view test-data/output.fa @ 9:21a043c3ae00 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit dfdd4c590370ecb3a9806314d43eb5668e36a01a"
author iuc
date Fri, 22 Jan 2021 01:35:36 +0000
parents afac0d63dac6
children
line wrap: on
line source

> seq1 This is the description of my first sequence in sample 1.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
> seq2 This is a description of my second sequence in sample 1.
CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG
> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
> seq1 This is the description of my first sequence in sample 3.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC
> seq2 This is a description of my second sequence in sample 3.
CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG
> seq3 This is a description of my third sequence in sample 3.
CGATCGATCGTACGTCGACTAGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGCGATCGTAGCTACGTCGTACGTAGCATCGTCAGTTACTGCATGCTCG
=9zp[H>=UYmvRfI!m@4qCy88*:2#tz89_S@258_xЖ Z(KfJM txp'S}GqȎQU\KH,p<)͜ bq)G$&FH /:>S::E őzփWFur"{"(x@.=_Cm?j̪1mߍܔqG)+WtR!n c-\!#tIɦ* ?mm5PBZ{#5LP`RhpSI)k^ۿXˈMEhDB0P&hzϻ(JO¤66_{­ ,&14 rg@==/{+㎷@=-4E @+N!c `' rcaqs JB0!0>DAw/03"8䛑ιyLiJLՀGo8^U2.t#Nt2ԴLįl4&﷛A#} FѤB_Fiv߬4C 2; P&).:})4'H̲L|#ۮ $ZZv?u0v'׼ԧJҏ_߿bi&ob<!'1;hl[dM.OcvX)B&`IOzG?iF9|=S?r=?S@hcOעӤK%!ێg1$LNd~x?oPQ'V[d?(ŇZ0t5 @:{a7\|cZa"4L:CGXՂ]S՗ZӦҒԶ`&D#p\ ۞HGHP"PEi(84 Jo?I .sחXp\]9Ɏԛck63dLX7E*dCA&@A~g ;)UݒꁣZuPH4tf9%[㠐7X^؉/崳jfhB@U5!7PdU2pdA"@Qt vb1G҇B1RtI cPF4B`*ul-)A}?2fۦD2K\2hP@3iaܔ]U 5Wy$>眸SktBB'XʆIw)Cz(+YRY+` rM-)k3v-:ָO317%=&i^ĒnE7>4C"A$d)b`@,v2" &At>"k*7E6zDh] {صm01.^& @Ҙ1s0ǣ0=\ȁ hZTkgg09iZV 9ՂWwXS+GOnJ1."6-2e#HR06?SM0"a,S kko20L]thSjC1O""u_} VK;'T]NVrRCf;`ۺn)*_Mr\D(b]_FZMʆ_ףA|n ^S6ƭ<*T1mƙ`5\G彖crㅰf.Yk:>Zx> WIu?5Z<8YJR'Ԃ`A3/J "@0&R6iSЉk6кAÂY$խ5/ /g0qH6)tҋ 1}MԛbKevݟOPht#1`Ȅ5!Rx96w~~%"%+X%X[/3m:P8`+lXtH#1%makM҄ d2B~0+ˍ|q>:W:2MНN" DIXK` +Da|<d[ A8srWӪz5-KnRUa*b3C$ة) Rv zcP- `!rm4(Rƛuę (PP{`ʜqrs(DxqTt/ddգn;z% EP:u.LԾm;}zv߾/ѵgRP8T,V+ڢ/WWit9ͳV]b X8bYUtug:kZlߴ. 훯cLI; :l ;tkdkpGS1=R(_烍cSv7$Uى9S߭k9kCU,&-Mkq\dmu MUSjoD߲v tԩNjPzxzBRȧla _Gf ٟ펑R+ GӾ=ލ.{:a߸3mj*teapB[߻Hd26C91@os&iYYXqksj VZhLfHMY-~!Q0VL0%ݏb7lCGDtyR)@Ҝy z+ZepBe/ (.A މ1 WTpD|dU)ڶ`z|{ qD]7G(ԣRr7Tm$c<49V7WRW\h=B qmL'F$c@YST$s#P}l28R".昽iHI?{J]7e_[GE7SKSʽVnıx=LYHYTJǸ8#hnP%strib9+!fGnuݎGa I(L>L_NeQN 2d]Xpq-¸-֧h%J.}pjc֊[S`g2=<g^-;VIlivصm(sX.dlk͊4'vRBƢ,RS]c,|k_C6sZ&;Pt0JIpNo&=ve?Zq_$]c|-Mmol\^)z<V Yu%fUD*0tVW LL.jDžtSIS-SL9?]dqo]D\G /sjLENpێԤW4z;ȺT2U??{:;>>=Qs A!lZc)W* f_SiXL* nOX@i+R4I8bmbYɀӥ ^70AcfI_X07gW&8j;Lʪd5wOlP`T3@`VE@ǭ .ے'RѲ}8LqJD{/CŤ>H>Pv}q㲮 CA0CѓhXJ@A4gxpdhCM3s0ySaYLPYBbSAAؠބG:ah]PCShMVbZ\Mpf,=ǣRsM%ӎV:(9&j~pTl1dfDS"i_{dL:(0И %(Rv+NJ$A9(OncN|Q7;V@]' Gw:PZ RA4pI=2|WaKS- QY(xB$"lqΣ]/[4 lTf!5$1p%6]DْfOz9(T xUߞws!&3tJiD ŗ0.vBI3&F0jYRwO.5@ć{^.$nwErEzĜKF}^`Q 0Ӄ-` M$L}bx Om2b I =wu )^0f@_`'i 4Jd4 !z5\ضh-lZ]t}*,"zG 4eDDQ)CBB`ueã8(T1J<~'{8LrKQ^?oXv2%mI)40CLABVEɌqR C)%}'bq6  k!wdB( UtDZXC@R4҆)~OJ=ҁ @7l0 [U)LϧON~%]lFLVMi g P P'8kd޲Ğ@z4.M0׷Iƃ"$;E/'>jnaM*&ZP4Ѕ( ĢP.8 ]/BySCb?w[CFBMs.+67:)|m>AN81p?DZ'CnWAifEb~-jϒsӱr|R`О2.׫x:# I:'DJ$Fīa]MD՞XNYFI?7,*Oz8sNupL=I;lpC2 b [SbPhJx-=/1 O1plH(B䡂yȵ=ϱ~,C )>^ %"> C|xh ÏN778 u.;~^#JHqͼmn؁><$v\%c /l?xǭ0ȅyH48-e|;hiO4t'l%hzq(@4X"y,(ڽ_ߺY̯Jz2sU ]HT9}Ft h4iҺOŠst WM43ıyJ*׀BJi#*zU4oB I^} +J+OIG=(tЧC H80ȝ!J%񎞻 Z$4)-E1RbT4!A CBi=}4d[<):?HNRGHA>bM̊hh 5(f粅( t!KF}geGH%=p0HA ]HԼ*}'}d2q}6Nݬ|KLuV^=)WjL@mPkpq+/Ho;|mu)LHajmC2y6 q}X8^QWm&myOמ#gTXTy%g'O0_8g>;a+9+L2,fg2wP=0.,>u+,dY_JEaeNg'P|ncݞKlX٠ R"SImċ$,ͿKFb5ھso 7.m}ݤ$ K/UԐD~:_t]`ׂ8yM.A+>'=:[`r&~㽌4u"i21j o\@LКsbG:IrRޗ83f0=4A!ekq Рw@MI]OM9ǧ1l{cybcJyH Ŷ5TbvIIU)+뇇%SH $ @/X!a0SG$[ŭ:Gvc'y{ZP^JЭDSgΠBfw% 6 rHKK>TzBi hTt.fT o&:t^ /׎ =-@~(bRNwj '4+'K6=s^X0ᒄ1ԤS"}_} zIwR7u=p1,f heJOh^WVD\1إiL-lz ^Fd=+BzfC=*M)Ҵz@ yEd& - QE7ygϷtxhi@:XAH> %g,'4{j#0BDD9)L*]R1Ӯ9vHBCzfx웎(SeouSwFH$u7nzu_ C)V;5w 8B ɼۿo~uGUoI.Tir93NA|&tn u/U u4^%N#cBQ,frʰ!n (8A UYgbm m߳c-f@@C{B%r2.ʛleib$ bpδjQR][ ԕ6EGEJR J@ Bg@}'>ct -72gCL] ]3VhaGJKy?T iH8H$#n8g^mqX{T@r~H4:7 mJl 䰝{.t%";ɀhΞ 9$ݰԠ62ɵInÁ` >[y䝊TVFpAwJjJZQEkZ^4Ħ_8гk;NYSUa9/ N0Q~x} Ht׈zҡRi:zF~p\L$ K)UCCZ캣$Ot.*K ɉq2ԃ9y.IPH.KҴX#KF;"Q ѼsH X́ TyFl( 嗻 Z;RQU9ǘ+797P `ĺz1vI֨Olnm0M&і R: 4wmJf'nI)3IpX J SawHY{5H9n{<hF԰lЦ8B>2!=؄ NP2 , Mhc/=hӉ 8m%@`:i۹r Yfzilƥ"<n<=(fv8);.wNl 7t &Ec iarV/JDx(22stٔ8ArN J )VSvJ&kKL$`&nk+ (ɡ03;WzSxA ugov_zl&ph˗y>ag$P=ǡhMy1r q&sN@P} 0VP=bhos^0KS9]ƛA u`-$?_p>|vF#=y}XC2'ر)5N4t'NuJhP' .M}INK<SV'@;Sg~!zB*}*N P!RbM=!H]PK o5kcV#C=2KuFJC u҆널g0S.Y3 DUJt 4 :6ϲ. Y! acIvxPB ?EDw<D{mȇ!RfJY 5ڬ4ܐ2v!m5̓YȍVe>C}9IM=i FM+k JД(]4tC$-<#˗WanʱZdґ˰!{9DH*Pt=HQ\D8p{2GNe7tfe{R AEɲOw@Jޓ|1wƶ'I~3`1#p54Ԍ=qfWqh(L3x(a5qдw)"V! C }Ă"lJ]֕CZ}Ru a{Вw%$[evvhqmX14{4lqo{ҞvwhXݮfS֌vp}|WYb0%VdccL"탙80(؎7ɗ[w/ a1ş {B@!] iSd :Jˏq;) #c+Gc& F J4L]Yu %mڨq]ݲc\ st!HoJ@:2šNBÐ,iL_T$%x Sc.^DٮCGc^njMQZj9  03slױL2uFO5כ5+ KqGy;H cOMH5*',ǍKyoj>I\,r@Y3"?㵜dX~;dMٯ[^qy6CgmGZ 0.}  s}ҏ"-4-?X?'O ?@AgVRu6*Q?w6ʈ$)km *g?$ n^-{G'R4YD-#yC0?YTVbUR#-/L Qf]~\y])99l1o3X!tIFU;~wDڅCP[ j-J  dVFYk-'j?Sҵ=kVv@Ě+ -xWl=sEyBZ6f}E%uDΗ] ɶUik͟=͝(Yi kiN_~Ф@&NARc70Y^.wkMqZfWh7un1c(Loy:&:7H3Ҽl7}n Y:.Pz3 Rxc@A1T|Xd  tRɗG񺿏6@EdZL sN+ީU_X]nqzmB v22P(SB=a/cLZz3BkzI_k鰞Os|qqot-ao'uSz۽Un\W#m$'v.j- R1ɜœQ5 mc ֏Mh%&,Qwf%ۡN(lI2A|e Ң XCN9VOC/iq!v:{1UO`L ݞ"GK%_k{2 yUO ܑ[jknXU}{RfC6bhU= J5Zh\R?㉾]R'ݒ |c .& {xcC9*eD~iHypOxIE\ Yr>hy_'.Y)jݢz1NkBYLuq@=VJLzVߓdѽWw6}?sƔBSԹO9#.kPFoM1F [-O]כ}i]BYTGjOj}i݈#tC(]ŌX211nM _Xᎎ H}/~0g̔ljSi Sڇr~Ɵ>)i^w-xtWKJ2qZw2Dq.Ŏ|vkfg=#V?hHy mנtJݷVP7C|L9(UkIg$OˑO~usϱ5q ӽ*w>,M@AzT+jcBlS{&m -=/!ė=ԛKsuQSӥ߶mVhJ\+|ޘAR w4r~>KՐR''N j16[K hZ#>©>TD}_i1E?қRR= Mn-r0jfzӮ_h` G*"ęWD/d֐9=ݢ3kR~s<Yd0րaGToomz욂a)ÜMǻa=Ts"#xE(;YйokʱGɦ 36M8׳X>1@QXWǦ!Ik 4RoWS=E&J<;3|'ͱ))s܅v')٢ ƏSgD~ }/ĺ$M]pOC t\3 &V5$Y 2'5!QhcEhz]n"ܽTӸA2^5}֏/ tnnnj g CwZw@ۋG-(9dc > s.jy$lFWChOH)C0?\9RCD,}:KTB9j[_q=?t< @Il`"̡eNreեcj?#?̌oҟNJ}A G&1]JrioH0̄F Ba d%T}ԜP!vk.(4@hD|"![ys-4̫G@=̎JOyw,įw6qW"@Ye)5Q/8o?o3Uy!;]P4K+6+R %FR4 Aǣ1"\e-׮_3sȶCO`IӖL-x*3"9W"J.T&%Qj[:d8@@Qen(jb KZ"tBj%;v*8ɦeon(+^PRWN!r3n:g;,܇Y|f"!Gl e$AU'$/a>;3z \ A 12y\F3ϑw(ڊr5o3ZR*ODQ ҌWy F!:T pm/ҿ/ d{ Al:⮽K̤d`Qbϐ憎l 5e!& y#0үK8D|> hd`Ǽ1Gm"3׿Uϰa׍ڪK?lO 8?N΃8TC!XhvPG_e:tR"B؇R'C̚eu=6R))t'h rHnTI=5M54ۼFdGuJF6ʩok)"h_*e]5JKX LgޖX+Wӈ兔G1R] vĥj6&fWjDٺ&?=꼱7D7t CW_n7sz*Ļ%b)Jrt>̥ݑvC)\҄ O:o8le,$Nkar_[--UX1B5xqʮ|ӏ\:}ҴEnƸ+Q{(5Zn 72[B 5O JH:VJ8 |?vY*L5FO)EJ %>&JLd O9?]n~_R#c`XՠX e?? & -S_X?&TCqΟv>7/c*h4CI6*oՁ;u&KNUÃ~-S~ԅA]{]7.pк\M^QS~C{7;=dvaWl̠lgl53К0t*[ܥ{g{^H}ƫ='NBJY,`/(E[m*{ ^oE8I'evEpt}OcӺ>kVϟSG-=L춅&4Yg$MSE_dhj #w~AcH zHהU@cI՝g~>D+U/see0&Abѕ٩S#'ڋiz'JǠ0Q~hB*Rp|WԺQ%ag'bsfjAe J5ٗ a )y.P8螄f9[4o_ԕUe"@'#CrԘG(7X[WeKLa*Rt*^+y1c[@XezO# jL+Y;5\ ms^^!WTAM St6dm//5#ԩ Gk)#p 6]oMHoםrD#ыwݝh U29Kms%XIa"ZaemgoYheX*H$"C(2NQ<'nU~ђ(Lu:܌mC*!'tX`MPYuoVCຯ{ e&ᵿdRr2P ~ЖOEBz'STuF/X?~}%1UI\Ǻ-}eo&+݀{! PiS劣ךQhJbőIIM[+Jshd8Jx_쿶F'tM}oR7܀v/4{&:0Hz7lP(P\#&3Wm8@37ιE"P`+)蔜0 B ؎„dNG){ܷNG7냦T+,\p=tz$* e<NW=Ud4׳S5yhP M4҉]RcOD?e/Tl\, ®?>lAӅ֑NHO?N"B'bfNv_: h=*+DBB f𳫒j$NBk{art]x4M} ;4#& %ߝ+ߟ UgR1P(vצhdQg'#q9XI}+n~]|]",@88gGnFAն8&\ڬ\vˣb }`׽\MfeWh2dzm䵣,2raC? MF3p;3FKkF8mfk=kdH7Ҡ%( R + -啹:q >©\VcLFZk~(V)+RcN FgBKAHkHb6Z2eP/ C@^F Cw[`>_J)x7аd"jedhdUs@s5@e _IF@ݨdo_)YtF2ο9{W dK(>҉ʦ>sўAMekc4V!<)F: Tk,%cz8FM;t\ɽ6FG ڨ~fN溝#cqa  xS(ռk1T}ڬ'cFM)~vd/=$u;Cr|)2~`K1&.(JBP ?k Ix&pcn]L!;`mJh537b8((L(5@ތ_Vm |L}QAb% |tԚ@GH!R?~6 B<;aI#`֋وsLbP_uѽA# ;n02fT[z5CxHJ< ,JAB\Sdݳxr#B/.I4B6n1 J#aET1B9uơ:B1SUfytdJ^g /ΩjP*7yPici7gWZ_}}V~2ǩCT&~wr\"_и:vG@H{WsLy_OՀ ʝF),[&o0}eWIaQݏ`Hwigɺ6RNO. :Y&#,`5U{'A4=KT  hJ(u#&a5 {0 jfQd)*BBBf@Cf֮\I82D{_N O'tɾH_@ !O+qk0@Y$fU=  H. ] `))d\^!~VG_ekOO+d B_utb=#eT`;I&$ JjJղ;~дEdMcM>FUnVE{xyHHǣ$hHTѴЛMiR3 $2(i퓖2U&>mQOwֈJNp迗bC:oBk /c:`ВAAכuMOr=|T-e/8樶;aKxI9'Cl,B~/'""xzZLv7cEA.-j"(K˭Y"H<%&r.ÀM`vFqQ@9 %H):' =[oZ_opaMg^™߽^v͚?&`Gʂ v%NS%8{a繨 S_Y4'UtCPb @#-A&?H!5B>T==g!ڨE!I55M/lg]`OғTD¦x2\ZE78:3rs; 9q`l7׀CiTt,\@}27]D"0˕=cr uKeL`*_#PQQx2\zH8=. 32u߫щSaic24)AC흸)T7 S!. Kpྡc>?ߟ;7[^ETmx 3zQgMgӢNAʽ׌V"q_bfBW(fxWRo -OhC UT6AW6ܤuUX ϧe| S~RV}[.]Ӭ"45FcFJd@PD3T fdLTv?NW WvR~pm")}-A]A^cm%R!h$CEYZʴD{eI FjoLZԤofRbYg>(bdh?gkY$r~Sŵ .o5 Tci2f6 =DVՠݦNueHE~cLw?7ԻXSݜKNh55V̨ե\.]a }pء2LݵRZ}~jPGDkX$r3BAG9%Hoirk58+Ҟ΋1TTRIK;tޥhdƶrQ`HrKc[87OɊ[sLK1".7O-]E4C+1aA֞6 ^~R.u&P`}0QA@\+B9*qnWz~QŢDdD=͂^w:i'ErnIa\~gRvVB46FB FJ3Hf^:w*E]TUb*U"Pݢc.rB2e4.JHr5Qhz =E|'’wv_Cۓ=gbmbףv5DZtN60tĺ{0t:PَSLSlO|2&ssEDC*Q!7UN?yRMoI59mTҼx4o]x4X_HmdUUCL@wn{E>.ąH=.ksWޅLrtѩc*K`aAMDyMrmU,CrO).םzBR,dIЪjj=WyiTmpv;-O9Aw咄%;]5b```jޕ7v6|Xwu:}Wn]q4|(c*.a @rʄ{!2*ø-VՌy8lB(gkj; 9=dҶ"K$ .!>xzYrYf5F ;~j#֪Z6WPwcijVdèWjhQtPШD X0J;lTjeZD--t%XR \ KjeX]]2e2+$%q%1]tllS..`1`vڍ]I.TPP,TiVDAe.3]2jW vfcS:v)ы4nܠHC[`cmacR]6Sdq+UեCV!pj[id%.R6P%l`)C3!'2FIL$By20X\{ao` g9O0 y(rT$&|!8&>p3߶~bNsR~2y3 ,X/ O?Qc@Fis3s2wP Sә?wO='Pi$=!'?1_+'H-O~L3:I~<O_LuCw:!xZ3t6*O2=VOƿo~ 0s\ƿ_;꿥D?'쓐C|I "OsO$_s3p~m:i:d'}-÷9zyRQ{ݕv>:2P?>~^?tVԪè<7:A w>({)waGMNZk2U=m]MR9j8+a̓m[_C5F`۹jѰ*O_ @(UliMBwQϥ7- 5b *nMA,z!]}u\\{?L~=VEY=[\Ӵ/o60<ꩭĴtTheev{BF{ȷI^elg,M3_ss' /襖u]#z!54G,qEV K=wj2t||q_)ZJXQ?Gk֭a:v2khodKlT/>3 t;@UUT$P`tBɔf 1Jʻn,oK:<;+U3oW_޴3-~z(*x/z%nT]AALwקRgtI #PwԢFG9УJIln?X=Pԙ |ah5iET(V٠l'mRq^WbXLb& P~OqDftvŁ\jQ6*$Tǰ|]g3 LJ^Z|glcmRm/4^hq*Glљs DV”sң ҭsW0j v oS-5U%~z*dҫߑ,BWd _ӈoLF̚f.hdx.)c[kC峍5L}s:$%G 4!V+DzͲdHX6\b2Z\aev2Iv :eC0?##[a#) Ŀ(KuIn|__9: =:Д\I>]p4T^&2pbL{bekDat{)M/3jr˱0u3.McyX:벹xݵBUI$ӝYB;:( GxpC*Ryȶ>{T[7k""a@KDDh 2Y@`@Eb1dG!~* -Mց脄,)˽4rRs&W+w5G&VTwv"foAwv AHf5`ϯl ⇫^9^uN=Z-)Qow,#C*KCqsD,%"b\+]}7=KhP+xdH"oKY-]u1S U>lPfb7ZbbpB^VWbl3C8nfrz{)@[b(#t.c钛v8)9=d!&FGj[U͂B9$%ĚdtJC]07y֥ !OG':w_^մ QT~ Ò5~68R2[nǥʦ쪯O _E’`HBP4GS9[tؾIf>"6۟UP!w=a`ҁ2e _SRrڦn+\_ :6\'Ϳa@dBJ; J?6OPGS*{Tz dS!^JPmMY(յS]WنSKXL= @k9// ?˹s?9*d|Ԟ?t=5M h 7mDaE@+%AzK(-a(9_Zb/Am E& C˿2o@# E5ٽ:f\wfn$QU2W~?3-s /鷭Vs}8h$OeoL goT ?]Vo7{F\~S˭nh` js `)TNaAiNuBڭi] nhE`ha?e! Hbs.G [KzV%^l96Va+ka-LmTVa31X]CdLD1j4ΊmfJcQɭe(P(KV jm%ئ]ˊ̺v(h)LfLD(*'c4tobfEݱjɦ\{4Yj"r>͞XE'q=.G+X6zs 7 8chz<.r6xC co _ tJ"TՍ GgΖs6hi(5$lf̱!Q ?es[G d&YFl02K+t'|:{$+{MnlGAJY r[:%{`H)]YqQ:Ί!&qф`~<t_Je$,Gku,KRnJ`J2 ɮw]H嶏IGJVIf lM:mH9!n@qteon>I.C>SJ}J&|G݌2T1vN?c@}oo}) _GFmLbԲsł\,CQ.Kx`&>q6C? z2!\LH:$ȵ +U动+Z*t B H.uҶ41ܼsՃuL7^l}@"_,^wUsPfx`wbI%ڇ88'8CCi;/$2BI* veI?A4пHt'B>{?{يu_sc5d9)[%ISM 0h)(*`@Cu+Gg3&?rxҜO%=:ZnͻIjA%F~wob?^9vO!$t ->OzV ArNTHow:4&qh(qv3WQ.5? }nfR0x1rIq~^8:S w'uv,´@xP=* hxN#{F0v HGR7ڍ3{l +s' hD(B4s=sS'])#7:9Sى a!{L CTc_mC쁖!.1˫!g͞aȬ#]9 V=vg#Jz0z @xRm I&$;5c A?Du =*6GdK;&:0mFF*D)Y*Gb~MzYIHQ< n7 tRE@unPf][g֋a#iPK%mt+xHc~) m:99UɌI=O;2#1[Ș#Je4N`Adϝa`$SN}z@SCVaYH )=%+=ܷ xX!hrAHQy퇸4^r6+%kX:KI] (,$i,:CoXVoo/ M=pܧ\yq%8DWv" Z6^Ñ3o#örW󻟎KadQ,O#*3av8wosǸwnxbR#24RrhE͇p= H?t4)и>.Ie03so?ߴ~|N~N'>KXEX +d$]<_iH#&jlAJicm4)`hxuCGD1w>y+I E:tP0SdduQaT,Gb dV{7m;ukO`H&Q!,9E>qzQ(`, v,`Δf{gHD)IQ(0J4(]1@GBG z!À5RclF;A1W7A1@%d X߬_Ī8{ɱI%hʮ͇lub:z^ ?R{U|0_:ML$<`ʁ.G>k9ƋByN[8c= >4:P:WDLӰzKuU t5 l gK dCCZ0wM!ˤt3);\6C-Sr^qCnx7Hs2[ɞy vͽW(3bԄ=<gj=N{JNMI$CFH 0hN0UyUZM$0u:Yivm AeL70 s$ ">AKy<9dc!trU30?O:ۼt|Ǯ~){9|1kT P]OH fDkiA8:#OGF-ߞM+CϙϘe-h XeR# BTbTXج8LI) 4(QO1uBN_Xc =$ ÎBQ1PrfhR[0ZXj 0h\fD&}tw4BТY&MoWN MWvB&@ @/@/S҅"S' CFAv瀱'$[K`a$' }g LG PD !A@Q׎)i:OHh I-jWS"-+i}X[Ü*zL:@J'j؃4L /r TR5m'KJSv@6Һ]:L fC $(C;LҰJ [׸E۲Oo׍b9'H\`s'VĭђB@dURSJt!H%PyaN$l1*z𜒋$:uК44K 0V I%:L.# (~C$qCw4Jpa d9?Zla$uk7?ob1A@Q7ܫRk-8⥹>dWd+gީ쇧{ta>Esa1Tf:6?zv GGkIS(5R%HˮN@TfSCOd6ew ݏ@E8U)c`rf83U2bNDuZ΃Q4`[ vb'u(-"OKU0kL?g{]V![dDAlGkPo?JI+?LL! s GLG m|[h$6T^6BuFIS(kS)sKvtCmcr$ebz$K?/ z#-'e`3~϶o|(f~Q%I\Wz7z 9/TW XH涒Sl\gaXDuK};bYoża%L 0Ўh҄Z\X,4-uǹoCm"d^>:8QZ|Ak>[jT\\+뾝\3pWbcֹܵIyht0)SzoǵsBu.aVؗCAO(^i3ɞv] AƭT=PD`=.%`o^&z&%Y@a7_\=K! TSih A8e+$U T2qP f{tvRrbCw-8рҚ{;u$`ak܍R@iZPhյ -lDM&^%~ʝ2xbǚ('ckiU:%44]h$ٍ\D\ :7WӪ)g怽M4Ma\쾀)X 1@c= p I|Q*Άܲ-,J(|q?} _M Ҕ HJ:U @4%% !Y?>G9a38Z#N^a =LGc=K,7(!wy߯O\t|uz"sJ_KUB3Y hx꦳2H :NY?C!7yxs2(Wa/MZ@a XF(zm}{3,~~$(!W )}㕜YC2}Pw`}{dJwt$ydwn[y׬LtQ=+IFoTJx"ŊF~߯CbDxB4'c[< SNr+:W 7|dpđkb#ӫĩ'J"ҩ=0nNy߿:3׷#}xHlH&x fT siґ20K IR%1IRc`9P:N!dP^9LSdQ$UIDSI,4;qьs.c29'^x_u׵TU0HӮ;}@c qGf^}RCC <c*A9hMF؜`w!P:PKgJdamLj8 KfNavH΃'@ji|&y{m6 <װkۃDK{هeD-DYA!ZBX;%H?O( F%"=@'<` t=RhGH>5҉IsL?n+WcNWqwdZ8-M'jCqb*]=Pc;HcJ[vքq2Xy={=b :U:"4DJ_KzPt@iO [ Cۺf{`(H=QINTC5fhĉ,zĝ8a\I9|Nڄ,]] :z/`?><(&\ie ) t9&0(`IqTX'1Emj(;҈4Vt" !m4k X]8Dbg#1^5ˡaCFM0`&`qWuyܱ5&ҳg"6iy  U>sETQdcQAh/M6)R 儞yD;**YRB9F"]^6$ɢ1cY*-X%6-[j: ƃŴ9'XP"" 'NdM i8H7O®,2hBk߫ʤ)_/~ɟykjm ]|b2ɟ]3{s|RNiKz%',oir+O=# [AT7P8B 59t0c`L )mfē"Ea(rejlV9 .,cD*tTg<иԗn{fV6E&'\X<ǑQhwChrH_ԋ56;t\vm|-u?>9 |J?.dS/?e+a(ØT'!C뮅AGtH?COU`~0?ٟN@QϺDO'fI]Hd$YpQ$ K!08:4}C}gР  5dKX?n?#gJtaU}3P\=oXS"R{/,TBÑzڸj21==YǽU#}f Th 52?nmZYْwivhbQjoH-hkgӥ*z|c?R0[ w j52ZF61Fe ~wog~ D56~_o{ԒaaKiXw-$ΧS} t=4 PXTJv]\D%L/;V J+V)ן9~[9}9 ,,gZPD}9B%"a,!N.,ƴ ׯtSu d[rSҥM("6* *l:-$ѢADFUѠmłŀI=ۆ E1m0irGּ6Bi36Rwt@m/A4]Wvx^éy յ#]p2wC(.vEHD:q͎(\PC9Ѿk~P1 ̛t-:XYP:%7h9*vhȒ+f̸=ďUp.?? 4\uc+zA2өN*MMzY. 1\\Uh:ؼ` #BZldl6u@{!;(tt1#ON` d y؆3hPPß\!C]j4M" ::>}7~ۓxMl&!lsm7gu~=`t>BH pMѕKP(Y7oDm{' AW)"0D_Ǻ̾>FN(G=A"s_#0! Ԇ9ΥBWFj%M IS݋X8j.n2TssPf@Kb,EB^M2 c+ #Yճf,꽺`3ò!5yK,h RPJ((Jñt"UЃYN!l5R$?O߱XbeHdP2lZl& W;9Ҹ5dbn{;6Pc8j|1$LXh6$lD10;' ~9vl=4. $l\ 0X1PIhf"_B$4x1wFH8('^ u #`ρ;  9 i_qN߼셐hXR>W8/ZR'B7;K*leSpj\: e0 =JpN}ܔڙT-cN@Lik/@sl$Cӷ g@zk`L=ωe ;NmZ].B!]6Y5?i%L2ns߯ߚ'EyV>?b+E >+:UH>U^\ WaCxΤC/)>u[1U{w7Jb_]H2(Oicg~KC(-A]-C_1ZJve%` 19I jlj *cKQNkpRvl[&:G @&Ӭ0SCH]DuGde@cOt|.qM6_4aL)b|֮MJ~gI0l,KcMNco;ٯ#D >⨉HPIwa9y^P c=kz.?FT_ Ӧ9h7Gdf3ZkQ 2tCe;جlvL^)Vfd"7'L۝B@E11WR?4z%R۸'ޖ@ S eWMnP>U~^ČKD#D4C5䍂 rh%ho3m!Y=W;붶\q$$-5~aS)) 0fXx2 |=Kk䢛P45U]mS'\rt#MMQ<{n״ɸJ{қ\r jB.$ Q|~Ֆb"~^H'ѥF:\/nBbbfE Y#(y#ʊ]tƻ rN"4 ZM& K`J3hтʹnV6l FB&CF_@Lۡ͌쥯SťJ ̅)h@?/I;\`iI7nO!96d=D@? w`@J%Y\0&|_t@{z IO|dJ#qtqIko A h=PbZ~H=:NfmPhU@H I6JE&$ w%F;qޤ#rAJP!c$3Y#KcÉö g,Gc!KQ@Qt3RL#jKqֳO<# wg,ny!iॡLMA,xI^J:))kH[A_@tihXbJHT[*Lm)wM{go`B85 dʀSC)k';=&NƞwىJUTJM ((NmZZQb)2lmۻPGg]ĕ53۞xNiP4^:pKD@SAZ2XشFc#hIݗLtzr{o8/L^8/t)s,2v BڐS#S[ 8(PTN6ih(1ZSnm4Ewq\@ąb:VkMpNMhr LLbvQ F"ضb)" h5w6Z^^Ъ3l3F2;=&GG3wH\`A'qlu0nh 쾹 Ìg1HcpD&ax}/Ϸ6]sRn ;!hŢ F}RD>@ QħJc 9}}2"dVv8;Gq$I v-v4v|e e`.cC*D: Q@nqyn!mts b'\4tԐK8dҾH$In0`*7Q2)pb(`:mt4KBmdaL$p:B \ºUs"Drkd4 O9%9al?<WAA׸2J! H" C1Upzz"H&+CҜC֚ibF_.imQA/"QA`|EhT@e)<(@ST =l@(f 0,|@n=Pz &6 ז& J@r2'Jg]^9^BA7rơ\Y=<$' zށ WݜtLk'#it w9ti}}.4өCAMLy6DpDw`:ceSv4R$ 3ai!"'8 6W P.Ҧl`ljB3@(& it+m.eT*$DsE#ߟJ~m'K8 {t13 d3z'sjCٹ/SW} ['yPh;׉Eo52@J )15"}n(SWVXPZ$jMO˿Uѥ-UWvGȓ3Q Q?Tf-LkXn6,}4KL *iÜzl{$R}0J_c$ξkߙF,BsXy񂮠5~hf*^M\@>;ZzNe/ F&/*cCSÌ%'XqEf77-m.\M'1 ٶ\dӾ խ(HG+z,S05hjl"M@jJ.*v{|_V=O$@@FeICl{zGSٸQzg ``Qwei?BG{[5VЎ ! 1qRWAq' /{c?41yh݋ mQ>e>oSݯ? GkT@]/ g=^T)WƏೆGE4O>VOSG#솽>)~NY$H Y6Ax0^Է+9 SA)'L [43O[YK/[cEJH#^uH^e?~YUt?ku6ʂr4<?y.CIjBd@{Zu)F<|ruhw:U8*tfqp.{^ӱzEK*020gNJr~m(z/0n/5J獭|+ဍ 厃Ѹ4KCheDN\PHBO4DK?8_&ZQBmS DCnem+^ ʊT2uѽ4#m "T}!M A!z(|_3]߇Y8F>#d;n!ro_qP=|>/[!hv'QK쎴Y1'\^h-4hHUx Q~~|u EjPLpefz!`l04@ ݈C.v HGGzrߝů24tK}v#г/7=c>:sͦA$ytKgg,N)[,k^ ;cãH:њG50=.NνT.]=H)(=#Ҷ%0*Џs(۵+:e4IcM(u~_ VLHwYz|}]1ݚ m}8Y/mUf0H(/t=Ϙ@Ǟgvg۹FkQ@1 eUhq}(=7ZSִÔ1uD`y綬KRO'/3?r{}JIo.pfcC)y7"vmոUBp91⾋#w,;`a}"6C3s@,+~O$z=ד4mVbNνŨTKQ?᧫Xc[w.TkLҳa ;k) #i%ƴuJM`*G<_b<4 & =X^D6ֽ{Xyw(x"ϣϨ0}foZKct1aSa3UHg[[C gTCPɚCA ?zC`\۩I6{d\uH۳Z6mt5Y6=6GPZ]]_ޝ (ZQ.bpBHKvdH:@FPtF>UAzH``/ s @ϤJ*\pΎ̪׌Hvb/rJ@%o m ?K~)m?sחۚ5S PfݻN #A8ks]0FtWUXAKp zX莗IBA /+͡xlMWc'jN ~(5>7.TdhdG! ވ8Ng5~(~ϯj}J1&bd>>QQzA`.-?#? MTWxՎ/u2'%:!OG/dD͛ @z]rNZ5.c2&f@ <Vn͸*ѵ_l\ T!vdFvSO@Fݍ r`oJQSQ C  T5Ghlecp| ^q"-PPH9AK.7}—*G4(lS@\~W+!zzt3zl25]8, 8鹰$ʩ0U g{|ib41*v)d`Cb-QӫB(7Jw9 8XPmBndPj@C"Oۇ^!j!/_*VK!I !>Há.LO&u@FmsN?} OsIH6ZeH Z.0|gǸ' B+WixB:0B "0d'mV镘fnXuYKbzo.cKɶ)֖|pP͞ U4N+J7#_|a$ZG d3gW F.z$_>y|cD+qw_DbHIUMsza26P.dPI)RZjCZ= .njIYR2x۩XD3%*rQ]0NxC;>Ӈji]{ot:I#W0{gyY Q{MP"|޽%w-$Bj-?3ϳUésNX- \Zq%\( `,v9[5vyC}c:$7k6v1 JVel׿Gy3gbc1$5-Qev~ctC( F'" LS~[ң':άvG c1t4fK,۹Uȵz39Hh7CiWBgzt["YZb4ШG1*={ɫ5CU#D) 5KYfj82u´;n{]g?K߶v$AUsKh07!zMvSvBިWCr1dAOJ}L_Eur]=lt+q{ D™&A6Y|"ډLLU ߝh]q5(V**J_/>\r4hkTDX⺇%]I.IJ#NF ofŮ\dxK.8TKlZk5G:IדIwĄBKM+Qv99;dU0 *ǥc:ipT+XotϾ$}}<_|<o׽]JdN;E8m]i?/> ';8JL 3"ұ4b5F4 jDNGH'4!>kW (_ү5J/ QI  i(B%E @(Eh@T 5^oAމirڅ(TgU:ˊv u9KŴ[ִQks[ kU*oY6KJJ;&-R&^RެX*\V4xT]mr΃%4{7 S(K#> !ˏkFMZe}@) ?mV1Dq۵8m+cqR#""9xVZWԟX)85/j_tgc% "bMeT`HPbȫׯ:a+6jL$* .0$b:c`h 4>6w'$<8MZ{{q?KO:Q4aY őy64-.RT2N}e #)BHx\$8==4{(V =]4JM yxϗV 2mItr;̼t҆!RyB!Ia*7u* স)xCQE4USg'/Ro"^#r62QҗkhΙ\,Y(+1)kw OLK-'}q>`fmɄ+Qpp Ło#J>B|ƆC$蛰9cdn $BZIk3ȹ̕2.N@bWJ`J A IRb@3 ST'ѤݶH%كU"8- J@Rp~ϐ 0B*(s0!JAB@93ݻ :c2I#;JHd%?cH\3=z_i0 OB4>G#F:'?KKh'M?|1%"茰JS~펳۷ѯ,I ؃q8́&NӣuO4&ʿT 0zw"P@H4SDy&h@A"<_'%K%| 1)?)T=>/}?|?2{4%*J(: >{RϟWQhl6Fґ(A+8AHTfva+! , nѼ+pm*;;G8\z!{n8Y{: ٱGJLbGb̻˂Y2ak*h 4|9!zt Tp/w{svG/`Q`3&ŒT;$kCfN[^AX1(iA ћeVzL!`Dھ]D,(1.fpsmtTKJ-ճBmЂV)i:4w'xΝ+ZҁAN8 t%t!Am ;'`%=b vts ;ZX\`a: 9ӟc84^z8kxs7u5M-k0m$IJu9nwγw&(gˀ?2.i_oA~o;Ū9 #-:aAlx# \Ā@Yd>g7PlyAAC]P׶ЬCǏnmmͨTc9찑PN^{׷? % r+&oes! F;#ٔazFZTYڙQ"Q3LeՁߎK`mN%u0֎ڔ)p;.(QZ%%ew/3ظ* T A`KTs1qqXTc0H4/JtGõkN9! L;u8с급ONg1>܇c/lmz0 Ah@63oc-ηy=Y8)O%ǹ|8 aXиPT4#!V (+s $5i װwrg#w Q*(6V4vUd˜ .r{A=wAh@_C΃2iDqĶkd!$px&ƭ-~3B 5t\,A7zq5$?ݿn) \5 JmdޱdϬ/B 1%Ds ɶ :b`5 %%I6f0M# Z@P7tߗZoQ xb&#ApLmnֱDC{bD,9f]l1% ^duQ29'htFk0 Nam ,:q<'(U uU5 "J$Kp]w:(S\l*PH`aJM`PU ]4 M0:lS:bWfR`y>ạޏ>$/\8-KNO5!4(ݒQyĜzGM&Ez Ӥ KHД :DҴ}(zT]۰b`.\ѸBL6{psE8|zS4e U tiMt: V4!w`Bt Bh:vAҮ=ZO]& }Ebf$Z[Ky!8iUhG<ϷIN"`:˝ :ۻ^+Bt[Z|/d۹ݎ5c%6 e1m3r*Q[G)pL;āJ`Z#d2(a!E8MC%eyO5 ::նEI.` "W]LM)Ǡϻie]gהѱ4cIw ݼ'K,% %( )BЮtBH+x#i2qQPҭrk}MBsǗ  Ή`c** pCaOxRAx'Krچv{D5ɋ,M Rm{Ct*!P:Jk[ʼD'C)i)G*-\ۛ\摒XTɧ4{yPB% l{wJ}MEJ \(@}C$@#AVdWs̮)qh0!{3V¡CadNPCCSuv:k-p{` Lb܏==QlZ*XHj.ztt ATz臼m #.Ţ'IVOHH;uۗ0{Cx$^m8B  Z#t|$<:yۀ)6zspsl~~8ѓ; ?Jb 0xoX$X͹ixKrמK&A"YP)t0͠] x=-"t`ӈZ} ̘y@zӱE<5Zv(x8vt6n |ۘ4hR[IHä#]1 ] í"rfKRѰ aLuݟ : rs$'J!tafA!(hh@fQZzIB!#R Εz03p"BSA؏h=0 'CΕo d, ÍDg>%d͖7;Kh>Hy=Ùdü0qc!v Sg!:tA/:@?Bi]#SCHdw( zAJq<bO 1T5惤r٥`㫵qe%>ςr . h:Lh%vy쥴ד8Ma.YJ@!iEtt=*P hPl{{:(: 1` BIvzDhJ ɫ]!QPuIf 0Hv =;0p=x!!23ZJJrŞ;v8ö[<Nɓ||A m`˜n\D{Gys{1 Hݜ2д St'@'Һ iZZ*- mrfKDK02 >' JP-<ZѧèݎWh /1slDpP8\]54X q~Nhn;8xBx18xk1,!0A'>a2zVs`wyfu'Z+jeؐCC΀,G;'::RY4e L\@6Q''%U A = ,M< ~0}/<`z@4BV(ABk\1X{f&p0VQ [9$ (adP%VB!^rF1j5l6 ^xp䛇^hI跶L( &!^:NHSPyX1'i /qgI]J]82n^ϲ{TQAQ/IhM:@B=tQ]~|xHi^1JUН""N}b24Tݞ?Cǧ&a=Sd(aIhSAm /BbTɆXl9]aӘVYj&|β󎦎hpmX4xq~.:(h@5ЧHR%+a  Yu:3 o.;Rdy$"44(72gHbG2!H1ɂJn!Hh))Y0T%#Ÿ lݪ%%hStzSG@4t^ILBfk#<,th\玊t !ISnW|kּdó5ca,Q'lpSOl/$Щ*:u3LJThg 'Y&+HԞA@5RLsvF8q> 8 ~I[wѭ&7LjTBv5uI%OHt!޷qō-n&2ܘPH{?>hq<:Anђ0شnx@;KFK2=i}|@ #|a k-X %yFibK̞W)vА5-!I?o6ص|(uHY;؏b0x=FK-/mO`t* wg&;<zpCAJ" VÍ_G.5|$CK\%4}v`( -)ȘwSa#O J͊gGe2+e E H:qJBiC̑ts'벷ڰfT`v q$(f`QBedQD٠Yp]__ڜ=H$ Ĺ._]X#Dnll~ӺCAtf "lGl-{WoϿk ֦UZ# PݨUfA5^qMӪVM6b4PD  I܍[]B,^:֏̮W.S||P z?Ll,N W`B[*iASȨ=s!uu;1|B#6 tqUH}#us&J9l@ʴRz 0\V~ P)3$\Wi:+-2lĖ<ǨE<48@㪕^<2zXNқn|-adCM$ҽ8nב(g*u<U-,~ԑxAblvdu ½G`oɪ7d=$Tv[k>œϵ:&f"e5^$PĤe! ͖$@x ]F$b V1|0*%4.ȁZNgIi?65v?DXSjo(!О#GF .ɠ!8hYCQ0xrsk;}_lgz0WQRV0a@~\ 'Ptz"cAU`x͸i6@*[b<^oK9bJLK4|2BWdMUש#AvE&\̞G:>zY XΧ/t֛}XPTAҎ79/λD' $vdAHHFH*MdգTPu~W5N5{ I#}jS2Pfb8U2ϵOb1;KZpƩ:gr_+0Vs XAi^GfzL9=`KZ@In Wztrrtz&ɀ-D`0X0oQN}l>TR~OS ~y/U;+z&! g,H;=7\Z_T G/j?!Hl0LgqsM"i)T1PY0RK=" ao%$~Wƻ'P&gca/+/̦l=Xk@=H6IeW{9= - ehDI"zvb( M@ ]@::ԔK8F6 yϽ @ }^0;!Qo/+Dy iaߊ*޼ Z{_ʰO4vrOgDtaDv>-~ O6Z Տ@;q UVBD` A~[mr֓0=Lυi2Y]?mLJ O6^}_[l2PX`wƷ =XGO Şnv'*iϿrh!?SΤ߆M{j6x}|Fs0$:P { 3n:#aKRY)'fIσ<@OZȀ_V?~x1#)cuUyrx,2x 쮹eM #dC] @D=8^i.{[x%RNB~:P{'vM"c<#6Be}YWl~x=x"@9L*Y\}\( ,u .@001L.- V3T﷬oS-dMUȘ/&U#C@W(Fݕ.dVgk$Zs-$U(@/We]4OmW57./'rX|᰽NDV !!IJt!\xDȡKa@d ´#7tAJB8}E~BGN*\d~y}&=e [?_ϋL|ь}!xpqPAZ>1 R[_u^6Rm73%.ׯ B1,+ ?g\=biq9#>>U{BjIŞfH&GH帯-w$4-B)|, >O/p^_ D0'Bd9͞_A|}Ox=~F{F0gA1 bD3J >%D;iVx'<3n(9;VP'D?{&ׯp!|!Gީ@$dH`zU;2Xp >?ꇂ9,>I{KBW03sC<߿V|=E6V#a-x#!}W|x||}ٖaG"lSͼrqe^ȁ=xq\6($'cQ_9ߦX*le08GCcka . 9:VyqY0f9e<[,pq'FKgGw4Z+AD}1^؄L{t~Wߒ,v|_QƁϦ3Sse`GE EU}MeӸ^H:bd=Mt@s0GtҞ^a.%9Ʒ[x)aDtE{<_;sMrt훮2gŏX锁v{SffJa>)>O麩"xmIY&-'Kكٲ@G)Mg0Z ]ۚ=ΰhb"Dn-:AurM3s8%0 a~7C(x)2uyg md~~S"Sw.ns1 Q'l}T?)S'įX1T)-ɷJyeySBh ͖tL0:n#~$:X$@d5b )Vn{T<X,P->zKJVxf vXAMo:C|m@.$ ?sϗ՞~+\2JK]QI(IӉk9N I=mcϋ9ނ>e7}t夞WHBp_2MN#b=_9ژb :rh &<`N h|P%}Ƿ^&;[hk!P2\r6-uEh k@7I0Hؼ)hy eQD]rfI©p=p?W}=w9׿/aiCA;"'fȱD,%VO^}AI_=>g$>[r $"|hGH0תA~ܯnk&ըz+tݏopeᢪtbdxeu VTͫg" tT4$sc7`~S6v0U R8E.!`Uiy#[|+3Gf2Z6A mqCqE͚=_0z߹Մ, t76]Ɉف[r)(sShΗJD\/ ʜhYLJ>--]R/䴇F|ӢKl𦉰PC!v:  Yú< L?տrF]crG.썤&⋓>9nW9%y,2 R}HGIf@|}o~i\HHl}ʶQ f :A9US۶~1ګGש!E#M_+M*z%1XrƠݏJ!/ݎ ~2}$=> t*ǵ D sPYdMp@F 7\1LÄ^E^ɴR R> >3e{9EF7@tp :I}}Slh|nޏ>ː:3>̡Q) l;-$!W@0t!Tmкao ˝$f ~^MynPV[N#RX [po=Nk<7B Ǘ6U4$N'auRy=6issHdz9xl~>n߫+ wZ~ _)*)BȦ,kde"%'VQb(O-&, SC4Jo}{[Uǿ+Ui qQ"]7?ND¡5\|ϢB-bޛvP{)*EF eFm ~ CTDH{>!q y] 7mĠb]߄M*N{04hǶOnaۭwp@'gVB.p<א[;^eJp x}[GHWK+AA@4ՎRn.c `->{,_ %xHolХ`h@JB!pDGPljȁ;*YN 6xDX$> Q$ *#Z`0ꄤhR"AWQ :a p}{toIE6PNqDW$ ܌PCL+Xa{ \CBZJ}~$:~ &'^(tkkHɎ (QhV#Dq@w}[80PIx0*g`gwj`Qu5f:ȵقݸ#l궩G(s(Ado#GZSg5c?vhhAz-tI*!z-{/{龔V&𬧧/&mfTXވ(cs*7zE 0(W~.Nr#>6Q"뫀O[Y-!Im|/ Yg/[@ߨŭB݁`c]p'?<m?@c= P#Y}Yg&l ?r:%2hOxy:u)[zuNe2@OcG $%"ud얾 }8xsE"4"@CZ0|[&-Y$KP_!W{dP8NDSGuc#A$C4O}!@:-h UO}Fb庾Ҋϋh[ꫢ(?UhI!q @$ uHcyLԨw5DKʫLմX!Z9FRkQh I4K>2m/⇞/x!Dԧgsd((]XgQ"&쯈f;z#e;?e}#-rV)M%4UIϊ}VqO2d u0*":49Ԁ'Z!e'\Da1';^[XO,*Nu?UhlK2hd5 ByYzi'~PH HX~vu$p-EO5{bN ^T{xT:S-vvq :]E#;eTN(?wcBv U73'W<xi v+zM0hR0|Jiz! (nrB"D U辗$Dw!t.fe3ḾAJMޮ04=0h (z%[ cLX𴥊L۾췖SI!q88+y`pyxkKD YE$zAǩBV֕-ۃ~9a%o) sD:X0,ȆgK"U^ǧ%Pg 'E,+U_b/D>X쇧յ^j }[0L!ΛbzH#QAL{z}?u/G(- Z(+}oP51tԌ|[Ф(,򴨯0Z mx߈, + N/\xd6W rmx!~~&:? {Ft~߼lZ-?@[^Y[@iশGs8Vty;qX$z5 |<⤈d?֧c0~4PM``[uib}rr4Y^ڲ4]AnOn苪/ٻ/?>A{%Ĵ@3BbaP".Fsgٗl\ : i2<{h]CSlGeM ks%Ҡe*$ A^ ! .ry=-- 온,U"TAq<fӽ~6K+f%|O;ޗ3r%93%τJM}b#|:=y[tEZ%A8B$ƅώI非j~1rSy)Vr!U:_g=xcT& ~XH!3*@ʩ`T "}ת<Ԇ̶)cmB/6.@*]YZ$o̢M-Ds?KU<M%,=7\箄w{#Q=RJ鳨Q,:x^44vK_dR}pJi=yv^>j^he[Y e@eS]6(؅qߴO/_ fȣ(zxOR?%f(ԑ`:XQW4r[ T(|;x,%a; :A>8iY'ץh,mMjfrVU2?"[#+k1݉[PE+}-vJtOJ"m,8VV- qbr߃D/-u:CtC*QNkx$ˆlY,7P0>.P"D? аws8W8`RLb$DX7u۪TIָ&Xy9m $`k!'fbĄg՞ф!Xj,6%xA cɍRJbHy'geK;Xϡ 4``as)T" (uHchj® ѩB@DȳT321PZܣ|1ք,_TQLBPJZgOhG[2-tQ.& yDNq:i{H/XI,嚊@`Ow8$w5}aD=d.we˝ Aã0H?TF#ʡD:,_.!2׋:)TH:#ٷ-`EʐlױVj>4HLsd{~N+䀏TIi8 bOB~+-a}#4:]g U:RJx6'P~TC&v]w /{pGIiI8#q9ҙ R{"3Zg&L{I/d7mbUſ]r%:zef#CT=jQ:dsL2?KcUUr\RkdF4,ǽ-̿qfgQxćuJ_|7YZvMl0<ع3ӾYs#z 2 $eH kXC<<5ѹPv k]1v 1a (4!:!Ò` tRَ2p/e]rw6@k1 hJ\ m?dPPYj}ŸfH$ޓŶX6] F}ƅ_y\:˪*Z~t(oyZo*{06pPH@,"-+]o,hz 0FAQ17aQ!a>7r.VnvYrT15T[/KtzGX L C7kPoǗ\TL5S2 *MM/!9YΝ,qs2lp<0 tځVj ^9 1XLr: $HZ7==IBkѩlHN,W5ϢP }/'{'{X:eF?^X\7W/ KJON4 rAuI_VhR@~Bߚ{r+xf_(\YʠfWdNڨbnF'~PzO>zF :f 3WMت+ A Ժ*>LD#ۧRM)N# Ev2ʑbSz2i_ĶBp*!m=3vAvX huԬC]t:cs̻~B3 qS AS{\zi+Ѷ+òݭ7ô7O]A JɺB({_Tʒ&F;墨ԚK׃ԘpGkB߫\NsA.Lj|xCvAwxk"VYJ{W‡02;X9`f/>ɬH]G ְ3mēi"g'$ϫ KEM&gp![&wN%s.U1h-D~?\ ⫋ߦvG;rL"$ӁonqTWI[oy5A{YJs 7=zR3n0 G!!̘m,/iM-SD*"C6%ԙ)Os3)cd`Q .` jp)Rގ=gZA8?ɭ9n|hhW6rV S7}'a/'Z?Xk|5> A]=*Ճe|rT832_4[we*T8z0 8f;׌#U.Ԁ4 ^?#r?}`cu%UhBj Q桑C%J"4AAE!mi[ O)hFh&PQLj˥U&JIjꙘC7f bABH:e߯=߅}oVf2 [ Q$iLVZH”BٍS̞o,hz>&2FœH*?t)zS]p8I.[׃0qKl;yvA]jbxEeɖV:Y ,3j-,nHL eTsk-|gWj[qu3H%LV+UdfDF 1)_N yWJ/<;an:tyo%`O4 (t4zxh@%xf˻ڪ 2`_e@T|r\=ӣA+1:5HxVL֋6[Q$kuMxՊ2AqTܕJ9 ;h IwB\^nk!XhJ61%E? <ܞb$B9~6%^0~u?'KH&"D N6pT#tn@ Y^wNTؗ{Z*kXܜ` b^p/SpǹF4EPwA|KВh.䐐B2u$ߵK }sǟ}͊+2Q=}Y\zk}^<da|W|SQ!赡~*aLŰOaPXy^&!$H%%#ubM)?'jL툉 ;ϞbM3Xr7JYH?vWûq0?O4>a@4= W|G k|AKZW6ȗR\Zq:Q~L׊l<<:KYupڋ"ȡ0&} G_j:] |9 i&=Q#=; )ۅq7\ГӸ>"9:pKcXW_'=?W.=Y_Ttř /V-a!j#Be3^Y#ץk1ڧKd<!IK|"_1\ 0_)$qnj&E/@PL"nO3#f,6Ԟla")wh#VZ@:A:ҼaG+Mciwʠz02hj}}yսɘ\De5TIGL;hZʞ=[.B, E+{X &(,`I_ӟ7:33׃yV{G4kI ! TmkDчSj W83Hҍ~hyV!m^@@ /b+Ve yrt$~9T`Ś3B}1mOxC\l:/X-4YA'C8̶09dT9!H~rptڣG 3G !q'.cϊ-&}Юv}ϛw"x$tzR\& DP_׷fV;(օ~r.BHu[!׆?1+ӿЀAR{Oi^a B4|}шݝ9}RD3,zԬ=ζVUk{V>-ke \D}Sk'?R+?C$C0Jh]1`mCrgm Qᶽav2}=m{m mi: MGHvmp j^YUD&Sdt7w%bkI L$׽:"TBX({nd#;`"}=ݖ9ZA)ӫG`_G&_3Uj3TiUĿşzwVpkClḃtiYYDK;^O7W+= CjoB6F 8ZT@Jߴ7zNA BB"%vsZI&mDjs &T ZރwT֎/_n:I "嗯ۭC?GkwC|> +V8.OB-,E̫=xS]Oiw'߱I$VyRKݡ4~$ŢC<~XYtVD5PrƤ@D8k#5Ɇ] JQΥ{0q'rFЀKGDPl}Ï>m,JEC>TUPKOgVρngﭥj%)a}-CqֿSmh3.3 ! >' ڋj_SǛ](im?=~j !| * &8UNgC94prP劮_̻hsF f /GYHUW#wu8$$2ıYzaNeſV]ftBQ7MusְoE-j!DKZՕ˃Ф9]|^/O8;HODQdzYE)xII.(u["Tqy>|w_b`<\ZFT`?`>h]9h!5'kCFRo${tu !E?vJoXbFl[uPbPNoT jjRK5\bU(Hx0F2e5&LSFD C6>ϟT>aU2?;ڡ9nyIo>W'pB*i*AV:j^]{C#s{W_%~zAt8[uD} Cl c&Kq;0{s#8J &ASڽpf"6@)q6u1T] K|?2x%( 8ՊߓwJ%.ok XJ$%VnA.t#R~᪽~ӂB2"x\4u`M&YG!jtibANnh{ߊUҿMԷB%},p0ɺF uV:0=Kn5ؘ!-YYNVI ef^x?e|mM!qRMҊ4Z1uBWU'&x GOdzFDCgPXu1._Nxn)UJ:݃],wVL7^r=֕.ʴ%tÖτ֥Bf j+S(&9]Scow;5zeF+-sPxWW d7T,m$:]K?mj0[&Em5dg{9J<ZHدfCy suCY6#u `{]H cd"Z׵Ä?|$.,0v;H'=R$٩‹J;~u\hS'΢;K:: t=Lڛ-*iQ5`Jsglmr3j͘Y54?|3 nluj % HV_,RaXN6BA"5j ̮ B?%;sWF]g'.Dzkv ;tC0̙jmhh\,hg1L$ɳ3% CAa!9vv` s_Aic Sq4<֟];:f*$|Fyb]!-u m<:N:9_|[͡@2cY42 كA'{"P SzjrV)яN;i+c[w靚?/p0tҭn-&Mhx8t⾮xJV)rJ| Sû9d3L ,ibk EPϴXʣ sƬn ԙn]^wZMՉ{F󷑆UQ'T%Q !]+ eirz*RuGK0ns k8jY'K.|\P 8Ҵ +ETǫ]˶9Xi\$NJ9oi=o] ( b?ƻTJѥ#PFk}t `J?VCI+v[9ѩEi,>6٪3ް¬Jz~zI!Ԇ 2EP)WVy-A-`5hM}ʰb;#R;n-}x1ߑ꫶).a& S~B!6 :"  !]\f(7G(]krK}!W2,?p{|:Oةeq=~& ]T׃dY¼oHYP|%H--&8/(WP)5l=)g)I3|.$LQO ^V_I\8`ߘ.a"߃t=u٤IASNyp:!ύɞvwM[*^f^P_Ŀ]\d-Fדx6;>UMЛA|bm'Fl۔r Q30ʼnK3XA[?գ%D8b|a/Ӵ*Zb%7gCKiY_`.a0%@k1["J="B`z l@QP ,'aVd #N=QH{y(s1[>DgwBRญFViG &i?i^3-&v['^jTcJ_h/]d%Q/e)l_Kp{UX_tZ1rrE!o`P);FEx FVpךgK_W;e5qeRjJQu&z5萖fJaR"TXE,?DLjLABǽ,2=1`Ȣk$8jpcTQMaP^4,\>TggZ׳kx6:jencȣz^bxIBZ}ڣ{mڧJeY?^~BIF{~?1D1/rqQfQYYQC&z<çTpm9e({T=. AeJYQ@A:$;ߎlo,> >dZ\ʪp_Q>M1MU ;--)#N%M3 LUe  kyUhK8^nb]–M OPFN~,-+?99\tYB/ѲVhh6Fiz%wn;;QiN<-0'( t0n,P<5\"kk {#PA#D?r u>ᆴ~;D gn}m,{]H$ OT<31xlL ax$I9/OanMztL4|ψL AR'!H'gUP-U(S_XߣM jה /̩3YU~(F GQ:w7gKًm;@#KA@u8f,- ke8~mg *<7]BhSp,@d =@'@|3T^w[l`| [9$ẠENϳ?@:RVV:( E?^38A;ဝ?lh 72)Y_tڋ\hVuNA `}mO։րTa@+U$E,3!*TЌgf!ݾ3C "vZ"@Ց{:<(cd `'UӒאeOr5{2HgB'v@8cVq2{}33Ϸ!-mX B1F41@KmgLd>?Ӽ6OIqW~x*Ƽ)EZ)^pI1M _ir\n0Y(؆%;##^ݻ^.L&~o]s$ݔϮ})O/Y,HwT:m{,(=u[]VДַ WB4H%~A{aWƇ?6RM:6. ^ui)s2GS-Vdh6{e\3):|CV63T*dB(Hxh_L^ꋿ@\C(1nxd8EYK{![|fj(uJؠjsW:8>}>`="r 3ϫ%МD Ʃ\$8+o{NyƟ$hp%[+MՓY4b[hy?8'}eomc2:s=#E]5I2rSݮHTl%ʆ{+U;^xˁC#@ڪj+zrSTNNSـ~[M{'|&hg:U֪;5-GE(ҪvktD8t- BM4, 'm6q鑍մmYNiCgS^ VIɮ7<\̅b3UiKC6PTnH\MsڥMS1x}Ns럾to<}<=~rj AP?66t^D;Hv5&y3H Ug+vSug6I eOr} =b\repHz}X\v=hvOסV|x `@\urNi!aawl^2>gJo|ܬ+/TXEdƣG'U9cZDRG%~&aL`O}YgdHXXiU,&Ɯd0'ﯿ~ͨv$EntPRKu 7k]6I睰w :Cf|C\=$TZ bF&UF$N0:F0,V$èuuqŽhwWxYۯ," 1Ev%#h!ˀB:!v@Q0HQ;.dCmrj"d͛;>xYC RhäOBˈ]Ր* }̹Z뺼yV,"s͜ 2>+:UAT.jB>N }=Os:p8p5ğ$x<<vK;b^ j];Z4@. 3Vkճyr帆>©V*Z ~[9!jQam0ddXf<|< ւZϖc#ԩqJH 48DQ5{ӛ]cn|܋cH) yہY‰QjkGK~CcXv桾WK:E%W۩K VM#H"\4Њ ժNntфGC {n%AVOM`rXw><$q^˝tL5b̬{lfg_F}`yWjY8J֢Y}ٹg+2puO?קK;B}b*s%rLaNҚS"*H~ !dߦWo?UXd%b&d$ߛ9 S'f|G-p0Fe^Sc.F<:ڲi2@rΙPUj"tQؾ a![dD b(Rf>ݬ_>^Y=zgBcdVO0GHLI] 7~h?ȕCDgdF =6hMU``N'D0N5hmA$#ؓC֯vE Wpt~|{J:'KԼXzA4aZ#:S5@2-V+F뵬i2Q:vƻsMsv旡sä[{Ԑ:2PqsCSLI[W&kRT'2~bc o|K㷐sZĈW$T;y?ztI\,}q[^OM`|tY5Tb񧍎I;Q{'JG[bT?Mg$H{!T!tS\W*.-z=qerGWrXZwI KLBǚtZ$fVVTxNVD;M铪@cT&[\U&-x|mnEO8b:}X %M` ѨkџM(Ts0a |^;B{x? gs+rՆjf0(`mAVY(nT*P^釽p,T)H`ZQmX\ļ;[7JO%_tYrfY:[~ L{Q{> `TX sXB+Ff*G<UJ͉֪`0NkpAi1YFWʴ=xWԫ ֮C! XC@3/'uO˃9)qݺcU)3CUn1EoMKE 6e]H2Y4FQ}I[M{hZa㮮Mݭcj%5,6MCVRHu [.k;Z_hC)C:Fr”>J cyGsiKe6=*Su3ҭ(P֖T=wLv v*q+&I}HZ ,UD^[=w{XĐ@GJ{F-͋%ZXT`O~-{:zrNqiFju[ouUÛ]ZoҵțVY h-}֋,vQJyLtuCt~9tF0p"'E0xDBΚZI|o ^"nH3/*`*D0\.={!~<#e(ֽԤU.,r0GKsû Su.+-{ 8hexHTX!12CaF*PLũF`nY1ɴU C6 wi7\=hI6D2zXY\WuH)ŌuMW޷g=vKyI*#*9ES|U%j+X0dk XǴ1]P Ap>҂I  4`x6k]5{[?RGóh.PI1 ;1فg $pDӦ}OTfT(lȑQ=vkܲfC |)Qt*H܌jY`A㻭WK?8pT:Dz&7h=s;ZXP?;rwxem?/m,v.̃^,Q!ƅozφ0w:' a8RR9g[9?)ȇlI"KS[;~q//9F Qg[S^T]Z!>> NJE|6*1j^7? L[%#%j n* Y:G:%vF&cS" "h2#]H M1;J%F^4?}2JO@Yb0/.FT,Yj懆y]̳>U19c5;Ϊ `F-ObŌM-hOd [-%w{pwU5OR%0x1f-0;RT+[(7;Ҝd+b[#s5ӼG#˭{ynYК(ftxc j+-J}PCf{M 6 0q?T࿳A?-,繹e+8?\sp,-=''/@ oQq\0]O7%*q a͂M*}Ex뼯Վ5ʣe:^h&tkV5c)Yqe#E meS ͊x_g^tKwNj?AU^=xpVm3)*͠?IXg_V]M]IkGw7='ͨ$Ӻt)r|I@8™f_U|ir.ZZ2-3ƃ j fa`cK3Z0YZ9NK'[V.ȌXdH1cܫ]P7}JaY3+bJK^ٳjGt-bХ;`vVe2]{9(wf5:ꟺbAAdBRи{Wmux%Q"MoVwJm!\i* =̱qU-U _ky_|xbHN땞֟-Y3|D (֢5<d |Rlx0AT?e`Y\ }Gaӂ/yur'bj w]> ~\W4YuOYiDk\TmkmKam1y*agaZU(]6%Mأ7lElK 0%Q.1i;J.ǎDb1-(ڲ‚\BYa#HX*A*ʊ[hC HT%eJG(3(iדimPp4Q ,ȖZVZaH85QmbEXJ9]u̦QlqD3HBpA1C,yvDDy(vm %]pcin0GFqb5 L#-h:8HТ1gٺe-?kR%S hBVo(;1Z꽑+ы^W"SЃ~ O3GO,ju=aZ_;ߟA,D/4U--.QiMl! t A9Q), 'U?/ǺtTu|wSs}9h7\o/rSQ7FbU-UC]J]fק j#)Ϗ#낐!ׅ B[7@]9P^c?ɾ^ ѠFtaJ]v զh+!E#5Uk:zU~*Z;6sݾ+yE}O~ FaÞ C\m:tUg N֯]̠Ϩh ]LUЕ쉅t5s4W3Ek唂yrǴX=Lb&ْl~ |{y- 5H&3%\l֛ +ӂgBta~S0FgrR,7Os( Z Yikqavvh)-%X6SH%1 C@F Ej) WGw[uL->N|&)" {'si+:] \<,(-3QGA42ٽljQ) 0gSL9*^a+%4oUd(WOlI@I!V/' j>E$-۹8}~t036a;l#H'%!Qe`Y)ؠ*u5FH4:e ſa sP?8*#.FJI̓Z )勒2h2)G҉;A/-*]OT 6#;;;#`de!4BP_nr.uFi 421Q2*hk빦ȵlr6ٖBg*W~bShWcHhrӆ:2y!~Ns!#L7'e7[Q )ؑL =3y)Z`#CŊit Ʊƨ`a !:$.#CsPKy`Clٌ&$Ln\4ޔ50I8\˒"Xs8>L'ѯ,Eҧe?/ik*$UlAl .d"J<6.;V#[EPĐʣcC0#Xk؎Iװ%OP1ta˜mDd'ɱA)F4FVa8pOy>+{ϟ>+YUN| )bmB HmYzDeJ9o&&5&cv[(B>> 0<=&p@lB`2,F4 cza sF2]4n Gdi3θ!ƇUF(]BʔVY5etJ$vOG.~ z@qdQ2Iz@OCƴ3C &cHøi @i$ҏ4>}v_{*T ;6V#Bh|{btG!𧽼y82M ԙta>@H􋥏JiB^n 98ڋH?DT)4} xu) p`@=iܴ+Y6zcA㡐W$|#ET``d P*YsjJ%9Wpx,lqmsI҇AьGd88GI> KݮƯGĻXdΊA?yChR tG t.)s2 03Wý;X 2uj:#uݷ RĵAI]iIV ZѠD3Xkbqv{M :K!;8=<:s]}Mc1 >/]eD0bXkJ6.,Hm%dc:t%pc1<\qΤ[82̘$I3"~$CϧLQYnnh!ӹ;Mbƫ*`87 < 4J@1;qDHiv(qM(DIAU5AC, 0Ġ0%@9Iөx8x%ݜ$HүO,/m4SGdgL%W0G= M@H t u %օLAڰdzM,C'Xh:qnj:c&Mb"N"IqAss0^f;΁uƃ Y?{'5n^u#H+BۦsnW+n*CN#MDyf7vúvy-"PhS1JrvW\ܞɈjEUTBBbJ&˝4Eϊc=6{w61 $bG"/0hMձiHQv;(d"2i\I]9iwsHqI&dR?THLoqM˸3Pd)n6z,9% '43E:إn_cm[$EX=y0,ĝ]8${> w/A܏BtR Pi4)C&4=`kXY }a+XWqcx[fM9h4wPo5?KJAzvp@^{hQ͠헣$50=uӠѤj!ttz^vFo8i ە~Gz0+UEZ-a0YsCYe1uWIG{ז i7@{?1e1AДIY ̢ 2qTGfdZΝ@P[1D$GXPSDEA@*2'ouE1DiM4Y4؋wg".:1.IǷpawL==HTЧ@F@ĉpb 4m BB@)J% :ӱذ&[! wp=$wmDvXl`HsMuqrFnnٺZvuX4Ao-sMkvR]zP MH)D&rwW"I*] O&=k7hv !Bogcp];]K)}:^rѥ! 0Gm%T$Lև[=vQm6!${CNLY \6C=hijK;qɢ.14HKRD3`b N2sNpC Ǘsdd2Pwq4TI>b!n6h:r<, UKפh4 4%(ЁJ넃4FKBt3id;{w8kep:Y F0z~ JPH4JJҀzF(T!hHܴ3I.v0kj[u`';wA2lemV(E䠺NL7XF%TZ?lPn?^clZ@@4->KusȤ. 6wT07bLqc)|ywwrLc2F튤1Ib53׉E?{?EZlEN Ŝ  o,%#O]Y7"$꘵FrY|_[ܤ6rmiBBq~Tu20FD$,I!FRZ*dЉ2z(EV'({i'—❕<ϊ0=3F,& G)Z,JcTDi\ɖdlR TcK#aaPjuz "Av)ΤOzߕb՘ݒ"Y}! e/YiȚVӮpH hcLXHϏ'}"vwD8;.di,AFSPI].9:hHPIqJ9MhBpw\4c{B_QS>N1tDz3ۈ%;: ptR4h$bP$߽ܼW3G <S-Mč Z 2[ Vj譁U ]LJpf(ZCVvKJV6Sf%,L%Q=݄<Mu$Orہm hh"1mo<]Z1E1h [p?O2&.O1[s8`,tGqA(_JENփ+Qi';/ %,i&%R}a8zȒV7wvvvF)1 rft侱4L1 B':\ thҴ&}Qh$9R\K)CuhN1p= $ b'8D,4&?=;dG&hJUrn[j5(ROL$>;}b@ }#q0|I0 FxgEAJ C@Nh%^t͐I"N5”ҫ& (zWƋ(І-!dxuHm:?H3w(h{Hp jjABKw7d:J@{l @0 ;D4=#t4𩚨*SR-mݳJDDH=x:;&RqDT(G'IsfMDӰњD&La̙Kq'z|tÈ}9زYrX[JK`칗9?|7u;ŒA )a}-:>}ԍta ףJT +RQH*huQz "v4A֛KHsʷ-62 Xs skiYmъ3=tY6͎wnU^C$1vкi1۹+xfM+  )]b8SH(:dk6*y`1v*ctIt[ao{D̅:u݀Oi 6urwR7WR^#x  6rU_7-dѴ򹙴2}ZJav[ t H( :`2ns,q}yittrJs8<56BDg9m Ke|-ŌvF|M,i+ʸb$Z4TjC1 [1FF$[jmÖR ѐ3t2PQN8YoOw[ۂcb0D2{^{̉ztd.b{&IQ-"hDJGj  5=IZ9ɊMHqqhg sLkK`8u' :|p=L`2s(R<"{ѩYLډ&` j#b,l(F&Et(>9̜J0#(t6iC!c|슏K4F0I>pIHIpbQQį<W@;nAS"t{N_`;v襊Hf;n= ˔E`]v10A48X-b0KݻPZ*J#(> 8czmIGo{;LWv֋:X1*f8S7$nou9IUR J9gkNtaKǑF='\- ࠤBs;Y|.{VPL Ȥi,vJXu:zBxq#'D.ذ_Q8=fHPSL?d pHVɂ,db. )uWg9gs>zX 0Nu)88ZaxӪ i r9c5H u޶RPԥDHYH"El:=Z1MASv9ƥ|v΁ZVv0 -)͂jk,owuΘÀԡi!KV.pO%)Dw&:!XN;l(CU=K0q3Q1C2准[19$>xϠ9a4,Ͽx?) }{2LɈ `#BWH{G0#%DAlRp=d'g̃Bƅ O7~QCh;@$RØyM@?C> bî⃺̆qQ1>)_ۿ>=Tv(  " rXYu$}-] !22JI@C $45y%[aR8!MkrDV]n5+F-t`i 1֍]Rki!&Fzyj{;2cRv8*} тM64D"ߋ}$/AJl_8Ճ_C!-^nFQF#:T[93g8 `ƻT9if CsRCC:PO@OZV *3=,ېX1 ΔB3l Ywϯa 5V%tv K˅:cFih\}X{% J>)acwQ# KJL0#k&M٤۾L'Y΀i3fa7oEYP=.qZo»W~iק %̦! |7x߸ÿUGf$E&$?o3!(f]%x펫֜epDJZ.Ư9 ޼ގxeDL$H7OcԷ554HtR yC6<!/ ѝ؋wgVg]ԟۖt v2{?Ç|>%ٴz&P'+PW .*ETtH$VVci┝0d`wrG5I񀖽G5TjK7A!nU+dw~(wJy[e~]s?( Ԇ]U_F VHe*njȉuV ` |T d4G18OkG>L12(']:ぇL g%[pTسA#攲ݡ[9;նL#SEv†hH4MT+a b->cc˥՝#5O/PFwk< |4_Ecx[ OF@h7P@_iW)x߄@t>c#}^zw[&esז;Uz!6DZܭ;Cj$QICyߎp~z@'#0RWن !K[R,OK5Z}ӳnMl!oJs"W ;5w莉d3V^WoSixxv7gY29;&Xd5|8>ϟJI|=;aӞI8y-gJNˀMcaOޠ负Q}4f,)m,VY% mMޅC Ǩ|u͉o:#M"v{;+jQD. Z\'VGp,,&h?dYl{*JFs(q1bzC~ DP!:"W%>?;L>#O!uye h=گX. A˂H4WKg=?L蔁LZ kN TV\Bb EFA 8Je@*4ƬAY)-UmRq%X%14C C0ҁ.Z2ȯS,  |ޟ{È] *!!QޭJ_tP)h@W7 i kO _{llG^S 38$9v,0s016ҖEK6(Zt8)ѫRŅq:4aFScb"‚0 U6қO1D& hb2h'w. Cݐ~D/BBa' 8ly*N$gucY}guA )~]PcX`"U1VXlbfd3$ PK\(a &0R92@#"ȸHJ}laĎ {@qX5F D>B.&iN)vK v% H2p1d1cRaxۆ9:m8G/A wHLm`蘋7[̓YsHYeԮdQؗwECޗ4޼x2@Ftdxbw IOȣhPz~ ̱h2pE(j,Gp`Х8hK,w6tCse"$1v1*(aIi3pP}&.`$GiopQ%AxI<ݓIOBw )fhp8Xh.eY䏟3h aqUv5 tEw #ޓ) 2U`!$r12/}.wMEF@` ]*dw]jgrKԛ3N\/w9J>`DQV0GJ/n,S G6vc9.&Ƥ=!71! !Q%܈J5˔$%*5 CGvjZL!/G1Ez@A/T;83B:6`g{k cLcU1FUu* @{žl(OB*kdMRp&jaObI\CӘ:U@t@kI0I=c:U "JK b3H#.'8 }[SDnyn㙬6>!5pܙ((#p ͟0~V^~U6KA_k- xD!SiЎZaTǣHߛ?byuA/*U ʔ)ԡQhS_B_~ S.gv c֋6&#3+c?dR}Y9!*;P@gE8Fn^$:$:EҩW%CtvP}z_oja W^Jx3Ch<0ݕPGơF_r]9%&z#='ϔ$CQ@@v_ +mۯp;_Y\X^ K# H?&%? |TcA4'2I.G4Bi.LYLD׳jieylE DP0@d'Ao߿*~s-`j62,!׻:Cid?Δ:6gy"ICuD*WHcHd1IN艋q EƈdwWMb a$J7cq#"LzԠbڈ,HE>t` td:C NC)Z t-G(PH/JBAPAAX*%j~xfB TKevfޯ@+yMQI+Q-t&`$JLnV I,TAh;B̰ɤL22%O-i2B:zߦ^v䯲j *$2/~ov00҇_kj >7@A&I`hgQNɓ:JCH-h5Zy 9~:5^~B|^U^lm :OIct71p '~_:"UrLmh(v\S1H[Ac%~K3Y#翷]1+0hsog@WB'B'YI$ӿox<~>w9=(x\.KEvqXo9pn#%])wbNg5^4'1dp`탪H+Al)=.kHqEi 3 0 dH2L=ݗu$8EEF ҒT,L Ę۷t>y<%!WR9+\v;x|ᓟgqCS LUHT's]b]^Af0BfU[G! &T$Qf=/wFOemlm$Xz|iRZ>PӻG>['ʯ$^(Sn>ȄpPѽT-؊8}E2@fua~Fl@l~:@#A$k@C,Ye!`rN1hiɓjZƤ0dɲmvL 1O'rv**-`)MC  svHhQ廜(Ij'3LwndDh6b Fua^+%#Q(b:c|/ 6[-GsN&$ۻSY`W!(&C"ZJdHHo_o}Mw?'WRwĕy(5_ 7ʼnItB`$ lN]+W,ʠD*kZY=mY)FVl٩Q i(KQd?H#=4 r{vR A ZL{4sѪx h'ߩ ǿPJ$UZ2b8ǒ|,Wǯûe0Xg??B$JPI+|o˗*ـvtv-\pCHˠzqbxdg(*$ Hp w]-\ɺ0gOjJM\<HёR͚4< :=db}6Yrv$!vKŧjT<CУ:=5{wKJY\~q /7Jc%[)p?8aVLeqt}{(!UB%rqG,VtCpҧƧ͞V H'6j">zz+^\D);}>7/<0`r oaTՎx ⅋K(͚AG G#|:+s.w=%Oq}ql|S5ˌ]c[[Z /ԧ]1qF3k˖amytH?*Aɮ-S@PJu2#X6nh<4n/z3<@g tvN"6$48ϥVhL&M;Lr(`Zwص!j@hZ:;xrkֈY)-z^{@Db-BLbIeJgEl#y6't kwh)SB"piQ; xQa!l7lLBQFVFYF0ò+ 3Ǘ"\E(u֓~&0~M7dC$փ\r;o18r}(|Ob",^3%(>a Ca.c}'פЙwdC.w)Bqtr HYvj1Lĉ7O9Gbct@x%0J1pG.@4zH¥Βb"6H{а!s Xss݉r M;C Mn:*#H!NvGJ҃Cijb/! bpO K x:ۻvWd$M>ФF=Z:z=hWZZ K<*qTb vt4*ק{>Ѽ̚)`uprQtJ)PH=44 c E=4M{Elys ]4IFid{KiFf,\4!%s6Q6)=Ŗ+k|:Nɲq>=*Q#WPTxrP{O`AV$ Fs!1ڍpAA/1' QvRqq='JtNCVֵh/m nqCw1]I $*TzС;Bh4w\3&. &J<&C{5-[ IAy%(#m*,6)]/سC"#6(~em (uhɴQA`$(ؠ>SiDRXj;3UdpOEC6JE=,/Aˆn%{k,ڒN02ZtG,5&y9:dP,L6-%y#Hۦ( +4W.g ]ZXه (Q@:{\N)vd4ǠU;Iɳ\gG70Qֈ'Zֽw/8媠ߺ)27z>xU͚vS\6 B;eՑ1D(ؔWUU nF98&Lr*|t}My={}],z smJ٘ 1XEfNf"l  KB!$H%05?X 8Q3o:=D_(CyL?4BAK*J(`|mAC:`v)xs/5?Mo}r|U!u0H &4J*28,R/T(K҈vOEZR]uD=1,awA{ o4+ۺ6e#3PLuPĕW i[uefd<+M{7}>P}?&A}}{HێuA5]M!o{FJs-Kl:셜SBz# [N #}hNv"BR}ֆ`$W4$ta>>ߧ=o2_0RoE|rvx}̥'yXh?RZLBv|!{EmӒ(b_otnPGP-a2R@ft72:1=a,q>0"$F!2H K3殥x^{eg wb𱵣$bOl1|CX҅5,&J1+brXQ:`OUԇy#&?/cz|y|&C_?r!:G}̲!yݞh]*B>ϊ^|<؏-PJ̘+\VζMR&eC @R$ԀAa2G5m$1kxQ`d]& CUFk^NX#Aj! H-vwzZjZWUQ냇"qI1~2/],N% .ߩ"G|t),bY|]cWXŎ@·&s/#(~*ʮ>D]HrtlTH~L c5sy $@I 0xn]HEBKdy:cmxub6z[/}u>b-f3~mPVjtbf*b*ИI6hJ!>c]s,{O{r FEX4nn^3K~)kXv3ϯꇛ4=&:({eώgb%T`U~3mMxX>3 )=(usޝ{c7G7M49׋ {WQv'zd10h, U\(tH'k%yi&LR-zRFT!urlFR@wyT g\w!Ee:0ӇxsPHTS />LW-lI(~^nD \C39s-bx-iA(9I ,a SѤbkHgѯτXjE|}qPm*ֻU_g(V{Cr @cVYWR[UE= B(U\PD#0xHo+?8UG/U7e&0&4lgEpiBd"F$de˔%2R)=Ǩm-![8;*a4I d#ߣ 4BY\!A3]y LgǑg,/^7MR]ojngGHU†{uOŭU$ 2}7Go1tSM(ar57E{mZ.Z>7Cg^@y)=_wkƅ 樎wv> `oZJmki\v \y 1 ~r۝R@x!Z@C6kՠD﮹g6)j?;KFmrRm,?Q','62JK2>jDunE2l+UšRd12/Cm#GLk,Ҙg1}>GkE9A8=T-4}&~iU4`3'/>ޜ-? vi}fEʒekwމbTItmG7/70HP&migC 0І[G %:Np^7kAT0nYNG$Ø]Z$Qb}S-@#STx1bּQ꺛gR9^NHtjG[< n3ӢǮn5@(x#h.S8yS괼Nt!v vDqJ WD)蠜so5rQ*zgd$/C0[X汢1[J9Wԍ h4/wYc%(!"P!pA{g/8TA]a#1}8a}gwggvS%/W-SKNQHCۘ6H2۳;grߕ|_kN>-p^[{lqIߊѕf]"Ж3j!A_zV:E"FI V#1gT/Dct6 HAO^:APdZ#i`_OMT_Q/OmJ^ZS=-UkkjCA]kܯHUw])ԁߓUk=A@ [Bgs/Hf!h,Z 6{˾@}8D_ _;4!EO/%ҌF H^PD|ʐ D) l_p>?{=4-~O4LP4lQ|`d1 J? u LѩH+F4Db %uE:!eejpGUBu;3HWౣz0ڣ!`*$BDӃD %U{N 0}M9EpS'EeS7pB22,eؔjd5 }-u ihW9N{%(f'>yHQqlƚȊQ 馔#̌%r7oY4e-ƚʉ]}WU iCtu?+;^txZ3a(^a&#[71p=ZެB%roC$Y3ݨ Kx `");;ee?Oű@r)(Emj2G;SF`"!c˷QD1ؤ9+- MQ\Aɼ76.!!g[-euY#hZd%]^8bM0m*$I(iIa6E5={0%_}쎑O7JʏovNYo=ks偡JSWmeGRt?NJwjy~j-4[0@wl ! )bRL /ͯnh( RT/$&a JZwm**IK^P$ B)6dԴ=weQ6¦{hAj!ff '\1?@&iZ ( , E"0 R 6ޭ踨Q u_l^!)5|9ʹ7 [ ɖ*ȅ-06Sykݼ]1?6\ݞu8N[GF<[_.6t[o nmaI9*q;㰂Զt<_e{|?r$R~B[J4m1Qe%LkݢbPH)pu-vaTQAe6vn5X4%s)$')h6͒ #Zgygw&+ bĮ#Ɍ8:(`xԓn84ɘo(\1,=}1k&hdb8tٖ`L9Ղ |~i?@hKɖ3~tlh^#t iA'J?HFƆ`Nq-,J2!Jt *@} O:a:?ړi@@{pn,TKihsL ֐LNOTusEAfG=O쒒:)hۮʰZ BPbi]ocf vS1ܽ]]1JM8gOgFL}2`cޱ-<,2m+ ͚L M3mERd#Bd9Qu\];4y\{ L08 i<)xn(hdRB{!'%Hh Ka B2el:$imC"\[FK/NK(K!#8\o`}BH~ThC\FH'ǏO0Vͱ Ӌ*¹C$݇wG@>> ݳ3`ɶ,t k2G!)z'c綡A@H–ٕڷw=!.-JV#Jmx"xٔYw., `u':a(|8B ޾'X8 fa A_HgO%p{o3swƴK%/^Țbn/iɄ78=ړKOH ;J~{V!Ept=ZeuF42lqz5l3@!CCgA} E֍"rsTKTzpY|ټʹ)n1# # Mki(‰S 0w@Y<ǥ +@tRe7qB599e J<<ع+KsPT@ql[,I+V)j5 u& A(ZXZ8X ndp.Z i%/ ֗v1'!)=L\ӤQd \@;-3<'y׭mUJ!XA|l1tF{vӻmÈms])%3 [TE* 2$KkJX؞ tL8ЁB4$Oq퓟qOCg/lI88uvܽɻˉd9/pvv[Dw;]'kpMj.&]HP1%ʥ F(5+%))$ĄHŐ1X: \s%|@YJ46*qPmgEXEDTTPD^NՋD muG\Rʊɮ 2D>FԽ.{dmyOO%PvsO*zD^F{m# a$4fڊ^W+y$S/8 +ێnmNdtkj/6431@R"6dIɌs;lm,T"af$VSInHV@C#[)Tjr!;HdР/C(2VDOQ:2r:̑"(ukJb9{*h@z(A)>OxCLn #A)1bPt Bx͑1i٦\\ JP`xDŽP8qp%8C.#x##R 'N3vei@e^d861x68Nz^$:R-RvӉbU Iɷd](0f /$C}K$ !1ٓdkD+ARݩ#(PdqѮJ/io6Y 2V5>! B=~^`}9}䢎LYln-w$pEpɒ#h tGc&s ` $ťkJk$`C3Qm,>wr#Y)R01b Ch!h!?T^2pL6b` CZ^Ic-݀6Grri[-HD%H{5H̬? 24E(Dq CXV#4ĘZƀ4 )0)C$vˤ* (sSLՈڋ]ژTPchH]8LF=uI(T+ɘ1Zi׸jU&`3l;=IKED$J)ݸ]$\nQ6EƑ]`cL&-J $ҳF&u1a DbP2.l8j/$тb ^hڣ2-|K7Ih`a:[VfB {lg]uh(@kAoTCLɃw)<|[wKjVBW7_:2)>hFz`kJ89n0:H%21-%H5 0eSHs~`8hɝy!݄MyCmF}'u8OqErKwZgzjC<@?Har?-HTfhwYS2 S. 2)ݵЎ߲3iC9c_:lTxڗNɑ_..)uatvhKo՟cNǑ*;㗓{#nV㯗X]܀'U1 $|; zǺ`iWTؘ%ٿd'̭]ttEs5f(q!ahV|ӑE}`lu"ilZ)A6G+j M.\CʦB4aWEYgjN|dFt8$u'b&% 4uiDY)V__M)%&^v{$F+a+$ic#+VodB08:f cAnw/v6|17_t>C['g:O{Z'C]#Ll3׿u">\; ZXGgTg}RP璶*_۰Sbs;l{&FQbDʒAzȗH/'y`|"@z5 #1jY^,q1F\ЪRΞ̖HV#[V:&NN%ϵuTD!|E vԁtI$) _%N%iW&d3SV320415:B>i~t'S ]AI_z/[>J +o=r^9>_ SZNhp)TT8.Vz;`jӥMtD0VX7:{#k;W|;r f*Xͮ>ʴ#],\Q25RPs7AO&lV3J *{҇2&WG\tddBaRi/v~jVWHJ̹)@zT?f+Q)@pfn6'd| M0I@Yrh?mAųZpZBt)+\ ۜi_T+g?Y 'Y4uBK ,Y*U~L_HUkwBnnQA7'3x5]Wx -"AE뫳pQG{ǐۤ&E;9B1DANe)s##tR #@I,3k~* jAQ10m nTE_sٮ{a/,j*zw:vOA|Pu7aq priQBп] 1CgX6l^ta+2ןBX B*@Zji#Bע8r&Tf(p+Q*FVet *& MPIu8oj1 ϣ |B_n,|h 9ڟnEntHXrgs-it#*!UhrHfLUOڷ@iZ(@ s`M;V<$ˮۙ/i~h v&dwƅUu\vw9!Kc;vӥgˆH1h-s1qˉ̠|=IdQN¿⾆=В˵^`}/}:~=R7Ut\ D*|]GO{Z|0a2Ψ[vb ل0F:oΑ)B&DSkLhdj=tqè84 *Xc&$PŬ0Lwq_]߮DhNaW?'{/9ZRy;<ޢbҁ "F$Eq-b~݉ˊnVeSQMlAb\q"bDxW$5I{l\&"HW)ݨNia?YӚNbMm@q)$I/{gZMc>A'/0f &F)A3ǭ PZq8&c+5֍ Ƈ \HOɦw ]K!/2⠼g:0J`uuӪB@d6O+oF%ռ1!YUDZ6D7V(ߕU:)wH׵AS -Bl:ڮKy3)-VnG 5i'AVݞ.m UDfJ P @Шә3iU! IA4 ?#>jiD96d|P<o[((1s:p#a}hȣu7OX`M"J$R׹uX౸Kر->q7NڥB}<ԐAjn JvD~Fo51 |"f ZB^Mゔl罉*DTiL܄ècj\}P;V %rDEC R^/U_Lj14_^6 H {+`=*Iuoor(x/2|W%+1 N,7xʥWO,`Gug^`\`؅Jb M"\9cp CHjh#VC j  5\N6Ioa9)6 |]&BAzBݻ3h'*~ۄ$wWB2Ya5*xeZN-ah U{LjQt^13g (b&dSEg^Uƙ߅2VR8=%-UC`5],"8(g؈Erl6:R;~yUوj;S_(䰺-DԉuI=yVMф rL+NʖGu ,aGAp% `#KJ:]%sۛ%e܍[˵Xȍ,RD%4u;EtXyы(mָ"[XǻU{ʿ uG]JPˉUU$6 oX#?%Ɩh9|i $IvK?20j-LvOjֺλ&׫yITFnЈfo3yhb02),$h}399o8L <&e:Kk]%XX {ˎ_왅AN !,6)Ki NCGeW)Ʊ'bO'ܝxL/T"dtIסs-sVR)/-,3V `2nP2,vD)hZ韖cGumgsQM,C?: {H0% .&I-ֺi% M>^UPZP즉HHĊS{Sth]5ӭܐ,c\YQr3Yikܓzadhe j_jy{Kj?zaμ \7k;'X(?z2x:4.}D0vP!A`k@ Gm}4B$qDWEZcZMV( }Zk5gu[?0"7꽨Uǯv/ ,S6G훹Ra'cz2,PI4Y&kZPdUYC[){]iX?VDIi,lY%]P<)v2±*:^~^Tʬ맽[*#ʜ'0U‚LBi3/ 4*̆OE} ',IPĽӣt>wv |{tmc $5VϏ>' e*Z S@MxUlY=UkoSG\GRK5}__=7ɍՎ 9g3B &I :sZ6 v:1!2Rqnl3E/T-RJlG'mhC"!Fl?"{Xruڽ0qua$! ZfNmŊZ Mq? K;`9:@KCy6pFve<$MhNRg\#fnѵ4><A8Q.>Α!𴳫<*kֹk=fi D5Ygwaɍpu9bEER? DFEH ֡Jm[jƷYL4UN=AhJlĝa_]8uVC5Ev˰ B fHFH %a3[,˝1Po݊&twWGlʧD&atg }1mٛlZ H&bk|bFzCVZtdY Og,糝oVW{]C*41j GQj#ڸb;~wbsǹ[lLrdle A4DHbCFDc$@HCi+:'uʹ;$ki9E1yU9ꩴ~T2B!">E":ҥw*wB~:aFk@:_D;J7ZG-\Y=OH f,9wch_\:qtȱc閷SwW=}|O>JD˃Tj Qz֠'@+ =1X1%l$LuJFlj&PHv~696+kaɮe3+H_(:-˧ ;7|u< ]w\L' !Ze_g^_ᦴb!8|A keDѐCpJH,VGZe1qzILT97ɔD΀qsBz4pK̳OzOs뙐+*FfVY xU bXG6͵R2Zɯo:1&P >w}44SD[(~[]Hز-.j-|];#|uBiWŸЫSjSiDG )9RPc‹!]0QLi*U2$+V#Ɖ]mQHUlкJ\WѡuOZ<3*tGIj(6ff,pIsG { \R?V#e/`PdEdh8D([2}?lvo pP_Z*Xo!L-> }60 =a W\lG)?@R\s=a脨e>t ?qs#26PeAf*\jlG t/UE cS/0ݏy tV ݍ2`$>#zx,C̖Ox_iwH4C'Sqҋއ5U;J,hx],⟯~<x# /zSp$:_$y{7Sc,3xO<U2R(Å("CF}&%Z>44ݽB7X,2 Ru ($&޴7;ߝy!qxa%@ v׹k_-mŢG^Y+ `AԀ# J3+0L d50ґ ~UleXR@p}W|Hi rP]+ȯ7J[-A:l2X׮l'62>N٤ u:gD8Q?d.1 ?]q߶'aՓ[T:NGm l{ cPǒ_MU.*kW8ߑ{{P]J^*,5ǩ+`Do=^6{<KC(a0I/%*ըS'.v %n4EDOU}>^%TI>T0w u9kdvrlV{28~*?(裮s9U-;DR0)-P/GC,PC6ڠدzx=R] [޵rM1Y0 w:S\X:J@B`UBXSanH%h C;bۀ t_^-@q ZM/ϴIh||WGEPVY+S 8z"yZN=?9aj! M, a4@]R6{ۜ|7Ǘ~$aPS Vx1G.s ٘^RCFi [' R1"@A JJ 4թիZ#g~S(/e/ݎ)Cq#Ԯ%[râȂ'3ɧ53ri8M#6Ootq<=U VW6%$z` K0=~.wHLG6vAz*8J"$!FpOv!N ~ SOn|@M:zA24[ӺQ# =3Wo,5BE{f+߂A/k67;{7=A(KDH ehYGuei̭@qcoHܪ#v;o/ "YAo٤Q~F>WΌ ]}朣>ev+'b=u]&KR4)G*N-?{Y蒸z39BcMceEr;C52n2k11d zIG E/Y%l*=P&w ~)=|UXh)nU:9RIUˮ-&cl5 z*$WiSHnE*;)SBR0U8Cjuqu>k߼ {+R k)GbjWσl1{ty6||WKr 0G(]W-Eg2U[ m뻵B;F~wKN!5uOs˿G(;Qӂ!P)ƬTw}^^K Z@]H(Y}5٨'foGȗ A@*.U%l>CkKlmd2\.im}[ m7(ay#Nu_ oWH=BVD:P{p[N-U*.٤ekݽm8֞.n|[bTl pbX&HHmUw׵G$!)d&Lgmd!^5F9.8lҶЕv:N6n*0&ã4\jR9>.ii6y׵%q͉(1zq$sv^[ҝ8n7콉ά%e[j I$N Jrg:>7I\ HB-sf- 85aaF䶁Al? +9ַ[h 0zIM4zy'KRE}9)t& A.-J|G,NtT |>D<ל3~6t F5eHfjý 1a4b -4f 73zmGNXn'SsiL6Y @?ɖp(K/ʺWlDOLg^I/7evoX0n$U#D7Je!-ogwL[FMj,5l~wID[ps)a )~V_C!{z+WM[n@) #Sj2+x`睰q o~XodHMz5utW}Np3((JTQEzsl48\鸂 a ٗpl=n0~Igk':֑(O{L8; FK|ާJ8wxuB 2[5E☡D96V uJĸYIks-:)La/#B4 -ToS397g.2'on!$zipgW_ 1#Q- MQmQXEZ/fGEF2'ha?y[ ;vOc*Uҷ  _)n6hx@v?7P9(#WF=/Z}V̫7?ͥ@QwOJ`yroʘĖ7w%l'ؚ( `TGB'Zn$/H.PAѴ646W1"m1yʀR8Rh˛ԍv#єy~ϯ[&b I&4(g–׹r존2F'?Zglj^TIae%EZ.wOӜ)atJPw q|simn[Tq?lnʌ6?-U=8 Q r#/ӝ#%eƉL)ް1?; C߮=J ?Ԥ_GgRAxN֧in~zq>у wўդc4 "Τڟczít--E-IJ>سxuNxa-w/6$y:$Bi"RmD Ck}nW݇ь7B|x֟GF#2$tA^W=Sm~W~*y W-QIwn+aZE#(?RSҢ8l~vLM$D iPXV9V\M ' 7'F > X?"T@&;ɥU^؃ 8.C-z^"&gzb$&⥥hQG 0=ղA+w&Q]%D;oPnŔVh\@BwR:&|OO^Q^X 6M9aH#-D:Y8ge;r>enn9YEhOsq_́fu:"^Zg$6I4j ]O3k.r5xH B#ETti?BevԄf%g<PD" i'v^ݪ56M4/ (4L\ZHJReBJi5<&;~ M* Hb%3:=~]h6Չ*,:xމ:'2ĠAWxni2r8L YZL "iM/sup6րerǏg'"UCJhK}yó;:F%7zXWa巓\?G앦!gkFҏC1o\@'Сא~X4 ۠+ G C92 CGhHCl ~b,' H"F 6z{]D%ڋz=k>pLgC"VX1$צrq>C|nLҥ:ݳZv1]QS9]UNo}[ vj吺~k倜=g~zAqϟEh #2_d#xIb  qׄ\!e_)8JA r~WF ZkL0MMNOۏlڌkfye%uL[<$U[ԥكL{bja@:]RHȟD /g?SOr kHsI. Vť6 +&'î{׼U$w: =$=^_ء CMMxB~Kt>ֿBl}[wB] uc$S26eKlҮ{AWQz$htnB޽A\`'g,!=/5iMVлE B -~sQy;Xt."@xXwQb\>H#{q8![(]_dR:PpWWdvY|馈S'ݒ_~PSKd) V<Èv|_3 R! V5}> ٨9x ~ QbXTEPB}-Y ptL\'P@t0Mx[tl[W#ި>_2j5V_8 D2,[Kw (`FPG-X֣=딄do;.;t_^U $W-y]S_JKz&l%}_v >u=8rT`9VÔ,Vhlb >59ʽO,D$iFBTMZKW%/l% nll 0f+\P*!Q mcE[8皌 $o Q"}|Ek3(u0 a4@}E6v*趗Ǯ|MLG``tS/qpes2|˥LJm7۷ïV?zG=`CiA"nQ*Oڶ:U #XwPU "(@#Ou ~ l53ى=p1kIFm7㨓'Z2yXW IBݏW(4*Ho0n &|ɷp2N>3HO/Gas!ًތ^v`DFP' Bkxbu`ߟ{2e%lC].X4jYAΡ߯״'nΪ+zF&i|\jL o""zk{P׼OVdP!>3I/}|Pkh{==ZJl/(ț'4,\h`_iR?>*f>SP>$!:C}dLQW:AtHQMA; 7`BO/tE3հBɥ k6T@jl7ޤφi6JVlT)6J !r;^Cg^ }QCfra.]dN+^! EKVs:, *K8{)i> l `ۗvm]I~Nm2Q~ƘuC^zt~HG[(ݔ3iɯol`5mD(~C"R|h`L>8]8cu3]M(%@XnBlǏ5ֵŨ@Tgڛ>d<[90Sx&SN= M'Njf8;!ۜ5[FWrxSւ9P"؎SN)w"20ڞ[7^ 㴏 5jX~:8)3 M[:KBva׍Xt++"q#%pH͢ސ lH:n~zr cڕ""rFq;o ^:DP^b$WO~y,d:c q7M\%"g"d]' :^Ma)`yNf{^?l12wdWdS AF EҨ3..02&:>י'{mzlT236~ M:N69ʯb;Ї=<~۔ASr`TP3腴>Rd =Ibia ߫6 f4Z '46]nD?yI}{zu($twJCl`ue C@R-O1y_oonek#,c_*׺XQՀ{(GYnisL\Jrg ʫd2tIãpHO74D%'jwӪ'"2NVNxG ga#{ sqϧve3 doGayc0_U}hu߉F oд&%Lf2>|>g#%ںgD'A)I`X?mN 7waf{[a=l[al|R;&@CHB '{@ 95:ZD{]R0"I&u݆v~?sXWܫKTZ!$RfKT"BqOsȀ g.o[R|'Ld(@+7jY@ٽSoT`3{K<$V=Y Phɿr,k== ~9D(Ⓟ7UjdKH$}q HmV女[I^Xjx; >Q$v02ҐmIhOOrtAvgqGGe 6J<:-?ؾȣDx0OMl=ױVӻ$'rqIgA غ(Zctv{8WcAXYz#,#HXog#)hcǮ D6@rq` C#ddLfWsOKYQ4zLϢ{'HEōjv~uU3ASSšIP {jg,m~5Ԩ*{}mnYRs7\Idcq|8E%A*6KnDZ'1mכ~xQ vonQ'VA4,D*j5D fpӛMar-$}*l&)"*4 jDF&"vgt@]e-0ZzMsPFD!` !D;Ugyg0#,|knoAw=J mph$ysR &PD>Jpv| s-pSTRPl/lN9{ea0zڢh|!FGH)oG,;:Q|BhU24LBihûiij,bjk]4Y:~wëK=4?$i},e|HwT:XcHUR͕P {=SHD21JT`:p׼yO?v ԅqMF%=^@jxt_Ï] x[pC2{W7m֬EZk"G]hvփa `;?z;eCܨ #" b)*`IP7d'ZPqoG ?P[B R 6Do|D+`M/Y]s^\ __ }iT!UZ8^' !|zsuwh01âXXMB?1QBΗ?^T꬈Hz) DP-5LAVYt&Fc2S[{D2 I \tۈĉHv?=dE q*?uߵVϪ "lʭetC}4@AH94]EaE$p醍6 ?ˇEmM" /ǜIԱw|<5 vz- ]G8pP]PҖ0uA޸V$"ʰ H]?QO&PC( &?P nd!i5 QyhoBѱvu22$zͨgekޙ'ou[=$.1͚F>6uK[QV;bVɦ~Na dAIX(֔oӚ<ϳn=;HZjF\)%A^W{U׾O=9L!LEϚי{Gc8'"/nrr\W ,itQ9' MFAe5k#͖5M_rHO^v)Q I-H<3⑞~3VLIA 娉^,T388R^ Q0h3հPBR'kǟux({KXExbg?F^)=\ '6n!!KKZpXNP@@K^NPA\ġA.mnts|54VdB:pP5YR+2SHp{cjF"B`Hh,h6t HD7E;"A0$t+n6`d?ϧHi>oS`  ()S2AgɤRU!XeBփt{wI#gD(  #9W]n# `[sT-AQOko=T!) /-;?|܋lCS͌ cR^ms[sVʱ\DG[C-rDBÝAy/5,S~v)9y]`Iem4O<ۤiO؞緳0iO S$=5fy#[&toG$x# )Rt"Fc8SMm>M!,5yZH!X,pT ^:3[uiZ`@,y{9bYۊR\!^yۯrʇA<255)JD{_u|pfT  y"e 3lhp7Dj:*YjG>~7{*;: vH66/6ۚbI3g\8aMkD'Ѐ*ju ]6OEQN˹m?z~di̿f,KHDPMj f@sS+L_hA-[ 1(0X{M]*,B}޿s;GXTUH#t&OWi~bDֽz>zb4;QZ@{W=|?ϮlV(!4@RGҲ,g[IK(Є-U5MG lng)~O)v“ 1.x<%}w:#CH4!{@ha@P;)FH4GHFi6@G Xߖݶ_G"M)-9sVʪ"'1$F)u-3 Α uC6"i"C6]:XZf~%vJ={AߋAigcȢ+0%D$btV݄ih@_L+SFSwN&=;  X)ٛ/\:maOe=Ǽtz>x:ci^$_e\EuRf;ѥ 2˟U<:?@ZĞhHGPS)AxmuXz"to @2 V4˟T|׎FzSNp`UDH JAhrK (4(KV@f1b޼hNNR 4҅kH#q0,;H(A5Q H^ lVPSRD0鄬9fZ^+# [ r@HihOfG~z*dޯ*j` _f=_'Klo b *DmH$Y # <,j݁+rx0 NSCl;h.u__¹A:QoHBEߤ{#;}D?d3?di9|A֏/wHI^6dBKUAΏg)ubL!۪/xdG>nH:+Jh OiHkRH$>R)j#|B9&_"z6<D .0î{|¤PAO)30AKycU!j -R z_&5= h.ce֘ Q{#hЄ&,͓?{Т<Gh4oDIn`F XwPX8'*Nyvt/bTCIw렩,#oK{jbZ"+`ZMjW(:X@ sGi}z !%^g0^ז|ܿ5KiAMoaCÇ#tOEQZAgè +UJ?AK0ؙ3Od>?R6dĕ 6(yY贻?d&/*0 3+(ߖJ,/KPNΰϦ? .>hs\tHimX5UKʓCmhxCWb=V!>K Fsh^z+&Iu T!S_ǴPDIVF`T+ɰqЗK\KI'qsת-հ T@#5379I yQ.]K;kR#/It+a{hآAlG ;_ ͎mPl5N/WWO'xhx򯘚'Cˌ׶ Y MkȤl= TE+⡺\@)x\2O=!G;;T8I uLJD9Ԟ|KX|:O`m5k–ITQIrq(ǵpHQ 39 | :0ȵW <nq zZ)MCg-v%s" MqUG?a \sT迬yǾUyJzz`$C]&X<!Aߦ?.92CG F{PՁ 55/LJ_wLr=9Oj-m%jA@$$XWlWQLbbuǴ[Q_60zh*޸^Ps+?6DmPOHf5fJ(:^b6dggrN&֓DaWFqܾx.dˉQ~6 cVEYW -Vg5EA5=j&|ƽ +1HZϭ Q8sWky֦nA1NnAF_6~5Ge=%(ƛIpYtW^>@?$!jBȟNsjLtO>b\2鑄lMc<1da:e3YZiH oGβN#Ya1#7tU"E @%6Y?+ژ~){w1:mB +c`">#mr_K,H{95Lz=80guutdEc*ERPF΅OT[9rȗ\UҢ"E?t*wqXƑ{34W(Qa֪&hvc~{6%9ov 1]vכ'D}b""RŚQQgj"ӌ Wv](/9z }ɩcT$ĕ@Նb.%q-rEUݨ! UOCLbi{~}4h*D k  K?N"nmOY+wtMgWT My_uswuƌiC7Y2qcNox@ chD/t'w5^0n뻹s~|{u1iä@JF hDm/P|4DLیgʐ |rDjW_oJcS={`V"(f"QLV ߍ|R!%4@"t8}ۿ]0'4ԁ8BUWs3j2eb9+$A4;>03}6W u;1~7PBD+qcEyLiDN NuTHڿI*{#n`8jOctaǮנ$hSww p79^#@:D@a6ㇺ$\̜?%]\hUjE7y҂Ecԩ֖1]GSFyjt4GQDEU-QޢCΡ+k*PͤsiM?Kqsu_)|>'66ӌQTEg;!bI'G:2$H0Ro!}N^ѯ)v!5P$M/p߈5 kzwA /:bnv߻&"}~߳ڽMj CW՗3NA^ȐuŶUb)ZR%K ohx#~e鰿7c ![x,Oj D=Rԫ" [T1!104O᠉DeYPGu2E5*ßNA]gΕiI;> ~qc6\ ! $\XA~'''7v$ bxH¸gZs}6K0|+i0a;9Y@d i2}(f'7 tDtc!B1>L@'8k6im."MY@ oNP:=!QA.~-8s.[쿒<ĉ8P`9s\4"89#'-ޡ&\ԈE/7ɪk;3":Wy"J&#)QrTV;{d_SUa"?";C*F.pN 5C؞+9n0:9MÄF&r5ED:ȌG"AшHd0um {}(KayĠbGz ^2='>!%%Y4E8L04H@b%'-q2U쉚3-՗/뤠 0'2\aFMlQQTsRu*5k6MX9`L&r{ \/߼Ң`1G\wu̺r2 I'}c NV\zg3ӁTYlK9(1iv0Ec'ʀHBu3͞B͈+6tpj$c♫:=_W:/ cՔ`oLPl3 Zj"2YEJ#홏Eci`)>uTwBh$ dE/MUC V'.o[tDqÄuI ![VTUNQT/ ˗o?Ijt{^#,3 !^\$7.#;Ljcc5h-eF1X+]gY*)3vA}GIpA@"2r=LdPJܔT-CgCH{b"4O)z~Y1$qS7Y?ud \=,qt>9'B$>eg|eg?*/ԔH}J6dk(3MY4'8'Q&Rn{*u2 =O7 ԯv'Ԝ O$$O~X!9<}!'23&g!=!ه3|pDϣ{>I43T!"09zI2{I!!X~P_eg $`|}'ɘk`xZnJ _Id;PfQh !m̟hQH}OD$iX֨./PRT!g ;ql2x7坜تՑI?,IHB$Kw}X|dPg_,?͢9'X@ڕ $$e4, DjF4gUVOXL%TRR*'2qd로3"g:ۺRg/sY?J3ۓJUaCYm%|C%IaS$$P/ٟ9dvǦ3_r}+*OE?X?LGԞ7PX?d>z,B(Zz":η5ê:-)çm*,*L 2l?h?~~N_NX|~EKl=b2&t'7W,?x+ϻRx*MhM.G%L`2?g$3L&tg'+Jb'3TEWZs?NԜ3i7zҡ[L$#9Μ ?oI38S'0dLԕR'<_ݡ逤m 5%eL3µ' Ù&w 5 HaP=(I_bK:$@Dɽrt`'i9>!YfdfM%PII&aJ^C\&kJJOl?zg{o2.?6=cfE%d~ x'o(lr1$^L,+ѝ:D0#ٳi$ 25I8'S>8"g*mr ˆxaVZs`t:'7na4GKFC֓N5y /TxXt8U&(>OcP0T=39頞eImaM zpgJ[)! =|E=vF mm $ BBB@ $ B@@B $$I$ @ $I$$$$ $I $$@$ $$ @@@$ $$@$@$$!$@  @$ $ @ @$@$$$ @$B@@ B@ $  @ $ $@ @ !@$@@ @$I $$I$ !$$ $$$ @ $$ $ $ I HB@$@$$$$ $$$@ $ $$$! $ $$$ @ !!$$I$ @ I $@ $@$ $$ @ $ I$$I@!I $!@@ $ I @@@$@$$ @ $ @@$$! $@$@@ @!$@$@@!$$I$@I! !@B@ @!@@@$@ $@@ @I$ $ I @$$$ $I! $$! I $ $$ @$I $B@$I@$$$ I $ I @$$@$@B@$BmV{l~+[.\mjiY4蘭.~=JlC J&۬԰[ kaBVķ(Xuct4xu a +KYMYp v5Ð(0XX 4QЅ@椭bmiء" kRUK`K[ ګg u*%u]mlD̢9ns95îio:ظJ-%[G%bZu2d]KPJlcIm-0ŲX!y%ն(Hbz[a9LSTиaVewXma KRfM|̣ Cŏ} ^8IX"#zO%X4!ܯ}GAԦcfXi²5ŷ':rT$w5ܜJ*B=5Eq8xzeQd[g^Jzi1Cd#H1L ; d@ JBtI5HhSl: ^t=1BB:E44^kAԣaCj`@Ar)S<sW4qظ2YGǧ"Iq(b*MZJrJ@(@zJ!>>h9 BӃZނ+_.ݵu"*1J:N4J}vHPI D  0uֻQ@ NMLQmc8O%;/ql.Ap v! L rM!=)t(0l5!Pf^ .mҺ`uݸ܆0ncmx*J*vp)ə '$Q"H) hm@!h3v, KLS%+\٬ ̡'e$v,ҾmJ.zRdF n0[O5`.L̅5OyW2hnTN a9WP~wgB0];bvBҞ \"רd Y=4e$x0b"^IJ;6+|(Ak.M`S4w`-zkF*@X;pR҇xjlxyhŠ)m 7' j3k:& 4rK!FN|%$PgXQ5&%;0́f:9KQӱb%J8Ikɂygh`Y skSZ.{r5y|lS>1r@'J4Raž0 d@TJN`7N@z{d>zhA-wq8XZ2.|6SZ }8h{׎UAĨ+HW hT(4DiVЅ"|ezn)a=UПSF"FS.B)U\p+ P-$.mCrx0L仄ǔ4no{A>JRtMҦ{eM84+mr9$]4nC#dzG|Yܚ?Inp{rFDi2&!L*,QeSv7[(0aЭ"{g`5D  㚺BvuZ&J)[C ySMi'#ׄ iG c9tljB,@ wK~z<蛢]~?\?~;s: jDD)(VxC'hd&(-(\ԫ\gZ h 3L5Ь5Hvq ycTPHPzxr]bGQ:)p,QqNN=Àw0rV$$MDDX4Or IxNw؂ o a " ͷ[3  YrMc ))2!@4  > (RG]R U@Ըc*IqktchJNC|gB m8 ^|/V%c4~Π9q%cqԆ.GN{?_|`̜ (Dbn )0h:BCЁJp; TPLl84+C@<>qAe:{ j! 2^!l.wb GFo.op[e 1Ga@F5RG0Nnǣe|ư}y95Ìpci5S,=ϹzUbjbC3ux٥F֒@Pb1,RRJj.+[AY`n@Մaʹ@v .FWP-m6eb5ȫJủZfS#@֪;P¹ic6.cER¬%0lAx̆b+aд P = bD19Ȧ`m[q2r%32X^8qzLXIR OŐ؄0}\b qK̆$99X [htI ѥth À2cY`9GtB=%+#fC\@xv<6 6ڽ*J$@l@xOJ?Bt2th@ZNeOPI l F-4OM﷒˜Z@l !v2jF')=w(yd{1C]qrHjBIHcŲoA]F/*!=3Αbsy](f3DSqq^뒃MJ&=za+ 1}!Ƈ Ad]M1`A({{K502̞g1DS!}*sH~ B}!_B@dW`ѪLĞzed?_A킓ĞdÜdrAdE5 (x5Ĝ)iݏ.2Zq ]"}='i6&(kP+I:sm"1@@͘gIKn;`tCe:JPV:^Gla[w<, dKcXآb4b565jMLZ"s[}]snk4j-RUQFmV37-EELX.;r[{'^sER[*aJ!X,adZ65.Ě [Ec0QqHan {v{@ÐCqJ|LlܕpO/vԺFzB!:s 5!9%CtةP7e.V \]eY ;&4[.%JɥM,W"T5">yfCowb`JJЮ.%'SJ4=J'T:Ew];-AKG0 h@N(=: ̲s7 Á㓢}0+ ƊFED$Jl-$=9ħ!qe9zG^ >IBP8 .ƀ{e0% ZP-Ԣh+0^;p B^o.YDrRFѢmEW\o E{}tiImܟJ w,d]JqhP5l,Ak$t2(-4SD#{1H1L&-*ɉ(V8EV3#JI0tVQACE6!mL̜5&6#j ІcyׂCG@;#ubb) 2HcN$w1ܤ[/@`tEu̼sS6A% AkŰ1K& hɭ@M)9;q* V AY{rяъ54'=ӏF@}TBZ:ООiCHSE(RH#ѡHi:GЯKmP= =Ӵ;ڝ??L\ <(ɐu~wMkq˂H!&vlʋQ<;@̡^KB}wH/6EI5=_qe OM::p}6h0GP2ù',nF8۶:qٸƿl}?m".T!, ɂ ;/&àҜrJ["#Ɛ9^%5_=|z ^ -#Dmx܄}G&Os0h98d'PxᏠu]!q*hW@-)@[#"Z|8{8<148 &%(XRu^aַkzTD=,FaYDF-l\cirl]|$ې)%fI*B`]88xDlK:rr4c/u<tJ6([i0A()\iqq! ѯwg)ATUX) bƐEvC^ OB (R)!JO_''Hf2:St*h@!! |$\*yzi|qˇW7'B ܆sMR'JEfM{=4ONCI;4iL^o6 m Ei֍x㭒(q]]Ϡ. S -"0IiL%OG)2pwOtۨ%$Ì@<;F3Ƃ6$ Jpnc JU *Z)PP9 ).EkI҈jLAv RRP L;bc A=:(SB(!B%B;x,tfD5@NK*("lz44u)I:Н\I܃GkP'ug373zyx"B(@PjB4vBKŌ@0m!', O])($cdC\ Jy 0dhy0w-ǷKz cD{Ap3QMm.SpR)F-y&s!pF]D "$cķv0ՄY}>ł=lr0 c8CZDҴ%=u/@YJtRs׮f4+̅H:SH290!ZW@0R S9h$ zT 䐽 F iv@:Li0@1DPt(V`s%xfKFzM $e'aU@έD\ahb$LD;}}ṭɔN Uqg9DY;pXbc_6W` 1 6*"s d $>'/^SДt8"t:pOmϽ iЬ{J`I66.h:l.1:*{f%vrΥvL֥JʨNϬ\O$䇘ڜwV9gxA4%H:h )#Ķ>3KRЦV3Jvd=;vHi/|YzO8Ŕ]E}EAGq>Ǖ@Ӷ pcA :rVdYvHv8t{|nr<)J6pٖ88(f ebHwd:|d;2ቂ)Y裝8Jr3و>u x+3c[-i#QļNC]NПJ-+'Hz CӊS 3#.XգdC5t"u!:h"кD(U҆  ԩ<P):q(Ӟ*䈌  hxnf $tpNT:zhZ@p8<pm%Ph,hj- Ye4UN!2o\{yv,@gDג0Qc>yCуbXC&P9ѾyB9+8mD-IDk˒2=dvrEx8ᙐ9턃ͩSC닲=2ӸK@N0k_Q+H:v*NwRNBmDŒ ChN9ll !!PkM n.ܼwtkSY))N8ؼd;ԢhndלwpdQ-9#AJnEI9y!:EFd5U 4uBNJ9 #vHGcжt=% qs(2d̤;vKL^0Th 2pҎH'X%7i8)rCǤ]c{qD2:E wKRzMP(v7%UYDmKL)J#*ʲQTB4T[a &POBC5]Քi ZB&ar7tSS5$ɒḛ3RZ *`+}DRv;Q$@9=nBc X+RQ!OwDp=ffa,4CI#v!}~DD ;Rn޻ t^,<ьe<9ɝn!{a"99,K,iD/T܄;~:]#4~aS@Jt>:Gx!V,s1 J( #8NH>#w 4 rY!cd-ùk7ry;6j$EٓE/'H yahpkB)M%GWh) D2@́zzSi WA30 D]~% {1a8e`&&vNC'Mt:*c@z|v4~2D;o4{8 6th/i| L&y}9\՗b a+.YCa܄'Q1$O\yICICdbl )2ĩ1 ixepz} y}+\p& &^v6Ռ>;t9 NR6sY8 u](BQ)#({Uvm1^CCw0uJL8cF L!,elTqpIv`: Ҏ9:rpD9.r07Kܾ֟H4=zh4(=H4ZS*rH<8P)zw'd׼N={TmN;a#!2A`v26G.vEAK\*63#ky\?{'N|\X:NG 9~>Ǔ"NāP=p@҅-`jdm/2C3 J$ZD#b_a!}1/#bq>J@0z1ݽʾOzDVmmbrmg pZm#. I}><Ǝ^~BC|AinDÆ8Z0e.CX$[F1R[*HHR Q tZ@ɘ*t׉CJ?~>O87d0gg8*kxj6*J Hqm]cB6[r;wgۍ(};c IlFb1c$y `Í[@I81FhjBZn= |r5F .$$v wxXIО5 N92B=(sخ&};2<]H/n9!Bgm)J :}8eA>:C,)Cm$&p4X7Z#QGIc PPj,͌dmzLtQܙ4K O8kÚjC1|= ׬W2-QrM-3=M:E D3dܤ+I|%]j &(>\ϯu~E`Dlt4Qdǝ!%^SĢDaPݒ)1w]$0//$f'k>(V%`lt5^#o/KcY7;X "`3 DA^ؖ9bBJ*j%AT\**eKnm{ثcvN901lĸ)0`"(,;c9aPKYޢSqh@؊bH`Ѱ C-݀ @i tǎ Ali'%әY݌6@B.B'Y0^H/h/ZxD=\McA#[tםu22v̎94!48 kHdJ#/.ԥ.CX\jeҬXt ]iFNn})I-3ߟ>J"I0%!0tq 3\Nb0݌iAeyqd(⠅&!FF`"6Y,cT`yL`:4J:汪mFDa )m\H67A :_;(L0ȵB ʓ3^A^L bZFK;B:@)k Kuѯ{8gݞN1kqF\d̴1AY&SY˵` T =,ڜخ헭8{)PAF%Tv-XCig5#e "N1VG6t [MD݃"őPV7_?Nݾ.g.S [hrJAU,-An5$T={ FruZQgqKaH5 )g=B@ia̡3ʚrQ-/:|SDT?ߛ@Y.oo_ͨ5 Rq]ݼn>73 :dm{rg}Lbdm6ۂR[55ĭ|MǺF¤ֵ6Ц(*̮\