Mercurial > repos > iuc > mothur_make_design

view test-data/sample2.fa @ 2:afa78efd7056 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 3418f23b9768f5aafb86488f5ec1cb97530d4fb3
author iuc
date Tue, 20 Mar 2018 22:23:04 -0400
parents 7f5f942a6862
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC