view test-data/output_obiannotate.fasta @ 3:e614dcabd870 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/obitools commit 5d3c7a7b3f7d687bb03ef7993ddf1a6507d655bd"
author iuc
date Mon, 10 May 2021 19:34:04 +0000
parents aca6a8c9cf83
children
line wrap: on
line source

>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=1; count=1; seq_length=100; 
ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaat
agctcaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=2; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=3; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaag
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 30, '15a_F730814': 31}; count=61; seq_length=100; seq_rank=4; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 64}; seq_rank=5; count=64; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 3}; seq_rank=6; count=3; seq_length=100; 
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 2}; seq_rank=7; count=2; seq_length=100; 
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 46}; count=46; seq_length=100; seq_rank=8; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=9; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttatcccctt
>HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=10; count=1; seq_length=100; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=11; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=12; count=1; seq_length=99; 
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaagaactgggcggtgctttatatcccg
>HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1, '15a_F730814': 1}; seq_rank=13; count=2; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=14; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaaca
ggctgaaactcaaaggacttggcggtggtttacatccct
>HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 2}; seq_rank=15; count=2; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 7}; seq_rank=16; count=7; seq_length=4; 
tttt
>HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=17; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcacaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=18; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcataaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=19; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaat
agcttaaaactcaaaggacttggcggtgctttatacgctt
>HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 2}; seq_rank=20; count=2; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccttt
>HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=21; count=1; seq_length=100; 
ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctg
>HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=22; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=23; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=24; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctacctgcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP merged_sample={'13a_F730603': 1}; seq_rank=25; count=1; seq_length=100; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
agctcaaaactcaaagaacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 1}; seq_rank=26; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgtcagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 1}; seq_rank=27; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattatccgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 1}; seq_rank=28; count=1; seq_length=100; 
ttagccctaaacacaagaaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=29; count=1; seq_length=100; 
ctagccctaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=30; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=31; count=1; seq_length=100; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcact
agcttacaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=32; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaagggcttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=33; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctggaacgcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=34; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaagcactcggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 1}; seq_rank=35; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=36; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=37; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggtaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=38; count=1; seq_length=5; 
caata
>HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=39; count=1; seq_length=100; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctc
>HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP merged_sample={'13a_F730603': 1}; seq_rank=40; count=1; seq_length=100; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtgctaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=41; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactcgcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=42; count=1; seq_length=100; 
ctagccttaaacacaaatagttatgcaaacacaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 1}; seq_rank=43; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=44; count=1; seq_length=100; 
ttacccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=45; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacaggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=46; count=1; seq_length=99; 
ttagccctaaacacaagtaattaatatacaaaattattcgccagagtactaccggcaata
gcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=47; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgcaagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=48; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacacccct
>HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=49; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaaca
gcatgaaactcaaagaactgggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=50; count=1; seq_length=98; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gccgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=51; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=52; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=53; count=1; seq_length=99; 
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=54; count=1; seq_length=100; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=55; count=1; seq_length=99; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 1}; seq_rank=56; count=1; seq_length=100; 
ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=57; count=1; seq_length=100; 
ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=58; count=1; seq_length=99; 
ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct