Mercurial > repos > iuc > mothur_make_shared

view test-data/sample2.fa @ 1:c4b6d7acffbf draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit e2075caee2ecdc6aed15a356e5328c5ca09cfb13
author iuc
date Fri, 09 Jun 2017 07:09:14 -0400
parents b8947620846f
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC