Mercurial > repos > iuc > mothur_deunique_tree

view test-data/sample2.fa @ 9:1ace9d6863aa draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 4c950508328589b5215b6c96868659a03f9dead8"
author iuc
date Tue, 08 Dec 2020 14:11:29 +0000
parents 90796e3ff3ef
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC