# HG changeset patch
# User iuc
# Date 1670797690 0
# Node ID dd2f87ccbd2c0910f98200a46f54bbb037aab8c8

planemo upload for repository https://github.com/Bierinformatik/miRNAture commit 9e4e624a3a486cbd805bc3beb00e9903f315efe0

diff -r 000000000000 -r dd2f87ccbd2c macros.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,24 @@
+<macros>
+    <token name="@TOOL_VERSION@">1.1</token>
+    <token name="@VERSION_SUFFIX@">0</token>
+    <xml name="requirements">
+        <requirements>
+        <requirement type="package" version="@TOOL_VERSION@">mirnature</requirement>
+            <yield/>
+        </requirements>
+    </xml>
+    <xml name="creators">
+        <creator>
+            <person givenName="Cristian A." familyName="Velandia Huerto" email="cristian@bioinf.uni-leipzig.de" identifier="0000-0002-1370-3560" />
+            <person givenName="Joerg" familyName="Fallmann" email="fall@bioinf.uni-leipzig.de" />
+            <person givenName="Peter F." familyName="Stadler" email="studla@bioinf.uni-leipzig.de" />
+            <yield/>
+        </creator>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.3390/genes12030348</citation>
+            <yield />
+        </citations>
+    </xml>
+</macros>
diff -r 000000000000 -r dd2f87ccbd2c mirnature.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/mirnature.xml	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,246 @@
+<tool id="mirnature" name="miRNAture" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="21.05">
+    <description>Computational detection of canonical microRNAs</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <command detect_errors="aggressive"><![CDATA[
+        #import re
+        mkdir -p uncompress &&
+        mkdir -p queries_to_test &&
+        mkdir -p temporal &&
+        mkdir -p output &&
+
+        cp '$speG' temporal/genome.fasta  &&
+        #if $blast_strategy:
+            cp '$queries_to_blast' queries_to_test/Unknown_species.fa &&
+            echo "Unknown_species.fa miRNA Unknown species" > queries_to_test/queries_description.txt  &&
+        #end if
+
+        #if str('$database_source.database_source_selector') == "cached":
+            ln -s '$dataset.fields.path' uncompress/data.gz &&
+        #else:
+            ln -s '$dataset' uncompress/data.gz &&
+        #end if 
+        tar -xf uncompress/data.gz --directory uncompress/ &&
+        rm uncompress/data.gz &&
+        ## Change name of user folder to Dataset
+        mv uncompress/* uncompress/Dataset &&
+
+        miRNAture 
+        -stage '$stage' 
+        #if $subset_models
+            -sublist '$subset_models'  
+        #end if
+        -nbitscore_cut '$nbitscore'
+        -dataF 'uncompress/Dataset/'
+        -speG 'temporal/genome.fasta'
+        -speN '$speN'
+        -speT '$speT' 
+        -pe '1'
+        -workdir 'output/'
+        -m "${",".join(map(str, $homology_mode)) + ",final"}"
+        #if $blast_strategy:
+            -strategy "${",".join(map(str, $blast_strategy)) + ",ALL"}"
+        -blstq 'queries_to_test/'
+        #end if
+        -rep '$repeat_filter' > '$std_output'
+        ]]></command>
+
+    <inputs>
+        <!--File-->
+        <param argument="-speG" format="fasta" multiple="true" type="data"
+            label="Input genome or sequence"
+            help="Input sequence to be processed by miRNAture" />
+
+        <!--TEXT-->
+        <param argument="-speN" type="text" label="Scientific species name written separated by '_', such as: Homo_sapiens" >
+            <validator type="regex" message="Only letters and underscores are allowed">^[\(\w\)]+$</validator>
+        </param>
+        <param argument="-speT" type="text" label="Species tag to identify through experiment (i.e short 4 letters tag)" >
+            <validator type="regex" message="Please write only letters">^[a-zA-Z]+$</validator>
+        </param>
+
+        <!--NUM-->
+        <param argument="-nbitscore_cut" name="nbitscore" type="float" label="nBitscore" 
+            value="1" min="0" max="1" help="Control of normalized bitscore (nbitscore) threshold to filter Rfam candidates" /> 
+
+        <param argument="-rep" name="repeat_filter" type="select" label="Repeats filter" help="Repetition cutoff" >
+                <option value="relax,150,100">relax</option>
+                <option value="default,200,100">default</option>
+        </param>
+
+        <param format="txt" multiple="true" name="subset_models" type="data"
+            label="List of miRNA models to be searched"
+            help="Input sequence to be processed by miRNAture" optional="true"/>
+
+        <conditional name="database_source">
+            <param argument="-dataF" name="database_source_selector" type="select" label="Choose the source for the database">
+                <option value="cached">Pre-defined datasets</option>
+                <option value="history">History</option>
+            </param>
+            <when value="cached">
+                <param name="dataset" type="select" help="Select a pre-calculated dataset to run miRNAture (i.e. https://doi.org/10.5281/zenodo.7180160)" label="Pre-calculated datasets" >
+                    <options from_data_table="mirnature_selection" />
+                    <validator message="No reference dataset is available for miRNAture" type="no_options" />
+                </param>
+            </when>
+            <when value="history">
+                <param name="dataset" format="gz" type="data" label="Input user Pre-calculated dataset" help="Please submit the pre-calculated data to run miRNAture (i.e https://doi.org/10.5281/zenodo.7180160)" />
+            </when>
+        </conditional>
+
+<!--Static list-->
+    <param argument="-stage" type="select" label="Select one miRNAture stage">
+        <option value="complete">complete</option>
+        <option value="homology">homology</option>
+    </param>
+    <!--Check Boxes-->
+    <param argument="-mode" name="homology_mode" type="select" multiple="true" label="Homology mode">
+        <option value="blast">blast</option>
+        <option value="rfam">rfam</option>
+        <option value="mirbase">mirbase</option>
+        <option value="hmm">hmm</option>
+    </param>
+    <param argument="-strategy" name="blast_strategy" optional="true" type="select" multiple="true"
+        label="Select one or more pre-calculated set of blastn parameters, accordingly to the miRNAture publication.">
+        <option value="1">1</option>
+        <option value="2">2</option>
+        <option value="3">3</option>
+        <option value="4">4</option>
+        <option value="5">5</option>
+        <option value="6">6</option>
+        <option value="7">7</option>
+        <option value="8">8</option>
+        <option value="9">9</option>
+    </param>
+    <param argument="-blstq" format="fasta" multiple="true" name="queries_to_blast" type="data" label="Query sequences"
+        help="Query sequences to search in target genome" optional="true" />
+</inputs>
+
+<outputs>
+    <data name="std_output" format="txt" label="Standard output miRNAture" /> 
+    <collection name="gff3_files_h" type="list" label="${tool.name} on ${on_string}: GFF3 file">
+        <discover_datasets pattern="(?P&lt;designation&gt;.+)\.gff3" directory="output/miRNA_prediction/Final_Candidates/" format="gff3" visible="true" />
+        <filter> stage == "homology" </filter>
+    </collection>
+    <collection name="tab_files_h" type="list" label="${tool.name} on ${on_string}: Additional Files">
+        <discover_datasets pattern="(?P&lt;designation&gt;.+)\-potential\.txt" directory="output/miRNA_prediction/Final_Candidates/" format="txt" visible="true" />
+        <filter> stage == "homology" </filter>
+    </collection>
+    <collection name="yaml_files_h" type="list" label="${tool.name} on ${on_string}: YAML file">
+        <discover_datasets pattern="(?P&lt;designation&gt;.+)\.yaml" directory="output" format="yaml" visible="true"/>
+        <filter> stage == "homology" </filter>
+    </collection>
+    <collection name="gff3_files_c" type="list" label="${tool.name} on ${on_string}: GFF3 file">
+        <discover_datasets pattern="(?P&lt;designation&gt;.+)\.gff3" directory="output/miRNA_prediction/Final_Candidates/" format="gff3" visible="true" />
+        <discover_datasets pattern="(?P&lt;designation&gt;.+)\.gff3" directory="output/Final_miRNA_evaluation/" ext="gff3" format="gff3" visible="true" />
+        <filter> stage == "complete" </filter>
+    </collection>
+    <collection name="bed_files_c" type="list" label="${tool.name} on ${on_string}: BED file">
+        <discover_datasets pattern="(?P&lt;designation&gt;.+)\.bed" directory="output/Final_miRNA_evaluation/" ext="bed" format="bed" visible="true" />
+        <filter> stage == "complete" </filter>
+    </collection>
+    <collection name="fasta_files_c" type="list" label="${tool.name} on ${on_string}: Fasta files">
+        <discover_datasets pattern="(?P&lt;designation&gt;.+)\.fasta" directory="output/Final_miRNA_evaluation/Fasta" ext="fasta" format="fasta" visible="true" />
+        <filter> stage == "complete" </filter>
+    </collection>
+    <collection name="statistics_files_c" type="list" label="${tool.name} on ${on_string}: Summary file">
+        <discover_datasets pattern="(?P&lt;designation&gt;.+)\.txt" directory="output/Final_miRNA_evaluation/" ext="txt" format="txt" visible="true" />
+        <filter> stage == "complete" </filter>
+    </collection>
+    <collection name="yaml_files_c" type="list" label="${tool.name} on ${on_string}: YAML file">
+        <discover_datasets pattern="(?P&lt;designation&gt;.+)\.yaml" directory="output" ext="yaml" format="yaml" visible="true"/>
+        <filter> stage == "complete" </filter>
+    </collection>
+</outputs>
+
+<tests>
+    <!-- HMM Rfam search -->
+    <test expect_exit_code="0">
+        <param name="stage" value="homology"/>
+        <param name="subset_models" value="fam.txt"/>
+        <param name="nbitscore" value="1.0"/>
+        <param name="database_source_selector" value="history" />
+        <param name="dataset" value="Dataset_mirnature_tutorial.tar.gz"/>
+        <param name="speG" value="genome.fasta"/>
+        <param name="speN" value="Unknown_species"/>
+        <param name="speT" value="Unsg"/>
+        <param name="homology_mode" value="hmm"/>
+        <param name="repeat_filter" value="relax"/>
+        <output name="std_output" file="test_hmm.txt" ftype="txt"/>
+        <output_collection name="gff3_files_h" count="1"/>
+        <output_collection name="yaml_files_h" count="1"/>
+        <output_collection name="tab_files_h" count="1"/>
+    </test>
+    <!-- Infernal Rfam search -->
+    <test expect_exit_code="0">
+        <param name="stage" value="homology"/>
+        <param name="subset_models" value="fam.txt"/>
+        <param name="nbitscore" value="1.0"/>
+        <param name="database_source_selector" value="history" />
+        <param name="dataset" value="Dataset_mirnature_tutorial.tar.gz"/>
+        <param name="speG" value="genome.fasta"/>
+        <param name="speN" value="Unknown_species"/>
+        <param name="speT" value="Unsp"/>
+        <param name="homology_mode" value="rfam"/>
+        <param name="repeat_filter" value="relax"/>
+        <output name="std_output" file="test_rfam.txt" ftype="txt"/>
+        <output_collection name="gff3_files_h" count="1"/>
+        <output_collection name="yaml_files_h" count="1"/>
+        <output_collection name="tab_files_h" count="1"/>
+    </test>
+    <!-- Infernal miRBase search -->
+    <test expect_exit_code="0">
+        <param name="stage" value="homology"/>
+        <param name="subset_models" value="fam.txt"/>
+        <param name="nbitscore" value="1.0"/>
+        <param name="database_source_selector" value="history" />
+        <param name="dataset" value="Dataset_mirnature_tutorial.tar.gz"/>
+        <param name="speG" value="genome.fasta"/>
+        <param name="speN" value="Unknown_species"/>
+        <param name="speT" value="Unsd"/>
+        <param name="homology_mode" value="mirbase"/>
+        <param name="repeat_filter" value="relax"/>
+        <output name="std_output" file="test_mirbase.txt" ftype="txt"/>
+        <output_collection name="gff3_files_h" count="1"/>
+        <output_collection name="yaml_files_h" count="1"/>
+        <output_collection name="tab_files_h" count="1"/>
+    </test>
+    <!-- Combined all homology search -->
+    <test expect_exit_code="0">
+        <param name="stage" value="homology"/>
+        <param name="subset_models" value="fam.txt"/>
+        <param name="nbitscore" value="1.0"/>
+        <param name="database_source_selector" value="history" />
+        <param name="dataset" value="Dataset_mirnature_tutorial.tar.gz"/>
+        <param name="speG" value="genome.fasta"/>
+        <param name="speN" value="Unknown_species"/>
+        <param name="speT" value="Unsp"/>
+        <param name="homology_mode" value="blast,hmm,rfam,mirbase"/>
+        <param name="blast_strategy" value="8,9"/>
+        <param name="queries_to_blast" value="test.fasta"/>
+        <param name="repeat_filter" value="relax"/>
+        <output name="std_output" file="test_all_homology.txt" ftype="txt"/>
+        <output_collection name="gff3_files_h" count="1"/>
+        <output_collection name="yaml_files_h" count="1"/>
+        <output_collection name="tab_files_h" count="1"/>
+    </test>
+</tests>
+
+<help><![CDATA[
+    
+**miRNAture** detects *bona fide* miRNA candidates through sequence homology searches and validation steps using structural alignments
+with pre-defined or/and modified miRNA-specific covariance models. The miRNAture pipeline is composed of three modules:
+
+    #. Homology search operating on miRNA precursors
+    #. Prediction of the positioning of mature miRNAs within the precursor mature annotation
+    #. Evaluation scheme designed to identify false positive miRNA annotations.
+
+This multi-stage approach generates annotation files in BED/GFF3 from precursors and detected mature regions and corresponding FASTA files.
+At the same time, a summary file with the MFE, precursor length and number of loci of each annotated miRNA family.
+
+    ]]></help>
+    <expand macro="creators" />
+    <expand macro="citations" />
+</tool>
diff -r 000000000000 -r dd2f87ccbd2c test-data/Dataset_mirnature_tutorial.tar.gz
Binary file test-data/Dataset_mirnature_tutorial.tar.gz has changed
diff -r 000000000000 -r dd2f87ccbd2c test-data/fam.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fam.txt	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,2 @@
+RF00027
+MIPF0000002
diff -r 000000000000 -r dd2f87ccbd2c test-data/genome.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/genome.fasta	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,2 @@
+>scaf1
+TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACATCAAGGGAGATAACTGTACAGCCTCCTAGCTTTCCTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
diff -r 000000000000 -r dd2f87ccbd2c test-data/mirnature_selection.loc
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mirnature_selection.loc	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,1 @@
+Test-homology-dataset	mirbase_sept21: test	${__HERE__}/Dataset_mirnature_tutorial.tar.gz
diff -r 000000000000 -r dd2f87ccbd2c test-data/test.fasta
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.fasta	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,2 @@
+>hsa-let-7a-2 MI0000061
+AGGTTGAGGTAGTAGGTTGTATAGTTTAGAATTACATCAAGGGAGATAACTGTACAGCCTCCTAGCTTTCCT
diff -r 000000000000 -r dd2f87ccbd2c test-data/test_all_homology.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_all_homology.txt	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,57 @@
+
+.__________________________________________________________________________.
+|                                                                          |
+|________________________________________________.........---------........|
+             .--. .   .    .    .                ._________________________.
+          o  |   )|\  |   / \  _|_               |                         |
+.--.--.   .  |--' | \ |  /___\  |  .  . .--..-.  |........---------........|
+|  |  |   |  |  \ |  \| /     \ |  |  | |  (.-'  ._______.         ._______.
+'  '  `--' `-'   `'   ''       ``-'`--`-'   `--' |.......|         |.......|
+Computational detection of microRNA candidates
+v.1.1 Sept 21th, 2022
+Cristian A. Velandia-Huerto, Jöerg Fallmann, Peter F. Stadler
+Bioinformatics Leipzig
+University of Leipzig
+
+[PROCESS] Generating a carbon-copy of your Unsp genome
+[RESULT] I am ready to run miRNAture
+[PROCESS] The dataset_23.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_23.dat models on Unknown_species genome
+[PROCESS] Running Mode: blast searches
+[PROCESS] Generating BLAST DB for the target genome
+[PROCESS] Running on strategy 8
+[PROCESS] Cleaning miRNA homologs from Unknown species
+[PROCESS] Structural evaluation of strategy 8 complete
+[PROCESS] Running on strategy 9
+[PROCESS] Cleaning miRNA homologs from Unknown species
+[PROCESS] Structural evaluation of strategy 9 complete
+[PROCESS] Running on strategy ALL
+[PROCESS] Merging candidates on blast
+[PROCESS] The dataset_23.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_23.dat models on Unknown_species genome
+[PROCESS] Running hmm searches mode
+[PROCESS] Merging candidates on hmm
+[PROCESS] The dataset_23.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_23.dat models on Unknown_species genome
+[PROCESS] Running rfam searches mode
+[PROCESS] Merging candidates on rfam
+[PROCESS] The dataset_23.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_23.dat models on Unknown_species genome
+[PROCESS] Running Mode: mirbase searches
+[PROCESS] Merging candidates on mirbase
+[PROCESS] The dataset_23.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_23.dat models on Unknown_species genome
+[PROCESS] Merging candidates on final
+[PROCESS] Refining final candidates on Unsp
+[RESULT] Detected homology candidates by blast mode
+[RESULT] Detected homology candidates by hmm mode
+[RESULT] Detected homology candidates by rfam mode
+[RESULT] Detected homology candidates by mirbase mode
+[PROCESS] Cleaning temporal files...
+[END] 
+-¿Olvida usted algo?-
+ ¡Ojalá!.
+
+  El emigrante. Luis Felipe Lornelí. (2005)
+
+
\ No newline at end of file
diff -r 000000000000 -r dd2f87ccbd2c test-data/test_hmm.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_hmm.txt	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,34 @@
+
+.__________________________________________________________________________.
+|                                                                          |
+|________________________________________________.........---------........|
+             .--. .   .    .    .                ._________________________.
+          o  |   )|\  |   / \  _|_               |                         |
+.--.--.   .  |--' | \ |  /___\  |  .  . .--..-.  |........---------........|
+|  |  |   |  |  \ |  \| /     \ |  |  | |  (.-'  ._______.         ._______.
+'  '  `--' `-'   `'   ''       ``-'`--`-'   `--' |.......|         |.......|
+Computational detection of microRNA candidates
+v.1.1 Sept 21th, 2022
+Cristian A. Velandia-Huerto, Jöerg Fallmann, Peter F. Stadler
+Bioinformatics Leipzig
+University of Leipzig
+
+[PROCESS] Generating a carbon-copy of your Unsg genome
+[RESULT] I am ready to run miRNAture
+[PROCESS] The dataset_2.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_2.dat models on Unknown_species genome
+[PROCESS] Running hmm searches mode
+[PROCESS] Merging candidates on hmm
+[PROCESS] The dataset_2.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_2.dat models on Unknown_species genome
+[PROCESS] Merging candidates on final
+[PROCESS] Refining final candidates on Unsg
+[RESULT] Detected homology candidates by hmm mode
+[PROCESS] Cleaning temporal files...
+[END] 
+-¿Olvida usted algo?-
+ ¡Ojalá!.
+
+  El emigrante. Luis Felipe Lornelí. (2005)
+
+
\ No newline at end of file
diff -r 000000000000 -r dd2f87ccbd2c test-data/test_mirbase.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_mirbase.txt	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,34 @@
+
+.__________________________________________________________________________.
+|                                                                          |
+|________________________________________________.........---------........|
+             .--. .   .    .    .                ._________________________.
+          o  |   )|\  |   / \  _|_               |                         |
+.--.--.   .  |--' | \ |  /___\  |  .  . .--..-.  |........---------........|
+|  |  |   |  |  \ |  \| /     \ |  |  | |  (.-'  ._______.         ._______.
+'  '  `--' `-'   `'   ''       ``-'`--`-'   `--' |.......|         |.......|
+Computational detection of microRNA candidates
+v.1.1 Sept 21th, 2022
+Cristian A. Velandia-Huerto, Jöerg Fallmann, Peter F. Stadler
+Bioinformatics Leipzig
+University of Leipzig
+
+[PROCESS] Generating a carbon-copy of your Unsd genome
+[RESULT] I am ready to run miRNAture
+[PROCESS] The dataset_16.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_16.dat models on Unknown_species genome
+[PROCESS] Running Mode: mirbase searches
+[PROCESS] Merging candidates on mirbase
+[PROCESS] The dataset_16.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_16.dat models on Unknown_species genome
+[PROCESS] Merging candidates on final
+[PROCESS] Refining final candidates on Unsd
+[RESULT] Detected homology candidates by mirbase mode
+[PROCESS] Cleaning temporal files...
+[END] 
+-¿Olvida usted algo?-
+ ¡Ojalá!.
+
+  El emigrante. Luis Felipe Lornelí. (2005)
+
+
\ No newline at end of file
diff -r 000000000000 -r dd2f87ccbd2c test-data/test_rfam.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_rfam.txt	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,34 @@
+
+.__________________________________________________________________________.
+|                                                                          |
+|________________________________________________.........---------........|
+             .--. .   .    .    .                ._________________________.
+          o  |   )|\  |   / \  _|_               |                         |
+.--.--.   .  |--' | \ |  /___\  |  .  . .--..-.  |........---------........|
+|  |  |   |  |  \ |  \| /     \ |  |  | |  (.-'  ._______.         ._______.
+'  '  `--' `-'   `'   ''       ``-'`--`-'   `--' |.......|         |.......|
+Computational detection of microRNA candidates
+v.1.1 Sept 21th, 2022
+Cristian A. Velandia-Huerto, Jöerg Fallmann, Peter F. Stadler
+Bioinformatics Leipzig
+University of Leipzig
+
+[PROCESS] Generating a carbon-copy of your Unsp genome
+[RESULT] I am ready to run miRNAture
+[PROCESS] The dataset_9.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_9.dat models on Unknown_species genome
+[PROCESS] Running rfam searches mode
+[PROCESS] Merging candidates on rfam
+[PROCESS] The dataset_9.dat covariance list is correctly defined
+[PROCESS] Processing: dataset_9.dat models on Unknown_species genome
+[PROCESS] Merging candidates on final
+[PROCESS] Refining final candidates on Unsp
+[RESULT] Detected homology candidates by rfam mode
+[PROCESS] Cleaning temporal files...
+[END] 
+-¿Olvida usted algo?-
+ ¡Ojalá!.
+
+  El emigrante. Luis Felipe Lornelí. (2005)
+
+
\ No newline at end of file
diff -r 000000000000 -r dd2f87ccbd2c tool-data/mirnature_selection.loc.sample
diff -r 000000000000 -r dd2f87ccbd2c tool_data_table_conf.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,7 @@
+<tables>
+    <!-- Locations of dbkeys and dataset files -->
+    <table name="mirnature_selection" comment_char="#">
+        <columns>value, label, path</columns>
+        <file path="tool-data/mirnature_selection.loc" />
+    </table>
+</tables>
diff -r 000000000000 -r dd2f87ccbd2c tool_data_table_conf.xml.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,7 @@
+<tables>
+    <!-- Locations of dbkeys and dataset files -->
+    <table name="mirnature_selection" comment_char="#">
+        <columns>value, label, path</columns>
+        <file path="tool-data/mirnature_selection.loc" />
+    </table>
+</tables>
diff -r 000000000000 -r dd2f87ccbd2c tool_data_table_conf.xml.test
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Sun Dec 11 22:28:10 2022 +0000
@@ -0,0 +1,7 @@
+<tables>
+    <!-- Locations of dbkeys and dataset files -->
+    <table name="mirnature_selection" comment_char="#">
+        <columns>value, label, path</columns>
+        <file path="${__HERE__}/test-data/mirnature_selection.loc" />
+    </table>
+</tables>