Mercurial > repos > iuc > mothur_get_otulabels

view test-data/sample2.fa @ 1:56b4c4b3ce7c draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 721531d2e9fd1e208a3fba8cfbe5dcd572599ca2
author iuc
date Tue, 05 Sep 2017 17:07:56 -0400
parents ca0c577f910d
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC