sequences which are to be used as the control set in PSP calculation. + +**Additional options** + +* **Minimum width to use for position specific priors** - the minimum width to use with selecting the "best" width for PSPs. +* **Maximum width to use for position specific priors** - the maximum width to use with selecting the "best" width for PSPs. +* **Alphabet** - The alphabet to be used, one of DNA, protein or RNA. +* **Use spaced triples instead of whole-word matches** - use spaced triples instead of whole-word matches (recommended when using the protein alphabet). + + * **Allow triples to start anywhere within a site** - when using the -triples option, select 'Yes' to only consider triples starting at the start of the site or 'No' to allow triples to start anywhere in a width 'w' site. + +* **Match as equal sequences of letters that appear together** - select 'Yes' to match as equal any sequence of letter that appears together. Separate letter groups using "-" (e.g. -equiv "IVL-HKR") means treat all occurrences of I, V or L as the same, and all occurrences of H, K or R as the same. +* **Consider both strands when calculating position specific priors for alphabets** - select 'Yes' to consider both strands when calculating PSPs for complementable alphabets or 'No to consider only the given strand. +* **Set the lowest score value after scaling** - select 'Yes' to set the lowest score to 0.1 unless the the following "highest score" option is selected, in which case the lowest score is highest score - 1. +* **Set the highest score value after scaling** - select 'Yes' to set the highest score to 0.9 unless the previous "lowest score" option is selected, in which case the highest score is lowest score + 1. +* **Choose the width with the biggest difference between minimum and maximum scores before scaling** - select 'Yes' to choose the width with the biggest difference between minimum and maximum scores before scaling, or 'No' to choose the width with the biggest maximum score before scaling. +* **Output scores instead of priors** - select 'Yes' to output scores instead of position specific priors. +* **Output primary and control file names, scores and widths** - select 'Yes' to produce an additional tabular output consisting of control file names, lowest and highest scores and lowest and highest widths. + + * **Report frequency of each score** - select 'Yes' to include the frequency of each score in the output. + + + + 10.1186/1471-2105-11-179 + + diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_almost-gff_1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_almost-gff_1.txt Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,100 @@ +##gff-version 3 +phiX174 fimo polypeptide_motif 1388 1398 102 + . Name=1;ID=1-1-phiX174;pvalue=6.36e-11;qvalue= 1.25e-09;sequence=AATATCTATAA; +phiX174 fimo polypeptide_motif 847 857 102 + . Name=1;ID=1-2-phiX174;pvalue=7.02e-11;qvalue= 1.25e-09;sequence=AATGTCTAAAG; +phiX174 fimo polypeptide_motif 2301 2311 99.6 + . Name=1;ID=1-3-phiX174;pvalue=1.08e-10;qvalue= 1.29e-09;sequence=AGGTTATAACG; +phiX174 fimo polypeptide_motif 5063 5073 95.6 + . Name=1;ID=1-4-phiX174;pvalue=2.73e-10;qvalue= 2.25e-09;sequence=AGGAGCTAAAG; +phiX174 fimo polypeptide_motif 989 999 95 + . Name=1;ID=1-5-phiX174;pvalue=3.15e-10;qvalue= 2.25e-09;sequence=TGAGGATAAAT; +phiX174 fimo polypeptide_motif 4713 4723 91.1 + . Name=1;ID=1-6-phiX174;pvalue=7.74e-10;qvalue= 3.48e-09;sequence=GACTGCTATCA; +phiX174 fimo polypeptide_motif 5048 5058 90.7 + . Name=1;ID=1-7-phiX174;pvalue=8.51e-10;qvalue= 3.48e-09;sequence=TGCTGCTAAAG; +phiX174 fimo polypeptide_motif 855 865 90.6 + . Name=1;ID=1-8-phiX174;pvalue=8.64e-10;qvalue= 3.48e-09;sequence=AAGGTAAAAAA; +phiX174 fimo polypeptide_motif 3155 3165 90.1 + . Name=1;ID=1-9-phiX174;pvalue=9.76e-10;qvalue= 3.48e-09;sequence=TATGGCTAAAG; +phiX174 fimo polypeptide_motif 5009 5019 90.1 + . Name=1;ID=1-10-phiX174;pvalue=9.76e-10;qvalue= 3.48e-09;sequence=TGTGGCTAAAT; +phiX174 fimo polypeptide_motif 814 824 88.9 + . Name=1;ID=1-11-phiX174;pvalue=1.28e-09;qvalue= 4.14e-09;sequence=TGCGTCAAAAA; +phiX174 fimo polypeptide_motif 2832 2842 88.5 + . Name=1;ID=1-12-phiX174;pvalue=1.42e-09;qvalue= 4.23e-09;sequence=TTGGTCTAACT; +phiX174 fimo polypeptide_motif 3830 3840 87.7 + . Name=1;ID=1-13-phiX174;pvalue=1.7e-09;qvalue= 4.68e-09;sequence=TATTGATAAAG; +phiX174 fimo polypeptide_motif 3560 3570 87.2 + . Name=1;ID=1-14-phiX174;pvalue=1.89e-09;qvalue= 4.82e-09;sequence=TGCGTCTATTA; +phiX174 fimo polypeptide_motif 2882 2892 86.4 + . Name=1;ID=1-15-phiX174;pvalue=2.29e-09;qvalue= 5.46e-09;sequence=AGGTTATTAAA; +phiX174 fimo polypeptide_motif 4453 4463 85.9 + . Name=1;ID=1-16-phiX174;pvalue=2.58e-09;qvalue= 5.75e-09;sequence=AAGGTATTAAG; +phiX174 fimo polypeptide_motif 2493 2503 85.1 + . Name=1;ID=1-17-phiX174;pvalue=3.06e-09;qvalue= 5.79e-09;sequence=GACACCTAAAG; +phiX174 fimo polypeptide_motif 4104 4114 85.1 + . Name=1;ID=1-18-phiX174;pvalue=3.08e-09;qvalue= 5.79e-09;sequence=GGCTTCCATAA; +phiX174 fimo polypeptide_motif 4955 4965 85.1 + . Name=1;ID=1-19-phiX174;pvalue=3.08e-09;qvalue= 5.79e-09;sequence=TGATGCTAAAG; +phiX174 fimo polypeptide_motif 1885 1895 84.4 + . Name=1;ID=1-20-phiX174;pvalue=3.61e-09;qvalue= 6.45e-09;sequence=TGCGACTAAAG; +phiX174 fimo polypeptide_motif 3376 3386 84.2 + . Name=1;ID=1-21-phiX174;pvalue=3.81e-09;qvalue= 6.48e-09;sequence=AGAATCAAAAA; +phiX174 fimo polypeptide_motif 52 62 83.9 + . Name=1;ID=1-22-phiX174;pvalue=4.06e-09;qvalue= 6.58e-09;sequence=TGAGTCGAAAA; +phiX174 fimo polypeptide_motif 1390 1400 83.7 + . Name=1;ID=1-23-phiX174;pvalue=4.26e-09;qvalue= 6.61e-09;sequence=TATCTATAACA; +phiX174 fimo polypeptide_motif 2017 2027 83.4 + . Name=1;ID=1-24-phiX174;pvalue=4.6e-09;qvalue= 6.85e-09;sequence=TTCGTCTAAGA; +phiX174 fimo polypeptide_motif 1000 1010 83.1 + . Name=1;ID=1-25-phiX174;pvalue=4.88e-09;qvalue= 6.97e-09;sequence=TATGTCTAATA; +phiX174 fimo polypeptide_motif 1555 1565 82.5 + . Name=1;ID=1-26-phiX174;pvalue=5.58e-09;qvalue= 7.37e-09;sequence=GACTTCTACCA; +phiX174 fimo polypeptide_motif 4430 4440 82.5 + . Name=1;ID=1-27-phiX174;pvalue=5.62e-09;qvalue= 7.37e-09;sequence=TGAGTATAATT; +phiX174 fimo polypeptide_motif 1927 1937 82.3 + . Name=1;ID=1-28-phiX174;pvalue=5.82e-09;qvalue= 7.37e-09;sequence=GACTTATACCG; +phiX174 fimo polypeptide_motif 2981 2991 82.1 + . Name=1;ID=1-29-phiX174;pvalue=6.13e-09;qvalue= 7.37e-09;sequence=CATGTCTAAAT; +phiX174 fimo polypeptide_motif 4203 4213 82 + . Name=1;ID=1-30-phiX174;pvalue=6.34e-09;qvalue= 7.37e-09;sequence=GACGGCCATAA; +phiX174 fimo polypeptide_motif 1669 1679 81.9 + . Name=1;ID=1-31-phiX174;pvalue=6.4e-09;qvalue= 7.37e-09;sequence=TGGAGGTAAAA; +phiX174 fimo polypeptide_motif 3260 3270 81.5 + . Name=1;ID=1-32-phiX174;pvalue=7.01e-09;qvalue= 7.82e-09;sequence=CGCTGATAAAG; +phiX174 fimo polypeptide_motif 3047 3057 81.3 + . Name=1;ID=1-33-phiX174;pvalue=7.4e-09;qvalue= 7.85e-09;sequence=TACCGATAACA; +phiX174 fimo polypeptide_motif 4176 4186 81.2 + . Name=1;ID=1-34-phiX174;pvalue=7.6e-09;qvalue= 7.85e-09;sequence=GAGTTCGATAA; +phiX174 fimo polypeptide_motif 4118 4128 81.1 + . Name=1;ID=1-35-phiX174;pvalue=7.7e-09;qvalue= 7.85e-09;sequence=GATGGATAACC; +phiX174 fimo polypeptide_motif 5370 5380 80.9 + . Name=1;ID=1-36-phiX174;pvalue=8.03e-09;qvalue= 7.87e-09;sequence=GGCGTATCCAA; +phiX174 fimo polypeptide_motif 1242 1252 80.5 + . Name=1;ID=1-37-phiX174;pvalue=8.94e-09;qvalue= 7.87e-09;sequence=AGTGGATTAAG; +phiX174 fimo polypeptide_motif 2583 2593 80.5 + . Name=1;ID=1-38-phiX174;pvalue=8.94e-09;qvalue= 7.87e-09;sequence=TACATCTGTCA; +phiX174 fimo polypeptide_motif 698 708 80.4 + . Name=1;ID=1-39-phiX174;pvalue=9.13e-09;qvalue= 7.87e-09;sequence=TACGGAAAACA; +phiX174 fimo polypeptide_motif 2299 2309 80.3 + . Name=1;ID=1-40-phiX174;pvalue=9.26e-09;qvalue= 7.87e-09;sequence=TGAGGTTATAA; +phiX174 fimo polypeptide_motif 4189 4199 80.1 + . Name=1;ID=1-41-phiX174;pvalue=9.69e-09;qvalue= 7.87e-09;sequence=GTGATATGTAT; +phiX174 fimo polypeptide_motif 275 285 80.1 + . Name=1;ID=1-42-phiX174;pvalue=9.85e-09;qvalue= 7.87e-09;sequence=GGTTTAGATAT; +phiX174 fimo polypeptide_motif 1801 1811 80 + . Name=1;ID=1-43-phiX174;pvalue=1e-08;qvalue= 7.87e-09;sequence=GACCTATAAAC; +phiX174 fimo polypeptide_motif 1386 1396 79.9 + . Name=1;ID=1-44-phiX174;pvalue=1.03e-08;qvalue= 7.87e-09;sequence=TGAATATCTAT; +phiX174 fimo polypeptide_motif 1303 1313 79.8 + . Name=1;ID=1-45-phiX174;pvalue=1.03e-08;qvalue= 7.87e-09;sequence=TGGTTATATTG; +phiX174 fimo polypeptide_motif 3772 3782 79.8 + . Name=1;ID=1-46-phiX174;pvalue=1.04e-08;qvalue= 7.87e-09;sequence=AGGATATTTCT; +phiX174 fimo polypeptide_motif 1288 1298 79.8 + . Name=1;ID=1-47-phiX174;pvalue=1.04e-08;qvalue= 7.87e-09;sequence=GACTGTTAACA; +phiX174 fimo polypeptide_motif 2577 2587 79.7 + . Name=1;ID=1-48-phiX174;pvalue=1.08e-08;qvalue= 7.87e-09;sequence=GATGGATACAT; +phiX174 fimo polypeptide_motif 937 947 79.6 + . Name=1;ID=1-49-phiX174;pvalue=1.08e-08;qvalue= 7.87e-09;sequence=TTGGTATGTAG; +phiX174 fimo polypeptide_motif 904 914 79.5 + . Name=1;ID=1-50-phiX174;pvalue=1.11e-08;qvalue= 7.93e-09;sequence=AGGTACTAAAG; +phiX174 fimo polypeptide_motif 2279 2289 79.4 + . Name=1;ID=1-51-phiX174;pvalue=1.13e-08;qvalue= 7.93e-09;sequence=TCGTGATAAAA; +phiX174 fimo polypeptide_motif 3164 3174 79.3 + . Name=1;ID=1-52-phiX174;pvalue=1.16e-08;qvalue= 7.98e-09;sequence=AGCTGGTAAAG; +phiX174 fimo polypeptide_motif 24 34 79.1 + . Name=1;ID=1-53-phiX174;pvalue=1.23e-08;qvalue= 8.24e-09;sequence=AGAAGTTAACA; +phiX174 fimo polypeptide_motif 838 848 78.9 + . Name=1;ID=1-54-phiX174;pvalue=1.27e-08;qvalue= 8.24e-09;sequence=GAGTGATGTAA; +phiX174 fimo polypeptide_motif 853 863 78.9 + . Name=1;ID=1-55-phiX174;pvalue=1.27e-08;qvalue= 8.24e-09;sequence=TAAAGGTAAAA; +phiX174 fimo polypeptide_motif 1984 1994 78.6 + . Name=1;ID=1-56-phiX174;pvalue=1.36e-08;qvalue= 8.68e-09;sequence=AATTTCTATGA; +phiX174 fimo polypeptide_motif 1 11 78.3 + . Name=1;ID=1-57-phiX174;pvalue=1.46e-08;qvalue= 9.05e-09;sequence=GAGTTTTATCG; +phiX174 fimo polypeptide_motif 4307 4317 78.3 + . Name=1;ID=1-58-phiX174;pvalue=1.47e-08;qvalue= 9.05e-09;sequence=TATTAATAACA; +phiX174 fimo polypeptide_motif 4303 4313 78.2 + . Name=1;ID=1-59-phiX174;pvalue=1.52e-08;qvalue= 9.19e-09;sequence=TTGATATTAAT; +phiX174 fimo polypeptide_motif 5033 5043 78 + . Name=1;ID=1-60-phiX174;pvalue=1.58e-08;qvalue= 9.41e-09;sequence=GTCAGATATGG; +phiX174 fimo polypeptide_motif 2579 2589 77.6 + . Name=1;ID=1-61-phiX174;pvalue=1.73e-08;qvalue= 1.01e-08;sequence=TGGATACATCT; +phiX174 fimo polypeptide_motif 322 332 77.4 + . Name=1;ID=1-62-phiX174;pvalue=1.82e-08;qvalue= 1.05e-08;sequence=GACATTTTAAA; +phiX174 fimo polypeptide_motif 5001 5011 76.8 + . Name=1;ID=1-63-phiX174;pvalue=2.09e-08;qvalue= 1.19e-08;sequence=GGTTTCTATGT; +phiX174 fimo polypeptide_motif 4217 4227 76.7 + . Name=1;ID=1-64-phiX174;pvalue=2.15e-08;qvalue= 1.2e-08;sequence=TGCTTCTGACG; +phiX174 fimo polypeptide_motif 4262 4272 76.6 + . Name=1;ID=1-65-phiX174;pvalue=2.18e-08;qvalue= 1.2e-08;sequence=AATGGATGAAT; +phiX174 fimo polypeptide_motif 3569 3579 76.5 + . Name=1;ID=1-66-phiX174;pvalue=2.26e-08;qvalue= 1.22e-08;sequence=TATGGAAAACA; +phiX174 fimo polypeptide_motif 194 204 76.4 + . Name=1;ID=1-67-phiX174;pvalue=2.29e-08;qvalue= 1.22e-08;sequence=ATCAACTAACG; +phiX174 fimo polypeptide_motif 131 141 76 + . Name=1;ID=1-68-phiX174;pvalue=2.49e-08;qvalue= 1.31e-08;sequence=AAATGAGAAAA; +phiX174 fimo polypeptide_motif 1491 1501 75.9 + . Name=1;ID=1-69-phiX174;pvalue=2.55e-08;qvalue= 1.32e-08;sequence=GCCATCTCAAA; +phiX174 fimo polypeptide_motif 434 444 75.7 + . Name=1;ID=1-70-phiX174;pvalue=2.67e-08;qvalue= 1.36e-08;sequence=GGCCTCTATTA; +phiX174 fimo polypeptide_motif 4565 4575 75.6 + . Name=1;ID=1-71-phiX174;pvalue=2.73e-08;qvalue= 1.36e-08;sequence=TTGGTTTATCG; +phiX174 fimo polypeptide_motif 102 112 75.6 + . Name=1;ID=1-72-phiX174;pvalue=2.75e-08;qvalue= 1.36e-08;sequence=GAATTAAATCG; +phiX174 fimo polypeptide_motif 903 913 75.5 + . Name=1;ID=1-73-phiX174;pvalue=2.82e-08;qvalue= 1.38e-08;sequence=GAGGTACTAAA; +phiX174 fimo polypeptide_motif 4748 4758 75.2 + . Name=1;ID=1-74-phiX174;pvalue=3.01e-08;qvalue= 1.45e-08;sequence=TACAGCTAATG; +phiX174 fimo polypeptide_motif 2622 2632 75 + . Name=1;ID=1-75-phiX174;pvalue=3.16e-08;qvalue= 1.5e-08;sequence=TGCTGATATTG; +phiX174 fimo polypeptide_motif 467 477 74.7 + . Name=1;ID=1-76-phiX174;pvalue=3.35e-08;qvalue= 1.57e-08;sequence=TTTGGATTTAA; +phiX174 fimo polypeptide_motif 4033 4043 74.6 + . Name=1;ID=1-77-phiX174;pvalue=3.44e-08;qvalue= 1.58e-08;sequence=AGCGTATCGAG; +phiX174 fimo polypeptide_motif 1348 1358 74.6 + . Name=1;ID=1-78-phiX174;pvalue=3.46e-08;qvalue= 1.58e-08;sequence=TACCAATAAAA; +phiX174 fimo polypeptide_motif 239 249 74.4 + . Name=1;ID=1-79-phiX174;pvalue=3.62e-08;qvalue= 1.64e-08;sequence=AGTGGCTTAAT; +phiX174 fimo polypeptide_motif 500 510 74.1 + . Name=1;ID=1-80-phiX174;pvalue=3.84e-08;qvalue= 1.71e-08;sequence=GACGAGTAACA; +phiX174 fimo polypeptide_motif 3001 3011 74 + . Name=1;ID=1-81-phiX174;pvalue=3.93e-08;qvalue= 1.73e-08;sequence=GCGGTCAAAAA; +phiX174 fimo polypeptide_motif 3776 3786 74 + . Name=1;ID=1-82-phiX174;pvalue=3.98e-08;qvalue= 1.73e-08;sequence=TATTTCTAATG; +phiX174 fimo polypeptide_motif 2026 2036 73.9 + . Name=1;ID=1-83-phiX174;pvalue=4.06e-08;qvalue= 1.75e-08;sequence=GAAGTTTAAGA; +phiX174 fimo polypeptide_motif 4237 4247 73.8 + . Name=1;ID=1-84-phiX174;pvalue=4.12e-08;qvalue= 1.75e-08;sequence=AGTTTGTATCT; +phiX174 fimo polypeptide_motif 803 813 73.7 + . Name=1;ID=1-85-phiX174;pvalue=4.24e-08;qvalue= 1.78e-08;sequence=AGAAGAAAACG; +phiX174 fimo polypeptide_motif 3770 3780 73.6 + . Name=1;ID=1-86-phiX174;pvalue=4.35e-08;qvalue= 1.81e-08;sequence=AAAGGATATTT; +phiX174 fimo polypeptide_motif 3429 3439 73.5 + . Name=1;ID=1-87-phiX174;pvalue=4.45e-08;qvalue= 1.82e-08;sequence=GAGATGCAAAA; +phiX174 fimo polypeptide_motif 99 109 73.5 + . Name=1;ID=1-88-phiX174;pvalue=4.48e-08;qvalue= 1.82e-08;sequence=TACGAATTAAA; +phiX174 fimo polypeptide_motif 67 77 73.2 + . Name=1;ID=1-89-phiX174;pvalue=4.78e-08;qvalue= 1.92e-08;sequence=TCTTGATAAAG; +phiX174 fimo polypeptide_motif 5332 5342 72.9 + . Name=1;ID=1-90-phiX174;pvalue=5.13e-08;qvalue= 2.01e-08;sequence=ATCTGCTCAAA; +phiX174 fimo polypeptide_motif 277 287 72.9 + . Name=1;ID=1-91-phiX174;pvalue=5.14e-08;qvalue= 2.01e-08;sequence=TTTAGATATGA; +phiX174 fimo polypeptide_motif 4338 4348 72.8 + . Name=1;ID=1-92-phiX174;pvalue=5.18e-08;qvalue= 2.01e-08;sequence=GGGGACGAAAA; +phiX174 fimo polypeptide_motif 3812 3822 72.8 + . Name=1;ID=1-93-phiX174;pvalue=5.28e-08;qvalue= 2.03e-08;sequence=GGTTGATATTT; +phiX174 fimo polypeptide_motif 1909 1919 72.6 + . Name=1;ID=1-94-phiX174;pvalue=5.51e-08;qvalue= 2.08e-08;sequence=TAACGCTAAAG; +phiX174 fimo polypeptide_motif 3000 3010 72.6 + . Name=1;ID=1-95-phiX174;pvalue=5.54e-08;qvalue= 2.08e-08;sequence=GGCGGTCAAAA; +phiX174 fimo polypeptide_motif 3891 3901 72.4 + . Name=1;ID=1-96-phiX174;pvalue=5.75e-08;qvalue= 2.11e-08;sequence=ATTGGCTCTAA; +phiX174 fimo polypeptide_motif 3079 3089 72.4 + . Name=1;ID=1-97-phiX174;pvalue=5.76e-08;qvalue= 2.11e-08;sequence=CTGGTATTAAA; +phiX174 fimo polypeptide_motif 37 47 72.4 + . Name=1;ID=1-98-phiX174;pvalue=5.79e-08;qvalue= 2.11e-08;sequence=TTCGGATATTT; +phiX174 fimo polypeptide_motif 380 390 72.2 + . Name=1;ID=1-99-phiX174;pvalue=6.01e-08;qvalue= 2.17e-08;sequence=GTAAGAAATCA; diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_almost-gff_2.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_almost-gff_2.txt Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,100 @@ +##gff-version 3 +phiX174 fimo polypeptide_motif 1388 1398 102 + . Name=1;ID=1-1-phiX174;pvalue=6.36e-11;sequence=AATATCTATAA; +phiX174 fimo polypeptide_motif 847 857 102 + . Name=1;ID=1-2-phiX174;pvalue=7.02e-11;sequence=AATGTCTAAAG; +phiX174 fimo polypeptide_motif 2301 2311 99.6 + . Name=1;ID=1-3-phiX174;pvalue=1.08e-10;sequence=AGGTTATAACG; +phiX174 fimo polypeptide_motif 5063 5073 95.6 + . Name=1;ID=1-4-phiX174;pvalue=2.73e-10;sequence=AGGAGCTAAAG; +phiX174 fimo polypeptide_motif 989 999 95 + . Name=1;ID=1-5-phiX174;pvalue=3.15e-10;sequence=TGAGGATAAAT; +phiX174 fimo polypeptide_motif 4713 4723 91.1 + . Name=1;ID=1-6-phiX174;pvalue=7.74e-10;sequence=GACTGCTATCA; +phiX174 fimo polypeptide_motif 5048 5058 90.7 + . Name=1;ID=1-7-phiX174;pvalue=8.51e-10;sequence=TGCTGCTAAAG; +phiX174 fimo polypeptide_motif 855 865 90.6 + . Name=1;ID=1-8-phiX174;pvalue=8.64e-10;sequence=AAGGTAAAAAA; +phiX174 fimo polypeptide_motif 3155 3165 90.1 + . Name=1;ID=1-9-phiX174;pvalue=9.76e-10;sequence=TATGGCTAAAG; +phiX174 fimo polypeptide_motif 5009 5019 90.1 + . Name=1;ID=1-10-phiX174;pvalue=9.76e-10;sequence=TGTGGCTAAAT; +phiX174 fimo polypeptide_motif 814 824 88.9 + . Name=1;ID=1-11-phiX174;pvalue=1.28e-09;sequence=TGCGTCAAAAA; +phiX174 fimo polypeptide_motif 2832 2842 88.5 + . Name=1;ID=1-12-phiX174;pvalue=1.42e-09;sequence=TTGGTCTAACT; +phiX174 fimo polypeptide_motif 3830 3840 87.7 + . Name=1;ID=1-13-phiX174;pvalue=1.7e-09;sequence=TATTGATAAAG; +phiX174 fimo polypeptide_motif 3560 3570 87.2 + . Name=1;ID=1-14-phiX174;pvalue=1.89e-09;sequence=TGCGTCTATTA; +phiX174 fimo polypeptide_motif 2882 2892 86.4 + . Name=1;ID=1-15-phiX174;pvalue=2.29e-09;sequence=AGGTTATTAAA; +phiX174 fimo polypeptide_motif 4453 4463 85.9 + . Name=1;ID=1-16-phiX174;pvalue=2.58e-09;sequence=AAGGTATTAAG; +phiX174 fimo polypeptide_motif 2493 2503 85.1 + . Name=1;ID=1-17-phiX174;pvalue=3.06e-09;sequence=GACACCTAAAG; +phiX174 fimo polypeptide_motif 4104 4114 85.1 + . Name=1;ID=1-18-phiX174;pvalue=3.08e-09;sequence=GGCTTCCATAA; +phiX174 fimo polypeptide_motif 4955 4965 85.1 + . Name=1;ID=1-19-phiX174;pvalue=3.08e-09;sequence=TGATGCTAAAG; +phiX174 fimo polypeptide_motif 1885 1895 84.4 + . Name=1;ID=1-20-phiX174;pvalue=3.61e-09;sequence=TGCGACTAAAG; +phiX174 fimo polypeptide_motif 3376 3386 84.2 + . Name=1;ID=1-21-phiX174;pvalue=3.81e-09;sequence=AGAATCAAAAA; +phiX174 fimo polypeptide_motif 52 62 83.9 + . Name=1;ID=1-22-phiX174;pvalue=4.06e-09;sequence=TGAGTCGAAAA; +phiX174 fimo polypeptide_motif 1390 1400 83.7 + . Name=1;ID=1-23-phiX174;pvalue=4.26e-09;sequence=TATCTATAACA; +phiX174 fimo polypeptide_motif 2017 2027 83.4 + . Name=1;ID=1-24-phiX174;pvalue=4.6e-09;sequence=TTCGTCTAAGA; +phiX174 fimo polypeptide_motif 1000 1010 83.1 + . Name=1;ID=1-25-phiX174;pvalue=4.88e-09;sequence=TATGTCTAATA; +phiX174 fimo polypeptide_motif 1555 1565 82.5 + . Name=1;ID=1-26-phiX174;pvalue=5.58e-09;sequence=GACTTCTACCA; +phiX174 fimo polypeptide_motif 4430 4440 82.5 + . Name=1;ID=1-27-phiX174;pvalue=5.62e-09;sequence=TGAGTATAATT; +phiX174 fimo polypeptide_motif 1927 1937 82.3 + . Name=1;ID=1-28-phiX174;pvalue=5.82e-09;sequence=GACTTATACCG; +phiX174 fimo polypeptide_motif 2981 2991 82.1 + . Name=1;ID=1-29-phiX174;pvalue=6.13e-09;sequence=CATGTCTAAAT; +phiX174 fimo polypeptide_motif 4203 4213 82 + . Name=1;ID=1-30-phiX174;pvalue=6.34e-09;sequence=GACGGCCATAA; +phiX174 fimo polypeptide_motif 1669 1679 81.9 + . Name=1;ID=1-31-phiX174;pvalue=6.4e-09;sequence=TGGAGGTAAAA; +phiX174 fimo polypeptide_motif 3260 3270 81.5 + . Name=1;ID=1-32-phiX174;pvalue=7.01e-09;sequence=CGCTGATAAAG; +phiX174 fimo polypeptide_motif 3047 3057 81.3 + . Name=1;ID=1-33-phiX174;pvalue=7.4e-09;sequence=TACCGATAACA; +phiX174 fimo polypeptide_motif 4176 4186 81.2 + . Name=1;ID=1-34-phiX174;pvalue=7.6e-09;sequence=GAGTTCGATAA; +phiX174 fimo polypeptide_motif 4118 4128 81.1 + . Name=1;ID=1-35-phiX174;pvalue=7.7e-09;sequence=GATGGATAACC; +phiX174 fimo polypeptide_motif 5370 5380 80.9 + . Name=1;ID=1-36-phiX174;pvalue=8.03e-09;sequence=GGCGTATCCAA; +phiX174 fimo polypeptide_motif 1242 1252 80.5 + . Name=1;ID=1-37-phiX174;pvalue=8.94e-09;sequence=AGTGGATTAAG; +phiX174 fimo polypeptide_motif 2583 2593 80.5 + . Name=1;ID=1-38-phiX174;pvalue=8.94e-09;sequence=TACATCTGTCA; +phiX174 fimo polypeptide_motif 698 708 80.4 + . Name=1;ID=1-39-phiX174;pvalue=9.13e-09;sequence=TACGGAAAACA; +phiX174 fimo polypeptide_motif 2299 2309 80.3 + . Name=1;ID=1-40-phiX174;pvalue=9.26e-09;sequence=TGAGGTTATAA; +phiX174 fimo polypeptide_motif 4189 4199 80.1 + . Name=1;ID=1-41-phiX174;pvalue=9.69e-09;sequence=GTGATATGTAT; +phiX174 fimo polypeptide_motif 275 285 80.1 + . Name=1;ID=1-42-phiX174;pvalue=9.85e-09;sequence=GGTTTAGATAT; +phiX174 fimo polypeptide_motif 1801 1811 80 + . Name=1;ID=1-43-phiX174;pvalue=1e-08;sequence=GACCTATAAAC; +phiX174 fimo polypeptide_motif 1386 1396 79.9 + . Name=1;ID=1-44-phiX174;pvalue=1.03e-08;sequence=TGAATATCTAT; +phiX174 fimo polypeptide_motif 1303 1313 79.8 + . Name=1;ID=1-45-phiX174;pvalue=1.03e-08;sequence=TGGTTATATTG; +phiX174 fimo polypeptide_motif 3772 3782 79.8 + . Name=1;ID=1-46-phiX174;pvalue=1.04e-08;sequence=AGGATATTTCT; +phiX174 fimo polypeptide_motif 1288 1298 79.8 + . Name=1;ID=1-47-phiX174;pvalue=1.04e-08;sequence=GACTGTTAACA; +phiX174 fimo polypeptide_motif 2577 2587 79.7 + . Name=1;ID=1-48-phiX174;pvalue=1.08e-08;sequence=GATGGATACAT; +phiX174 fimo polypeptide_motif 937 947 79.6 + . Name=1;ID=1-49-phiX174;pvalue=1.08e-08;sequence=TTGGTATGTAG; +phiX174 fimo polypeptide_motif 904 914 79.5 + . Name=1;ID=1-50-phiX174;pvalue=1.11e-08;sequence=AGGTACTAAAG; +phiX174 fimo polypeptide_motif 2279 2289 79.4 + . Name=1;ID=1-51-phiX174;pvalue=1.13e-08;sequence=TCGTGATAAAA; +phiX174 fimo polypeptide_motif 3164 3174 79.3 + . Name=1;ID=1-52-phiX174;pvalue=1.16e-08;sequence=AGCTGGTAAAG; +phiX174 fimo polypeptide_motif 24 34 79.1 + . Name=1;ID=1-53-phiX174;pvalue=1.23e-08;sequence=AGAAGTTAACA; +phiX174 fimo polypeptide_motif 838 848 78.9 + . Name=1;ID=1-54-phiX174;pvalue=1.27e-08;sequence=GAGTGATGTAA; +phiX174 fimo polypeptide_motif 853 863 78.9 + . Name=1;ID=1-55-phiX174;pvalue=1.27e-08;sequence=TAAAGGTAAAA; +phiX174 fimo polypeptide_motif 1984 1994 78.6 + . Name=1;ID=1-56-phiX174;pvalue=1.36e-08;sequence=AATTTCTATGA; +phiX174 fimo polypeptide_motif 1 11 78.3 + . Name=1;ID=1-57-phiX174;pvalue=1.46e-08;sequence=GAGTTTTATCG; +phiX174 fimo polypeptide_motif 4307 4317 78.3 + . Name=1;ID=1-58-phiX174;pvalue=1.47e-08;sequence=TATTAATAACA; +phiX174 fimo polypeptide_motif 4303 4313 78.2 + . Name=1;ID=1-59-phiX174;pvalue=1.52e-08;sequence=TTGATATTAAT; +phiX174 fimo polypeptide_motif 5033 5043 78 + . Name=1;ID=1-60-phiX174;pvalue=1.58e-08;sequence=GTCAGATATGG; +phiX174 fimo polypeptide_motif 2579 2589 77.6 + . Name=1;ID=1-61-phiX174;pvalue=1.73e-08;sequence=TGGATACATCT; +phiX174 fimo polypeptide_motif 322 332 77.4 + . Name=1;ID=1-62-phiX174;pvalue=1.82e-08;sequence=GACATTTTAAA; +phiX174 fimo polypeptide_motif 5001 5011 76.8 + . Name=1;ID=1-63-phiX174;pvalue=2.09e-08;sequence=GGTTTCTATGT; +phiX174 fimo polypeptide_motif 4217 4227 76.7 + . Name=1;ID=1-64-phiX174;pvalue=2.15e-08;sequence=TGCTTCTGACG; +phiX174 fimo polypeptide_motif 4262 4272 76.6 + . Name=1;ID=1-65-phiX174;pvalue=2.18e-08;sequence=AATGGATGAAT; +phiX174 fimo polypeptide_motif 3569 3579 76.5 + . Name=1;ID=1-66-phiX174;pvalue=2.26e-08;sequence=TATGGAAAACA; +phiX174 fimo polypeptide_motif 194 204 76.4 + . Name=1;ID=1-67-phiX174;pvalue=2.29e-08;sequence=ATCAACTAACG; +phiX174 fimo polypeptide_motif 131 141 76 + . Name=1;ID=1-68-phiX174;pvalue=2.49e-08;sequence=AAATGAGAAAA; +phiX174 fimo polypeptide_motif 1491 1501 75.9 + . Name=1;ID=1-69-phiX174;pvalue=2.55e-08;sequence=GCCATCTCAAA; +phiX174 fimo polypeptide_motif 434 444 75.7 + . Name=1;ID=1-70-phiX174;pvalue=2.67e-08;sequence=GGCCTCTATTA; +phiX174 fimo polypeptide_motif 4565 4575 75.6 + . Name=1;ID=1-71-phiX174;pvalue=2.73e-08;sequence=TTGGTTTATCG; +phiX174 fimo polypeptide_motif 102 112 75.6 + . Name=1;ID=1-72-phiX174;pvalue=2.75e-08;sequence=GAATTAAATCG; +phiX174 fimo polypeptide_motif 903 913 75.5 + . Name=1;ID=1-73-phiX174;pvalue=2.82e-08;sequence=GAGGTACTAAA; +phiX174 fimo polypeptide_motif 4748 4758 75.2 + . Name=1;ID=1-74-phiX174;pvalue=3.01e-08;sequence=TACAGCTAATG; +phiX174 fimo polypeptide_motif 2622 2632 75 + . Name=1;ID=1-75-phiX174;pvalue=3.16e-08;sequence=TGCTGATATTG; +phiX174 fimo polypeptide_motif 467 477 74.7 + . Name=1;ID=1-76-phiX174;pvalue=3.35e-08;sequence=TTTGGATTTAA; +phiX174 fimo polypeptide_motif 4033 4043 74.6 + . Name=1;ID=1-77-phiX174;pvalue=3.44e-08;sequence=AGCGTATCGAG; +phiX174 fimo polypeptide_motif 1348 1358 74.6 + . Name=1;ID=1-78-phiX174;pvalue=3.46e-08;sequence=TACCAATAAAA; +phiX174 fimo polypeptide_motif 239 249 74.4 + . Name=1;ID=1-79-phiX174;pvalue=3.62e-08;sequence=AGTGGCTTAAT; +phiX174 fimo polypeptide_motif 500 510 74.1 + . Name=1;ID=1-80-phiX174;pvalue=3.84e-08;sequence=GACGAGTAACA; +phiX174 fimo polypeptide_motif 3001 3011 74 + . Name=1;ID=1-81-phiX174;pvalue=3.93e-08;sequence=GCGGTCAAAAA; +phiX174 fimo polypeptide_motif 3776 3786 74 + . Name=1;ID=1-82-phiX174;pvalue=3.98e-08;sequence=TATTTCTAATG; +phiX174 fimo polypeptide_motif 2026 2036 73.9 + . Name=1;ID=1-83-phiX174;pvalue=4.06e-08;sequence=GAAGTTTAAGA; +phiX174 fimo polypeptide_motif 4237 4247 73.8 + . Name=1;ID=1-84-phiX174;pvalue=4.12e-08;sequence=AGTTTGTATCT; +phiX174 fimo polypeptide_motif 803 813 73.7 + . Name=1;ID=1-85-phiX174;pvalue=4.24e-08;sequence=AGAAGAAAACG; +phiX174 fimo polypeptide_motif 3770 3780 73.6 + . Name=1;ID=1-86-phiX174;pvalue=4.35e-08;sequence=AAAGGATATTT; +phiX174 fimo polypeptide_motif 3429 3439 73.5 + . Name=1;ID=1-87-phiX174;pvalue=4.45e-08;sequence=GAGATGCAAAA; +phiX174 fimo polypeptide_motif 99 109 73.5 + . Name=1;ID=1-88-phiX174;pvalue=4.48e-08;sequence=TACGAATTAAA; +phiX174 fimo polypeptide_motif 67 77 73.2 + . Name=1;ID=1-89-phiX174;pvalue=4.78e-08;sequence=TCTTGATAAAG; +phiX174 fimo polypeptide_motif 5332 5342 72.9 + . Name=1;ID=1-90-phiX174;pvalue=5.13e-08;sequence=ATCTGCTCAAA; +phiX174 fimo polypeptide_motif 277 287 72.9 + . Name=1;ID=1-91-phiX174;pvalue=5.14e-08;sequence=TTTAGATATGA; +phiX174 fimo polypeptide_motif 4338 4348 72.8 + . Name=1;ID=1-92-phiX174;pvalue=5.18e-08;sequence=GGGGACGAAAA; +phiX174 fimo polypeptide_motif 3812 3822 72.8 + . Name=1;ID=1-93-phiX174;pvalue=5.28e-08;sequence=GGTTGATATTT; +phiX174 fimo polypeptide_motif 1909 1919 72.6 + . Name=1;ID=1-94-phiX174;pvalue=5.51e-08;sequence=TAACGCTAAAG; +phiX174 fimo polypeptide_motif 3000 3010 72.6 + . Name=1;ID=1-95-phiX174;pvalue=5.54e-08;sequence=GGCGGTCAAAA; +phiX174 fimo polypeptide_motif 3891 3901 72.4 + . Name=1;ID=1-96-phiX174;pvalue=5.75e-08;sequence=ATTGGCTCTAA; +phiX174 fimo polypeptide_motif 3079 3089 72.4 + . Name=1;ID=1-97-phiX174;pvalue=5.76e-08;sequence=CTGGTATTAAA; +phiX174 fimo polypeptide_motif 37 47 72.4 + . Name=1;ID=1-98-phiX174;pvalue=5.79e-08;sequence=TTCGGATATTT; +phiX174 fimo polypeptide_motif 380 390 72.2 + . Name=1;ID=1-99-phiX174;pvalue=6.01e-08;sequence=GTAAGAAATCA; diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_html_1.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_html_1.html Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,97 @@ + + + + + +FIMO Results + + + + +

+ + + + + + +

Database and Motifs

High-scoring Motif Occurences

Debugging Information

+
+
+

+FIMO - Motif search tool +

+For further information on how to interpret these results +or to get a copy of the FIMO software please access +http://meme.nbcr.net

If you use FIMO in your research, please cite the following paper:
+Charles E. Grant, Timothy L. Bailey, and William Stafford Noble, +"FIMO: Scanning for occurrences of a given motif", +Bioinformatics, 27(7):1017-1018, 2011. +[full text]

+DATABASE AND MOTIFS +

+
+  

+  Database contains 1 sequences, 5386 residues
+

+
+  
+    
+      
+        
+        
+        
+      
+    
+    
+      
+        
+        
+        
+       
+    
+  MOTIFWIDTH
+         BEST POSSIBLE MATCH
+        
111GGGGTATAAAA

+

+
+Random model letter frequencies (from non-redundant database):
+

+
+A 0.073 C 0.018 D 0.052 E 0.062 F 0.040 G 0.069 H 0.022 I 0.056 K 0.058 
+L 0.092 M 0.023 N 0.046 P 0.051 Q 0.041 R 0.052 S 0.074 T 0.059 V 0.064 
+W 0.013 Y 0.033 

+

MOTIF	WIDTH	+ BEST POSSIBLE MATCH +
1	11	GGGGTATAAAA

+SECTION I: HIGH-SCORING MOTIF OCCURENCES +

+There were 1937 motif occurences with a p-value less than 0.0001. +Only the most significant 1000 matches are shown here. + +The full set of motif occurences can be seen in the +tab-delimited plain text output file +fimo.txt, +the GFF file +fimo.gff +which may be suitable for uploading to the +UCSC Genome Table Browser +(assuming the FASTA input sequences included genomic coordinates in UCSC or Galaxy format), +or the XML file +fimo.xml. +
+The p-value of a motif occurrence is defined as the +probability of a random sequence of the same length as the motif +matching that position of the sequence with as good or better a score. +
+The score for the match of a position in a sequence to a motif diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_html_2.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_html_2.html Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,97 @@ + + + + + +FIMO Results + + + + +
+ + + + + + +
Database and Motifs High-scoring Motif Occurences Debugging Information
+
+
+
+FIMO - Motif search tool +
+
+For further information on how to interpret these results +or to get a copy of the FIMO software please access +http://meme.nbcr.net
+
If you use FIMO in your research, please cite the following paper:
+Charles E. Grant, Timothy L. Bailey, and William Stafford Noble, +"FIMO: Scanning for occurrences of a given motif", +Bioinformatics, 27(7):1017-1018, 2011. +[full text]
+
+DATABASE AND MOTIFS +
+
+
+
+ Database contains 1 sequences, 5386 residues +
+
+ + + + + + + + + + + + + + + +
MOTIF WIDTH + BEST POSSIBLE MATCH +
1 11 GGGGTATAAAA
+
+
+Random model letter frequencies (from non-redundant database): +
+ +A 0.073 C 0.018 D 0.052 E 0.062 F 0.040 G 0.069 H 0.022 I 0.056 K 0.058 +L 0.092 M 0.023 N 0.046 P 0.051 Q 0.041 R 0.052 S 0.074 T 0.059 V 0.064 +W 0.013 Y 0.033
+
+
+SECTION I: HIGH-SCORING MOTIF OCCURENCES +
+
- +There were 1937 motif occurences with a p-value less than 0.0001. +Only the most significant 1000 matches are shown here. + +The full set of motif occurences can be seen in the +tab-delimited plain text output file +fimo.txt, +the GFF file +fimo.gff +which may be suitable for uploading to the +UCSC Genome Table Browser +(assuming the FASTA input sequences included genomic coordinates in UCSC or Galaxy format), +or the XML file +fimo.xml. +
- +The p-value of a motif occurrence is defined as the +probability of a random sequence of the same length as the motif +matching that position of the sequence with as good or better a score. +
- +The score for the match of a position in a sequence to a motif diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_interval_1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_interval_1.txt Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,100 @@ +#chr start end pattern name score strand matched sequence p-value q-value +phiX174 1387 1398 1 + + 1.25e-09 29.4024 6.36e-11 +phiX174 846 857 1 + + 1.25e-09 29.122 7.02e-11 +phiX174 2300 2311 1 + + 1.29e-09 27.6463 1.08e-10 +phiX174 5062 5073 1 + + 2.25e-09 25.5366 2.73e-10 +phiX174 988 999 1 + + 2.25e-09 25.3049 3.15e-10 +phiX174 4712 4723 1 + + 3.48e-09 23.622 7.74e-10 +phiX174 5047 5058 1 + + 3.48e-09 23.3293 8.51e-10 +phiX174 854 865 1 + + 3.48e-09 23.3049 8.64e-10 +phiX174 3154 3165 1 + + 3.48e-09 23.0366 9.76e-10 +phiX174 5008 5019 1 + + 3.48e-09 23.0366 9.76e-10 +phiX174 813 824 1 + + 4.14e-09 22.5854 1.28e-09 +phiX174 2831 2842 1 + + 4.23e-09 22.3415 1.42e-09 +phiX174 3829 3840 1 + + 4.68e-09 21.8293 1.7e-09 +phiX174 3559 3570 1 + + 4.82e-09 21.5976 1.89e-09 +phiX174 2881 2892 1 + + 5.46e-09 21.1951 2.29e-09 +phiX174 4452 4463 1 + + 5.75e-09 20.8902 2.58e-09 +phiX174 2492 2503 1 + + 5.79e-09 20.3415 3.06e-09 +phiX174 4103 4114 1 + + 5.79e-09 20.3171 3.08e-09 +phiX174 4954 4965 1 + + 5.79e-09 20.3171 3.08e-09 +phiX174 1884 1895 1 + + 6.45e-09 19.9268 3.61e-09 +phiX174 3375 3386 1 + + 6.48e-09 19.7683 3.81e-09 +phiX174 51 62 1 + + 6.58e-09 19.5732 4.06e-09 +phiX174 1389 1400 1 + + 6.61e-09 19.378 4.26e-09 +phiX174 2016 2027 1 + + 6.85e-09 19.0854 4.6e-09 +phiX174 999 1010 1 + + 6.97e-09 18.878 4.88e-09 +phiX174 1554 1565 1 + + 7.37e-09 18.439 5.58e-09 +phiX174 4429 4440 1 + + 7.37e-09 18.4268 5.62e-09 +phiX174 1926 1937 1 + + 7.37e-09 18.2927 5.82e-09 +phiX174 2980 2991 1 + + 7.37e-09 18.0732 6.13e-09 +phiX174 4202 4213 1 + + 7.37e-09 17.9268 6.34e-09 +phiX174 1668 1679 1 + + 7.37e-09 17.8659 6.4e-09 +phiX174 3259 3270 1 + + 7.82e-09 17.5 7.01e-09 +phiX174 3046 3057 1 + + 7.85e-09 17.2805 7.4e-09 +phiX174 4175 4186 1 + + 7.85e-09 17.1829 7.6e-09 +phiX174 4117 4128 1 + + 7.85e-09 17.1341 7.7e-09 +phiX174 5369 5380 1 + + 7.87e-09 16.9878 8.03e-09 +phiX174 1241 1252 1 + + 7.87e-09 16.5122 8.94e-09 +phiX174 2582 2593 1 + + 7.87e-09 16.5122 8.94e-09 +phiX174 697 708 1 + + 7.87e-09 16.4146 9.13e-09 +phiX174 2298 2309 1 + + 7.87e-09 16.3537 9.26e-09 +phiX174 4188 4199 1 + + 7.87e-09 16.1707 9.69e-09 +phiX174 274 285 1 + + 7.87e-09 16.0976 9.85e-09 +phiX174 1800 1811 1 + + 7.87e-09 16.0366 1e-08 +phiX174 1385 1396 1 + + 7.87e-09 15.9268 1.03e-08 +phiX174 1302 1313 1 + + 7.87e-09 15.9024 1.03e-08 +phiX174 3771 3782 1 + + 7.87e-09 15.878 1.04e-08 +phiX174 1287 1298 1 + + 7.87e-09 15.8659 1.04e-08 +phiX174 2576 2587 1 + + 7.87e-09 15.7683 1.08e-08 +phiX174 936 947 1 + + 7.87e-09 15.7561 1.08e-08 +phiX174 903 914 1 + + 7.93e-09 15.6585 1.11e-08 +phiX174 2278 2289 1 + + 7.93e-09 15.5854 1.13e-08 +phiX174 3163 3174 1 + + 7.98e-09 15.5 1.16e-08 +phiX174 23 34 1 + + 8.24e-09 15.3293 1.23e-08 +phiX174 837 848 1 + + 8.24e-09 15.2561 1.27e-08 +phiX174 852 863 1 + + 8.24e-09 15.2561 1.27e-08 +phiX174 1983 1994 1 + + 8.68e-09 15.0244 1.36e-08 +phiX174 0 11 1 + + 9.05e-09 14.8293 1.46e-08 +phiX174 4306 4317 1 + + 9.05e-09 14.7927 1.47e-08 +phiX174 4302 4313 1 + + 9.19e-09 14.6585 1.52e-08 +phiX174 5032 5043 1 + + 9.41e-09 14.561 1.58e-08 +phiX174 2578 2589 1 + + 1.01e-08 14.2927 1.73e-08 +phiX174 321 332 1 + + 1.05e-08 14.1951 1.82e-08 +phiX174 5000 5011 1 + + 1.19e-08 13.8902 2.09e-08 +phiX174 4216 4227 1 + + 1.2e-08 13.8171 2.15e-08 +phiX174 4261 4272 1 + + 1.2e-08 13.7805 2.18e-08 +phiX174 3568 3579 1 + + 1.22e-08 13.7073 2.26e-08 +phiX174 193 204 1 + + 1.22e-08 13.6829 2.29e-08 +phiX174 130 141 1 + + 1.31e-08 13.4756 2.49e-08 +phiX174 1490 1501 1 + + 1.32e-08 13.4024 2.55e-08 +phiX174 433 444 1 + + 1.36e-08 13.2805 2.67e-08 +phiX174 4564 4575 1 + + 1.36e-08 13.2439 2.73e-08 +phiX174 101 112 1 + + 1.36e-08 13.2195 2.75e-08 +phiX174 902 913 1 + + 1.38e-08 13.1463 2.82e-08 +phiX174 4747 4758 1 + + 1.45e-08 12.9756 3.01e-08 +phiX174 2621 2632 1 + + 1.5e-08 12.8659 3.16e-08 +phiX174 466 477 1 + + 1.57e-08 12.7317 3.35e-08 +phiX174 4032 4043 1 + + 1.58e-08 12.6829 3.44e-08 +phiX174 1347 1358 1 + + 1.58e-08 12.6707 3.46e-08 +phiX174 238 249 1 + + 1.64e-08 12.5732 3.62e-08 +phiX174 499 510 1 + + 1.71e-08 12.4634 3.84e-08 +phiX174 3000 3011 1 + + 1.73e-08 12.4146 3.93e-08 +phiX174 3775 3786 1 + + 1.73e-08 12.378 3.98e-08 +phiX174 2025 2036 1 + + 1.75e-08 12.3293 4.06e-08 +phiX174 4236 4247 1 + + 1.75e-08 12.3049 4.12e-08 +phiX174 802 813 1 + + 1.78e-08 12.2439 4.24e-08 +phiX174 3769 3780 1 + + 1.81e-08 12.1829 4.35e-08 +phiX174 3428 3439 1 + + 1.82e-08 12.122 4.45e-08 +phiX174 98 109 1 + + 1.82e-08 12.1098 4.48e-08 +phiX174 66 77 1 + + 1.92e-08 11.9268 4.78e-08 +phiX174 5331 5342 1 + + 2.01e-08 11.7195 5.13e-08 +phiX174 276 287 1 + + 2.01e-08 11.7073 5.14e-08 +phiX174 4337 4348 1 + + 2.01e-08 11.6951 5.18e-08 +phiX174 3811 3822 1 + + 2.03e-08 11.6585 5.28e-08 +phiX174 1908 1919 1 + + 2.08e-08 11.5488 5.51e-08 +phiX174 2999 3010 1 + + 2.08e-08 11.5366 5.54e-08 +phiX174 3890 3901 1 + + 2.11e-08 11.439 5.75e-08 +phiX174 3078 3089 1 + + 2.11e-08 11.4268 5.76e-08 +phiX174 36 47 1 + + 2.11e-08 11.4146 5.79e-08 +phiX174 379 390 1 + + 2.17e-08 11.3293 6.01e-08 diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_interval_2.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_interval_2.txt Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,100 @@ +#chr start end pattern name score strand matched sequence p-value q-value +phiX174 1387 1398 1 + + 0 29.4024 6.36e-11 +phiX174 846 857 1 + + 0 29.122 7.02e-11 +phiX174 2300 2311 1 + + 0 27.6463 1.08e-10 +phiX174 5062 5073 1 + + 0 25.5366 2.73e-10 +phiX174 988 999 1 + + 0 25.3049 3.15e-10 +phiX174 4712 4723 1 + + 0 23.622 7.74e-10 +phiX174 5047 5058 1 + + 0 23.3293 8.51e-10 +phiX174 854 865 1 + + 0 23.3049 8.64e-10 +phiX174 3154 3165 1 + + 0 23.0366 9.76e-10 +phiX174 5008 5019 1 + + 0 23.0366 9.76e-10 +phiX174 813 824 1 + + 0 22.5854 1.28e-09 +phiX174 2831 2842 1 + + 0 22.3415 1.42e-09 +phiX174 3829 3840 1 + + 0 21.8293 1.7e-09 +phiX174 3559 3570 1 + + 0 21.5976 1.89e-09 +phiX174 2881 2892 1 + + 0 21.1951 2.29e-09 +phiX174 4452 4463 1 + + 0 20.8902 2.58e-09 +phiX174 2492 2503 1 + + 0 20.3415 3.06e-09 +phiX174 4103 4114 1 + + 0 20.3171 3.08e-09 +phiX174 4954 4965 1 + + 0 20.3171 3.08e-09 +phiX174 1884 1895 1 + + 0 19.9268 3.61e-09 +phiX174 3375 3386 1 + + 0 19.7683 3.81e-09 +phiX174 51 62 1 + + 0 19.5732 4.06e-09 +phiX174 1389 1400 1 + + 0 19.378 4.26e-09 +phiX174 2016 2027 1 + + 0 19.0854 4.6e-09 +phiX174 999 1010 1 + + 0 18.878 4.88e-09 +phiX174 1554 1565 1 + + 0 18.439 5.58e-09 +phiX174 4429 4440 1 + + 0 18.4268 5.62e-09 +phiX174 1926 1937 1 + + 0 18.2927 5.82e-09 +phiX174 2980 2991 1 + + 0 18.0732 6.13e-09 +phiX174 4202 4213 1 + + 0 17.9268 6.34e-09 +phiX174 1668 1679 1 + + 0 17.8659 6.4e-09 +phiX174 3259 3270 1 + + 0 17.5 7.01e-09 +phiX174 3046 3057 1 + + 0 17.2805 7.4e-09 +phiX174 4175 4186 1 + + 0 17.1829 7.6e-09 +phiX174 4117 4128 1 + + 0 17.1341 7.7e-09 +phiX174 5369 5380 1 + + 0 16.9878 8.03e-09 +phiX174 1241 1252 1 + + 0 16.5122 8.94e-09 +phiX174 2582 2593 1 + + 0 16.5122 8.94e-09 +phiX174 697 708 1 + + 0 16.4146 9.13e-09 +phiX174 2298 2309 1 + + 0 16.3537 9.26e-09 +phiX174 4188 4199 1 + + 0 16.1707 9.69e-09 +phiX174 274 285 1 + + 0 16.0976 9.85e-09 +phiX174 1800 1811 1 + + 0 16.0366 1e-08 +phiX174 1385 1396 1 + + 0 15.9268 1.03e-08 +phiX174 1302 1313 1 + + 0 15.9024 1.03e-08 +phiX174 3771 3782 1 + + 0 15.878 1.04e-08 +phiX174 1287 1298 1 + + 0 15.8659 1.04e-08 +phiX174 2576 2587 1 + + 0 15.7683 1.08e-08 +phiX174 936 947 1 + + 0 15.7561 1.08e-08 +phiX174 903 914 1 + + 0 15.6585 1.11e-08 +phiX174 2278 2289 1 + + 0 15.5854 1.13e-08 +phiX174 3163 3174 1 + + 0 15.5 1.16e-08 +phiX174 23 34 1 + + 0 15.3293 1.23e-08 +phiX174 837 848 1 + + 0 15.2561 1.27e-08 +phiX174 852 863 1 + + 0 15.2561 1.27e-08 +phiX174 1983 1994 1 + + 0 15.0244 1.36e-08 +phiX174 0 11 1 + + 0 14.8293 1.46e-08 +phiX174 4306 4317 1 + + 0 14.7927 1.47e-08 +phiX174 4302 4313 1 + + 0 14.6585 1.52e-08 +phiX174 5032 5043 1 + + 0 14.561 1.58e-08 +phiX174 2578 2589 1 + + 0 14.2927 1.73e-08 +phiX174 321 332 1 + + 0 14.1951 1.82e-08 +phiX174 5000 5011 1 + + 0 13.8902 2.09e-08 +phiX174 4216 4227 1 + + 0 13.8171 2.15e-08 +phiX174 4261 4272 1 + + 0 13.7805 2.18e-08 +phiX174 3568 3579 1 + + 0 13.7073 2.26e-08 +phiX174 193 204 1 + + 0 13.6829 2.29e-08 +phiX174 130 141 1 + + 0 13.4756 2.49e-08 +phiX174 1490 1501 1 + + 0 13.4024 2.55e-08 +phiX174 433 444 1 + + 0 13.2805 2.67e-08 +phiX174 4564 4575 1 + + 0 13.2439 2.73e-08 +phiX174 101 112 1 + + 0 13.2195 2.75e-08 +phiX174 902 913 1 + + 0 13.1463 2.82e-08 +phiX174 4747 4758 1 + + 0 12.9756 3.01e-08 +phiX174 2621 2632 1 + + 0 12.8659 3.16e-08 +phiX174 466 477 1 + + 0 12.7317 3.35e-08 +phiX174 4032 4043 1 + + 0 12.6829 3.44e-08 +phiX174 1347 1358 1 + + 0 12.6707 3.46e-08 +phiX174 238 249 1 + + 0 12.5732 3.62e-08 +phiX174 499 510 1 + + 0 12.4634 3.84e-08 +phiX174 3000 3011 1 + + 0 12.4146 3.93e-08 +phiX174 3775 3786 1 + + 0 12.378 3.98e-08 +phiX174 2025 2036 1 + + 0 12.3293 4.06e-08 +phiX174 4236 4247 1 + + 0 12.3049 4.12e-08 +phiX174 802 813 1 + + 0 12.2439 4.24e-08 +phiX174 3769 3780 1 + + 0 12.1829 4.35e-08 +phiX174 3428 3439 1 + + 0 12.122 4.45e-08 +phiX174 98 109 1 + + 0 12.1098 4.48e-08 +phiX174 66 77 1 + + 0 11.9268 4.78e-08 +phiX174 5331 5342 1 + + 0 11.7195 5.13e-08 +phiX174 276 287 1 + + 0 11.7073 5.14e-08 +phiX174 4337 4348 1 + + 0 11.6951 5.18e-08 +phiX174 3811 3822 1 + + 0 11.6585 5.28e-08 +phiX174 1908 1919 1 + + 0 11.5488 5.51e-08 +phiX174 2999 3010 1 + + 0 11.5366 5.54e-08 +phiX174 3890 3901 1 + + 0 11.439 5.75e-08 +phiX174 3078 3089 1 + + 0 11.4268 5.76e-08 +phiX174 36 47 1 + + 0 11.4146 5.79e-08 +phiX174 379 390 1 + + 0 11.3293 6.01e-08 diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_txt_1.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_txt_1.txt Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,100 @@ +#pattern name sequence name start stop strand score p-value q-value matched sequence +1 phiX174 1388 1398 + 29.4024 6.36e-11 1.25e-09 AATATCTATAA +1 phiX174 847 857 + 29.122 7.02e-11 1.25e-09 AATGTCTAAAG +1 phiX174 2301 2311 + 27.6463 1.08e-10 1.29e-09 AGGTTATAACG +1 phiX174 5063 5073 + 25.5366 2.73e-10 2.25e-09 AGGAGCTAAAG +1 phiX174 989 999 + 25.3049 3.15e-10 2.25e-09 TGAGGATAAAT +1 phiX174 4713 4723 + 23.622 7.74e-10 3.48e-09 GACTGCTATCA +1 phiX174 5048 5058 + 23.3293 8.51e-10 3.48e-09 TGCTGCTAAAG +1 phiX174 855 865 + 23.3049 8.64e-10 3.48e-09 AAGGTAAAAAA +1 phiX174 3155 3165 + 23.0366 9.76e-10 3.48e-09 TATGGCTAAAG +1 phiX174 5009 5019 + 23.0366 9.76e-10 3.48e-09 TGTGGCTAAAT +1 phiX174 814 824 + 22.5854 1.28e-09 4.14e-09 TGCGTCAAAAA +1 phiX174 2832 2842 + 22.3415 1.42e-09 4.23e-09 TTGGTCTAACT +1 phiX174 3830 3840 + 21.8293 1.7e-09 4.68e-09 TATTGATAAAG +1 phiX174 3560 3570 + 21.5976 1.89e-09 4.82e-09 TGCGTCTATTA +1 phiX174 2882 2892 + 21.1951 2.29e-09 5.46e-09 AGGTTATTAAA +1 phiX174 4453 4463 + 20.8902 2.58e-09 5.75e-09 AAGGTATTAAG +1 phiX174 2493 2503 + 20.3415 3.06e-09 5.79e-09 GACACCTAAAG +1 phiX174 4104 4114 + 20.3171 3.08e-09 5.79e-09 GGCTTCCATAA +1 phiX174 4955 4965 + 20.3171 3.08e-09 5.79e-09 TGATGCTAAAG +1 phiX174 1885 1895 + 19.9268 3.61e-09 6.45e-09 TGCGACTAAAG +1 phiX174 3376 3386 + 19.7683 3.81e-09 6.48e-09 AGAATCAAAAA +1 phiX174 52 62 + 19.5732 4.06e-09 6.58e-09 TGAGTCGAAAA +1 phiX174 1390 1400 + 19.378 4.26e-09 6.61e-09 TATCTATAACA +1 phiX174 2017 2027 + 19.0854 4.6e-09 6.85e-09 TTCGTCTAAGA +1 phiX174 1000 1010 + 18.878 4.88e-09 6.97e-09 TATGTCTAATA +1 phiX174 1555 1565 + 18.439 5.58e-09 7.37e-09 GACTTCTACCA +1 phiX174 4430 4440 + 18.4268 5.62e-09 7.37e-09 TGAGTATAATT +1 phiX174 1927 1937 + 18.2927 5.82e-09 7.37e-09 GACTTATACCG +1 phiX174 2981 2991 + 18.0732 6.13e-09 7.37e-09 CATGTCTAAAT +1 phiX174 4203 4213 + 17.9268 6.34e-09 7.37e-09 GACGGCCATAA +1 phiX174 1669 1679 + 17.8659 6.4e-09 7.37e-09 TGGAGGTAAAA +1 phiX174 3260 3270 + 17.5 7.01e-09 7.82e-09 CGCTGATAAAG +1 phiX174 3047 3057 + 17.2805 7.4e-09 7.85e-09 TACCGATAACA +1 phiX174 4176 4186 + 17.1829 7.6e-09 7.85e-09 GAGTTCGATAA +1 phiX174 4118 4128 + 17.1341 7.7e-09 7.85e-09 GATGGATAACC +1 phiX174 5370 5380 + 16.9878 8.03e-09 7.87e-09 GGCGTATCCAA +1 phiX174 1242 1252 + 16.5122 8.94e-09 7.87e-09 AGTGGATTAAG +1 phiX174 2583 2593 + 16.5122 8.94e-09 7.87e-09 TACATCTGTCA +1 phiX174 698 708 + 16.4146 9.13e-09 7.87e-09 TACGGAAAACA +1 phiX174 2299 2309 + 16.3537 9.26e-09 7.87e-09 TGAGGTTATAA +1 phiX174 4189 4199 + 16.1707 9.69e-09 7.87e-09 GTGATATGTAT +1 phiX174 275 285 + 16.0976 9.85e-09 7.87e-09 GGTTTAGATAT +1 phiX174 1801 1811 + 16.0366 1e-08 7.87e-09 GACCTATAAAC +1 phiX174 1386 1396 + 15.9268 1.03e-08 7.87e-09 TGAATATCTAT +1 phiX174 1303 1313 + 15.9024 1.03e-08 7.87e-09 TGGTTATATTG +1 phiX174 3772 3782 + 15.878 1.04e-08 7.87e-09 AGGATATTTCT +1 phiX174 1288 1298 + 15.8659 1.04e-08 7.87e-09 GACTGTTAACA +1 phiX174 2577 2587 + 15.7683 1.08e-08 7.87e-09 GATGGATACAT +1 phiX174 937 947 + 15.7561 1.08e-08 7.87e-09 TTGGTATGTAG +1 phiX174 904 914 + 15.6585 1.11e-08 7.93e-09 AGGTACTAAAG +1 phiX174 2279 2289 + 15.5854 1.13e-08 7.93e-09 TCGTGATAAAA +1 phiX174 3164 3174 + 15.5 1.16e-08 7.98e-09 AGCTGGTAAAG +1 phiX174 24 34 + 15.3293 1.23e-08 8.24e-09 AGAAGTTAACA +1 phiX174 838 848 + 15.2561 1.27e-08 8.24e-09 GAGTGATGTAA +1 phiX174 853 863 + 15.2561 1.27e-08 8.24e-09 TAAAGGTAAAA +1 phiX174 1984 1994 + 15.0244 1.36e-08 8.68e-09 AATTTCTATGA +1 phiX174 1 11 + 14.8293 1.46e-08 9.05e-09 GAGTTTTATCG +1 phiX174 4307 4317 + 14.7927 1.47e-08 9.05e-09 TATTAATAACA +1 phiX174 4303 4313 + 14.6585 1.52e-08 9.19e-09 TTGATATTAAT +1 phiX174 5033 5043 + 14.561 1.58e-08 9.41e-09 GTCAGATATGG +1 phiX174 2579 2589 + 14.2927 1.73e-08 1.01e-08 TGGATACATCT +1 phiX174 322 332 + 14.1951 1.82e-08 1.05e-08 GACATTTTAAA +1 phiX174 5001 5011 + 13.8902 2.09e-08 1.19e-08 GGTTTCTATGT +1 phiX174 4217 4227 + 13.8171 2.15e-08 1.2e-08 TGCTTCTGACG +1 phiX174 4262 4272 + 13.7805 2.18e-08 1.2e-08 AATGGATGAAT +1 phiX174 3569 3579 + 13.7073 2.26e-08 1.22e-08 TATGGAAAACA +1 phiX174 194 204 + 13.6829 2.29e-08 1.22e-08 ATCAACTAACG +1 phiX174 131 141 + 13.4756 2.49e-08 1.31e-08 AAATGAGAAAA +1 phiX174 1491 1501 + 13.4024 2.55e-08 1.32e-08 GCCATCTCAAA +1 phiX174 434 444 + 13.2805 2.67e-08 1.36e-08 GGCCTCTATTA +1 phiX174 4565 4575 + 13.2439 2.73e-08 1.36e-08 TTGGTTTATCG +1 phiX174 102 112 + 13.2195 2.75e-08 1.36e-08 GAATTAAATCG +1 phiX174 903 913 + 13.1463 2.82e-08 1.38e-08 GAGGTACTAAA +1 phiX174 4748 4758 + 12.9756 3.01e-08 1.45e-08 TACAGCTAATG +1 phiX174 2622 2632 + 12.8659 3.16e-08 1.5e-08 TGCTGATATTG +1 phiX174 467 477 + 12.7317 3.35e-08 1.57e-08 TTTGGATTTAA +1 phiX174 4033 4043 + 12.6829 3.44e-08 1.58e-08 AGCGTATCGAG +1 phiX174 1348 1358 + 12.6707 3.46e-08 1.58e-08 TACCAATAAAA +1 phiX174 239 249 + 12.5732 3.62e-08 1.64e-08 AGTGGCTTAAT +1 phiX174 500 510 + 12.4634 3.84e-08 1.71e-08 GACGAGTAACA +1 phiX174 3001 3011 + 12.4146 3.93e-08 1.73e-08 GCGGTCAAAAA +1 phiX174 3776 3786 + 12.378 3.98e-08 1.73e-08 TATTTCTAATG +1 phiX174 2026 2036 + 12.3293 4.06e-08 1.75e-08 GAAGTTTAAGA +1 phiX174 4237 4247 + 12.3049 4.12e-08 1.75e-08 AGTTTGTATCT +1 phiX174 803 813 + 12.2439 4.24e-08 1.78e-08 AGAAGAAAACG +1 phiX174 3770 3780 + 12.1829 4.35e-08 1.81e-08 AAAGGATATTT +1 phiX174 3429 3439 + 12.122 4.45e-08 1.82e-08 GAGATGCAAAA +1 phiX174 99 109 + 12.1098 4.48e-08 1.82e-08 TACGAATTAAA +1 phiX174 67 77 + 11.9268 4.78e-08 1.92e-08 TCTTGATAAAG +1 phiX174 5332 5342 + 11.7195 5.13e-08 2.01e-08 ATCTGCTCAAA +1 phiX174 277 287 + 11.7073 5.14e-08 2.01e-08 TTTAGATATGA +1 phiX174 4338 4348 + 11.6951 5.18e-08 2.01e-08 GGGGACGAAAA +1 phiX174 3812 3822 + 11.6585 5.28e-08 2.03e-08 GGTTGATATTT +1 phiX174 1909 1919 + 11.5488 5.51e-08 2.08e-08 TAACGCTAAAG +1 phiX174 3000 3010 + 11.5366 5.54e-08 2.08e-08 GGCGGTCAAAA +1 phiX174 3891 3901 + 11.439 5.75e-08 2.11e-08 ATTGGCTCTAA +1 phiX174 3079 3089 + 11.4268 5.76e-08 2.11e-08 CTGGTATTAAA +1 phiX174 37 47 + 11.4146 5.79e-08 2.11e-08 TTCGGATATTT +1 phiX174 380 390 + 11.3293 6.01e-08 2.17e-08 GTAAGAAATCA diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_txt_2.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_txt_2.txt Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,100 @@ +#pattern name sequence name start stop strand score p-value q-value matched sequence +1 phiX174 1388 1398 + 29.4024 6.36e-11 0 AATATCTATAA +1 phiX174 847 857 + 29.122 7.02e-11 0 AATGTCTAAAG +1 phiX174 2301 2311 + 27.6463 1.08e-10 0 AGGTTATAACG +1 phiX174 5063 5073 + 25.5366 2.73e-10 0 AGGAGCTAAAG +1 phiX174 989 999 + 25.3049 3.15e-10 0 TGAGGATAAAT +1 phiX174 4713 4723 + 23.622 7.74e-10 0 GACTGCTATCA +1 phiX174 5048 5058 + 23.3293 8.51e-10 0 TGCTGCTAAAG +1 phiX174 855 865 + 23.3049 8.64e-10 0 AAGGTAAAAAA +1 phiX174 3155 3165 + 23.0366 9.76e-10 0 TATGGCTAAAG +1 phiX174 5009 5019 + 23.0366 9.76e-10 0 TGTGGCTAAAT +1 phiX174 814 824 + 22.5854 1.28e-09 0 TGCGTCAAAAA +1 phiX174 2832 2842 + 22.3415 1.42e-09 0 TTGGTCTAACT +1 phiX174 3830 3840 + 21.8293 1.7e-09 0 TATTGATAAAG +1 phiX174 3560 3570 + 21.5976 1.89e-09 0 TGCGTCTATTA +1 phiX174 2882 2892 + 21.1951 2.29e-09 0 AGGTTATTAAA +1 phiX174 4453 4463 + 20.8902 2.58e-09 0 AAGGTATTAAG +1 phiX174 2493 2503 + 20.3415 3.06e-09 0 GACACCTAAAG +1 phiX174 4104 4114 + 20.3171 3.08e-09 0 GGCTTCCATAA +1 phiX174 4955 4965 + 20.3171 3.08e-09 0 TGATGCTAAAG +1 phiX174 1885 1895 + 19.9268 3.61e-09 0 TGCGACTAAAG +1 phiX174 3376 3386 + 19.7683 3.81e-09 0 AGAATCAAAAA +1 phiX174 52 62 + 19.5732 4.06e-09 0 TGAGTCGAAAA +1 phiX174 1390 1400 + 19.378 4.26e-09 0 TATCTATAACA +1 phiX174 2017 2027 + 19.0854 4.6e-09 0 TTCGTCTAAGA +1 phiX174 1000 1010 + 18.878 4.88e-09 0 TATGTCTAATA +1 phiX174 1555 1565 + 18.439 5.58e-09 0 GACTTCTACCA +1 phiX174 4430 4440 + 18.4268 5.62e-09 0 TGAGTATAATT +1 phiX174 1927 1937 + 18.2927 5.82e-09 0 GACTTATACCG +1 phiX174 2981 2991 + 18.0732 6.13e-09 0 CATGTCTAAAT +1 phiX174 4203 4213 + 17.9268 6.34e-09 0 GACGGCCATAA +1 phiX174 1669 1679 + 17.8659 6.4e-09 0 TGGAGGTAAAA +1 phiX174 3260 3270 + 17.5 7.01e-09 0 CGCTGATAAAG +1 phiX174 3047 3057 + 17.2805 7.4e-09 0 TACCGATAACA +1 phiX174 4176 4186 + 17.1829 7.6e-09 0 GAGTTCGATAA +1 phiX174 4118 4128 + 17.1341 7.7e-09 0 GATGGATAACC +1 phiX174 5370 5380 + 16.9878 8.03e-09 0 GGCGTATCCAA +1 phiX174 1242 1252 + 16.5122 8.94e-09 0 AGTGGATTAAG +1 phiX174 2583 2593 + 16.5122 8.94e-09 0 TACATCTGTCA +1 phiX174 698 708 + 16.4146 9.13e-09 0 TACGGAAAACA +1 phiX174 2299 2309 + 16.3537 9.26e-09 0 TGAGGTTATAA +1 phiX174 4189 4199 + 16.1707 9.69e-09 0 GTGATATGTAT +1 phiX174 275 285 + 16.0976 9.85e-09 0 GGTTTAGATAT +1 phiX174 1801 1811 + 16.0366 1e-08 0 GACCTATAAAC +1 phiX174 1386 1396 + 15.9268 1.03e-08 0 TGAATATCTAT +1 phiX174 1303 1313 + 15.9024 1.03e-08 0 TGGTTATATTG +1 phiX174 3772 3782 + 15.878 1.04e-08 0 AGGATATTTCT +1 phiX174 1288 1298 + 15.8659 1.04e-08 0 GACTGTTAACA +1 phiX174 2577 2587 + 15.7683 1.08e-08 0 GATGGATACAT +1 phiX174 937 947 + 15.7561 1.08e-08 0 TTGGTATGTAG +1 phiX174 904 914 + 15.6585 1.11e-08 0 AGGTACTAAAG +1 phiX174 2279 2289 + 15.5854 1.13e-08 0 TCGTGATAAAA +1 phiX174 3164 3174 + 15.5 1.16e-08 0 AGCTGGTAAAG +1 phiX174 24 34 + 15.3293 1.23e-08 0 AGAAGTTAACA +1 phiX174 838 848 + 15.2561 1.27e-08 0 GAGTGATGTAA +1 phiX174 853 863 + 15.2561 1.27e-08 0 TAAAGGTAAAA +1 phiX174 1984 1994 + 15.0244 1.36e-08 0 AATTTCTATGA +1 phiX174 1 11 + 14.8293 1.46e-08 0 GAGTTTTATCG +1 phiX174 4307 4317 + 14.7927 1.47e-08 0 TATTAATAACA +1 phiX174 4303 4313 + 14.6585 1.52e-08 0 TTGATATTAAT +1 phiX174 5033 5043 + 14.561 1.58e-08 0 GTCAGATATGG +1 phiX174 2579 2589 + 14.2927 1.73e-08 0 TGGATACATCT +1 phiX174 322 332 + 14.1951 1.82e-08 0 GACATTTTAAA +1 phiX174 5001 5011 + 13.8902 2.09e-08 0 GGTTTCTATGT +1 phiX174 4217 4227 + 13.8171 2.15e-08 0 TGCTTCTGACG +1 phiX174 4262 4272 + 13.7805 2.18e-08 0 AATGGATGAAT +1 phiX174 3569 3579 + 13.7073 2.26e-08 0 TATGGAAAACA +1 phiX174 194 204 + 13.6829 2.29e-08 0 ATCAACTAACG +1 phiX174 131 141 + 13.4756 2.49e-08 0 AAATGAGAAAA +1 phiX174 1491 1501 + 13.4024 2.55e-08 0 GCCATCTCAAA +1 phiX174 434 444 + 13.2805 2.67e-08 0 GGCCTCTATTA +1 phiX174 4565 4575 + 13.2439 2.73e-08 0 TTGGTTTATCG +1 phiX174 102 112 + 13.2195 2.75e-08 0 GAATTAAATCG +1 phiX174 903 913 + 13.1463 2.82e-08 0 GAGGTACTAAA +1 phiX174 4748 4758 + 12.9756 3.01e-08 0 TACAGCTAATG +1 phiX174 2622 2632 + 12.8659 3.16e-08 0 TGCTGATATTG +1 phiX174 467 477 + 12.7317 3.35e-08 0 TTTGGATTTAA +1 phiX174 4033 4043 + 12.6829 3.44e-08 0 AGCGTATCGAG +1 phiX174 1348 1358 + 12.6707 3.46e-08 0 TACCAATAAAA +1 phiX174 239 249 + 12.5732 3.62e-08 0 AGTGGCTTAAT +1 phiX174 500 510 + 12.4634 3.84e-08 0 GACGAGTAACA +1 phiX174 3001 3011 + 12.4146 3.93e-08 0 GCGGTCAAAAA +1 phiX174 3776 3786 + 12.378 3.98e-08 0 TATTTCTAATG +1 phiX174 2026 2036 + 12.3293 4.06e-08 0 GAAGTTTAAGA +1 phiX174 4237 4247 + 12.3049 4.12e-08 0 AGTTTGTATCT +1 phiX174 803 813 + 12.2439 4.24e-08 0 AGAAGAAAACG +1 phiX174 3770 3780 + 12.1829 4.35e-08 0 AAAGGATATTT +1 phiX174 3429 3439 + 12.122 4.45e-08 0 GAGATGCAAAA +1 phiX174 99 109 + 12.1098 4.48e-08 0 TACGAATTAAA +1 phiX174 67 77 + 11.9268 4.78e-08 0 TCTTGATAAAG +1 phiX174 5332 5342 + 11.7195 5.13e-08 0 ATCTGCTCAAA +1 phiX174 277 287 + 11.7073 5.14e-08 0 TTTAGATATGA +1 phiX174 4338 4348 + 11.6951 5.18e-08 0 GGGGACGAAAA +1 phiX174 3812 3822 + 11.6585 5.28e-08 0 GGTTGATATTT +1 phiX174 1909 1919 + 11.5488 5.51e-08 0 TAACGCTAAAG +1 phiX174 3000 3010 + 11.5366 5.54e-08 0 GGCGGTCAAAA +1 phiX174 3891 3901 + 11.439 5.75e-08 0 ATTGGCTCTAA +1 phiX174 3079 3089 + 11.4268 5.76e-08 0 CTGGTATTAAA +1 phiX174 37 47 + 11.4146 5.79e-08 0 TTCGGATATTT +1 phiX174 380 390 + 11.3293 6.01e-08 0 GTAAGAAATCA diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_xml_1.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_xml_1.xml Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,66 @@ + + + +false +true +false +false +false +0.0001 +p-value +100000 +0.1 +1 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +0.073 +0.018 +0.052 +0.062 +0.040 +0.069 +0.022 +0.056 +0.058 +0.092 +0.023 +0.046 +0.051 +0.041 +0.052 +0.074 +0.059 +0.064 +0.013 +0.033 + +cisml.xml + diff -r 000000000000 -r a0fa4efeeee3 test-data/fimo_output_xml_2.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fimo_output_xml_2.xml Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,65 @@ + + + +false +false +false +false +0.0001 +p-value +100000 +0.1 +1 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +0.073 +0.018 +0.052 +0.062 +0.040 +0.069 +0.022 +0.056 +0.058 +0.092 +0.023 +0.046 +0.051 +0.041 +0.052 +0.074 +0.059 +0.064 +0.013 +0.033 + +cisml.xml + diff -r 000000000000 -r a0fa4efeeee3 test-data/meme_input_1.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme_input_1.fasta Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,66 @@ +>chr21_19617074_19617124_+ +AAAAATTATTACTAGGGAGGGGGCCGGAACCTCGGGACGTGGGTATATAA +>chr21_26934381_26934431_+ +GCGCCTGGTCGGTTATGAGTCACAAGTGAGTTATAAAAGGGTCGCACGTT +>chr21_28217753_28217803_- +CAAAGGGGAGGAGTGGGGTGGGGGTGGGGGTTTCACTGGTCCACTATAAA +>chr21_31710037_31710087_- +AACACCCAGGTTTCTGAGTATATAATCGCCGCACCAAAGAATTTAATTTT +>chr21_31744582_31744632_- +CCCAGGTCTAAGAGCATATATAACTTGGAGTCCAGACTATGACATTCAAA +>chr21_31768316_31768366_+ +AACGTATATAAATGGTCCTGTCCAGATGTGGCATGCAAACTCAGAATCTT +>chr21_31914206_31914256_- +TGACACCCACTACTTAGAGTATAAAATCATTCTGAGAAGTTAGAGACACC +>chr21_31933633_31933683_- +TCAGAGTATATATAAATGTTCCTGTCCAGTCACAGTCACCAAACTGACCT +>chr21_31962741_31962791_- +ACATATAACTCAGGTTGGATAAAATAATTTGTACAAATCAGGAGAGTCAA +>chr21_31964683_31964733_+ +TCTGATTCACTGAGGCATATAAAAGGCCCTCTGCGGAGAAGTGTCCATAC +>chr21_31973364_31973414_+ +aaacttaaaactctataaacttaaaactCTAGAATCTGATCCTGCTATAC +>chr21_31992870_31992920_+ +CTCATACACTATTGAAGATGTATAAAATTTCATTTGCAGATGGTGACATT +>chr21_32185595_32185645_- +TCACCACCCACCAGAGCTGGGATATATAAAGAAGGTTCTGAGACTAGGAA +>chr21_32202076_32202126_- +TGCCCACCAGCTTGAGGTATAAAAAGCCCTGTACGGGAAGAGACCTTCAT +>chr21_32253899_32253949_- +AGCCCCACCCACCAGCAAGGATATATAAAAGCTCAGGAGTCTGGAGTGAC +>chr21_32410820_32410870_- +TCTACCCCACTAATCACTGAGGATGTATAAAAGTCCCAGGGAAGCTGGTG +>chr21_36411748_36411798_- +ATAGTTCTGTATAGTTTCAGTTGGCATCtaaaaattatataactttattt +>chr21_37838750_37838800_- +gatggttttataaggggcctcaccctcggctcagccctcattcttctcct +>chr21_45705687_45705737_+ +CCGGGGCGGAGCGGCCTTTGCTCTTTGCGTGGTCGCGGGGGTATAACAGC +>chr21_45971413_45971463_- +CAGGCCCTGGGCATATAAAAGCCCCAGCAGCCAACAGGctcacacacaca +>chr21_45978668_45978718_- +CAGAGGGGTATAAAGGTTCCGACCACTCAGAGGCCTGGCACGAtcactca +>chr21_45993530_45993580_+ +CCAAGGAGGAGTATAAAAGCCCCACAAACCCGAGCACCTCACTCACTCGC +>chr21_46020421_46020471_+ +GAGACATATAAAAGCCAACATCCCTGAGCACCTAACACACGGactcactc +>chr21_46031920_46031970_+ +GGAAAATACCCAGGGAGGGTATAAAACCTCAGCAGCCAGGGCACACAAAC +>chr21_46046964_46047014_+ +ACAAGGCCAGGAGGGGTATAAAAGCCTGAGAGCCCCAAGAACctcacaca +>chr21_46057197_46057247_+ +ATTGCTGAGTCTCCTGCTGGGAAAACACAGGCCCTGGGCATATAAAAGCC +>chr21_46086869_46086919_- +GACAGGTGTGCTTCTGTGCTGTGGGGATGCCTGGGCCCAGGTATAAAGGC +>chr21_46102103_46102153_- +AGGTGTGTGCTTCTGTGCTGTGGGGATGCCTGGGTCCAGGTATAAAGGCT +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47517957_47518007_+ +CCTGGCGGCGGGGCGGGTCAGGCCGGCGGGGCGGGGTATAAAGGGGGCGG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG +>chr21_47575506_47575556_- +TGAGAAGCCGGTGGGGAGGTGCTGCCGGTGAGCGTATAAAGGCCCTGGCG diff -r 000000000000 -r a0fa4efeeee3 test-data/meme_output_html_1.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/meme_output_html_1.html Wed Aug 23 20:57:34 2017 -0400 @@ -0,0 +1,95 @@ + + + + + MEME +