Mercurial > repos > iuc > mothur_cluster_split
diff test-data/sample1.fa @ 0:e70a33ec8f3b draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit a9d1e0debcd357d8080a1c6c5f1d206dd45a7a4d
author | iuc |
---|---|
date | Fri, 19 May 2017 05:15:53 -0400 (2017-05-19) |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample1.fa Fri May 19 05:15:53 2017 -0400 @@ -0,0 +1,4 @@ +> seq1 This is the description of my first sequence in sample 1. +AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC +> seq2 This is a description of my second sequence in sample 1. +CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG