Mercurial > repos > iuc > mothur_mantel

view test-data/sample2.fa @ 6:bcc475f1af4a draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit debdcdbb89f9bf3e2c3eed05cb078eddb27d4684"
author iuc
date Mon, 02 Dec 2019 06:40:38 -0500
parents 04aa7542e2df
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC