Mercurial > repos > iuc > mothur_summary_tax

view test-data/sample2.fa @ 5:5eb0f670aa35 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/mothur commit 7f7605c2c8d8e92f3369dfdc290e5d8d06fa409a
author iuc
date Fri, 03 Aug 2018 14:47:32 -0400
parents 76c27b0fa016
children
line wrap: on
line source

> seq1 This is the description of my first and only sequence in sample 2.
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCACGACGTAGATGCTAGCTGACTCGATGC