Mercurial > repos > iuc > mothur_pcr_seqs

view test-data/sample2.fa @ 9:7dba7376870c draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit dfdd4c590370ecb3a9806314d43eb5668e36a01a"
author iuc
date Thu, 21 Jan 2021 23:55:22 +0000
parents 692381e1abfe
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC