comparison obisort.xml @ 4:b6d9ea2fb41b draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/obitools commit dabf62d438facc62f3e606ff4419092fdcdfaa44

3:e614dcabd870

<tool id="obi_sort" name="obisort" version="@TOOL_VERSION@" profile="@PROFILE@">
    <description>sorts sequence records according to the value of a given attribute</description>
    <macros>
        <import>macros.xml</import>
    </macros>
    <expand macro="requirements"/>
    <expand macro="stdio"/>

    <command><![CDATA[
        @GUNZIP_INPUT@
        obisort
        --without-progress-bar
        -k '$key'
        ${reverse}
        @INPUT_FORMAT@
        @OUT_FORMAT@
        input
        @GZIP_OUTPUT@
        > '$output'
        @GENERATE_GALAXY_JSON@
    ]]></command>
    <inputs>
        <param name="input" type="data" format="@INPUT_FORMATS@,txt,tabular" label="Input sequences file" />
        <param name="key" type="text" label="key"/>
        <param name="reverse" type="boolean" checked="false" truevalue="-r" falsevalue="" label="sorts in reverse order?" />
        <expand macro="input_format_options_macro"/>
        <expand macro="out_format_macro"/>
    </inputs>
    <outputs>
        <data format="auto" name="output"/>
    </outputs>
    <tests>
        <test>
            <param name="input" value="output_obiclean_advanced.fasta" />
            <param name="key" value="count"/>
            <param name="reverse" value="False"/>
            <param name="out_format" value="fasta"/>
            <output name="output" file="output_obisort.fasta" ftype="fasta"/>
        </test>
        <test>
            <param name="input" value="output_obiclean_advanced.fasta" />
            <param name="key" value="count"/>
            <param name="reverse" value="True"/>
            <param name="out_format" value="fastq"/>
            <output name="output" file="output_obisort.fastq" ftype="fastqsanger"/>

obisort sorts sequence records according to the value of a given attribute, which can be either numeric or alphanumeric.

@OBITOOLS_LINK@

        ]]>

    </help>
    <expand macro="citation" />
</tool>

4:b6d9ea2fb41b

<tool id="obi_sort" name="obisort" version="@TOOL_VERSION@" profile="@PROFILE@">
    <description>sorts sequence records according to the value of a given attribute</description>
    <macros>
        <import>macros.xml</import>
    </macros>
    <expand macro="bio_tools"/>
    <expand macro="requirements"/>
    <expand macro="stdio"/>

    <command><![CDATA[
        @GUNZIP_INPUT@
        obisort
        --without-progress-bar
        #if $key:
        -k '$key'
        #end if
        ${reverse}
        @INPUT_FORMAT@
        @OUT_FORMAT@
        input
        @GZIP_OUTPUT@
        > '$output'
        @GENERATE_GALAXY_JSON@
    ]]></command>
    <inputs>
        <param name="input" type="data" format="@INPUT_FORMATS@,txt,tabular" label="Input sequences file"/>
        <param
            name="key"
            type="text"
            label="Key"
            help="This key must be encoded in your FASTA/FASTQ headers as key=value. See help (below) for more information."
            optional="false"/>
        <param name="reverse" type="boolean" checked="false" truevalue="-r" falsevalue="" label="Sort in reverse order?" />
        <expand macro="input_format_options_macro"/>
        <expand macro="out_format_macro"/>
    </inputs>
    <outputs>
        <data format="auto" name="output"/>
    </outputs>
    <tests>
        <test expect_num_outputs="1">
            <param name="input" value="output_obiclean_advanced.fasta" />
            <param name="key" value="count"/>
            <param name="reverse" value="False"/>
            <param name="out_format" value="fasta"/>
            <output name="output" file="output_obisort.fasta" ftype="fasta"/>
        </test>
        <test expect_num_outputs="1">
            <param name="input" value="output_obiclean_advanced.fasta" />
            <param name="key" value="count"/>
            <param name="reverse" value="True"/>
            <param name="out_format" value="fastq"/>
            <output name="output" file="output_obisort.fastq" ftype="fastqsanger"/>

obisort sorts sequence records according to the value of a given attribute, which can be either numeric or alphanumeric.

@OBITOOLS_LINK@

**Inputs:**

For sorting by key, the input file must be in the
`OBITools FASTA/FASTQ format <https://pythonhosted.org/OBITools/attributes.html>`_.
If your file is an OBITools output, it should already be formatted correctly.

For FASTA files, your headers should look like this::

    >my_sequence taxid=3456; direct=True; sample=A354; this is my pretty sequence
    ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
    GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
    AACGACGTTGCAGTACGTTGCAGT

Where ``taxid``, ``direct``, and ``sample`` are keys that can be used for sorting.

If your sequences don't have title, you can format the headers with a trailing semicolon like so::

    >my_sequence key1=value1;

For sorting OBITools output files, a list of OBITools sequence attributes are documented
`here <https://pythonhosted.org/OBITools/attributes.html#names-reserved-for-attributes>`_.

]]>
    </help>
    <expand macro="citation" />
</tool>