Mercurial > repos > iuc > mothur_cluster

view test-data/sample2.fa @ 3:f53e9df3e598 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 283d5933cd945b7815b3da2ce45baa60d73e9746
author iuc
date Fri, 06 Apr 2018 04:12:08 -0400
parents 8c1b609f566d
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC