Mercurial > repos > iuc > mothur_fastq_info

view test-data/sample2.fa @ 1:7332408e1f37 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 721531d2e9fd1e208a3fba8cfbe5dcd572599ca2
author iuc
date Tue, 05 Sep 2017 16:52:35 -0400
parents 19316e7c4802
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC