view test-data/output_obiclean_simple.fasta @ 3:e614dcabd870 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/obitools commit 5d3c7a7b3f7d687bb03ef7993ddf1a6507d655bd"
author iuc
date Mon, 10 May 2021 19:34:04 +0000
parents aca6a8c9cf83
children
line wrap: on
line source

>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=1; merged_sample={'29a_F260619': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaat
agctcaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; obiclean_count={'XXX': 81}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 'h'}; seq_rank=4; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_samplecount=1; obiclean_headcount=1; obiclean_singletoncount=0; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; obiclean_count={'XXX': 77}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 'h'}; seq_rank=5; merged_sample={'26a_F040644': 64}; obiclean_samplecount=1; obiclean_headcount=1; obiclean_singletoncount=0; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP count=3; obiclean_count={'XXX': 3}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=6; merged_sample={'29a_F260619': 3}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; obiclean_count={'XXX': 52}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 'h'}; seq_rank=8; merged_sample={'13a_F730603': 46}; obiclean_samplecount=1; obiclean_headcount=1; obiclean_singletoncount=0; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=11; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=12; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaagaactgggcggtgctttatatcccg
>HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=14; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaaca
ggctgaaactcaaaggacttggcggtggtttacatccct
>HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; obiclean_count={'XXX': 7}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB'}; seq_length=4; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=16; merged_sample={'29a_F260619': 7}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
tttt
>HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=19; merged_sample={'29a_F260619': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaat
agcttaaaactcaaaggacttggcggtgctttatacgctt
>HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=21; merged_sample={'29a_F260619': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctg
>HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=22; merged_sample={'15a_F730814': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=25; merged_sample={'13a_F730603': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
agctcaaaactcaaagaacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=30; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=31; merged_sample={'13a_F730603': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcact
agcttacaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=33; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctggaacgcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=34; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaagcactcggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=35; merged_sample={'15a_F730814': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB'}; seq_length=5; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=38; merged_sample={'13a_F730603': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
caata
>HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=43; merged_sample={'29a_F260619': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=49; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaaca
gcatgaaactcaaagaactgggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=53; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=56; merged_sample={'15a_F730814': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctat
agcttaaaactcaaaggacttggcggtgctttataccctt