Mercurial > repos > iuc > prinseq
comparison prinseq.xml @ 0:ba78b984a9eb draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/prinseq/ commit dd85747b08272b72c7161de9b18d19598bb49de1
| author | iuc |
|---|---|
| date | Tue, 31 May 2016 07:43:42 -0400 |
| parents | |
| children | 6b865dde1baa |
comparison
equal
deleted
inserted
replaced
| -1:000000000000 | 0:ba78b984a9eb |
|---|---|
| 1 <tool id="prinseq" name="PRINSEQ" version="0.1.0"> | |
| 2 <description>to process quality of sequences</description> | |
| 3 | |
| 4 <requirements> | |
| 5 <requirement type="package" version="5.18.1">perl</requirement> | |
| 6 <!--<requirement type="package" version="2.90">perl-json</requirement> | |
| 7 <requirement type="package" version="1.106">perl-cairo</requirement>--> | |
| 8 <requirement type="package" version="0.20.4">prinseq</requirement> | |
| 9 </requirements> | |
| 10 | |
| 11 <stdio> | |
| 12 <exit_code range="1:" level="fatal" description="" /> | |
| 13 <regex match="ERROR" | |
| 14 source="stderr" | |
| 15 level="fatal" | |
| 16 description="" /> | |
| 17 <regex match="WARNING" | |
| 18 source="stderr" | |
| 19 level="warning" | |
| 20 description="" /> | |
| 21 </stdio> | |
| 22 | |
| 23 <version_command> | |
| 24 <![CDATA[ | |
| 25 prinseq-lite.pl --version | |
| 26 ]]> | |
| 27 </version_command> | |
| 28 | |
| 29 <command> | |
| 30 <![CDATA[ | |
| 31 mkdir tmp/ | |
| 32 | |
| 33 && | |
| 34 | |
| 35 prinseq-lite.pl | |
| 36 #if $seq_type.seq_type_opt == "single": | |
| 37 -fastq "$seq_type.input_singles" | |
| 38 #if $seq_type.input_singles.ext == "fastqillumina": | |
| 39 -phred64 | |
| 40 #end if | |
| 41 #else: | |
| 42 -fastq "$seq_type.input_mate1" | |
| 43 -fastq2 "$seq_type.input_mate2" | |
| 44 #if $seq_type.input_mate1.ext != $seq_type.input_mate2.ext: | |
| 45 #import sys | |
| 46 #silent sys.stderr.write( 'Both pairs from your paired-end library need to be from the same filetype.' ) | |
| 47 #end if | |
| 48 #if $seq_type.input_mate1.ext == "fastqillumina": | |
| 49 -phred64 | |
| 50 #end if | |
| 51 #end if | |
| 52 | |
| 53 -out_good "tmp/good_sequences" | |
| 54 -out_bad "tmp/rejected_sequences" | |
| 55 | |
| 56 #if $filter_treatments.apply_filter_treatments == "true": | |
| 57 #set length_filter_treatments=$filter_treatments.length_filter_treatments | |
| 58 #if $length_filter_treatments.apply_length_filter_treatments == "true": | |
| 59 #set min_length_filter_treatments=$length_filter_treatments.min_length_filter_treatments | |
| 60 #if $min_length_filter_treatments.apply_min_length_filter_treatments == "true": | |
| 61 -min_len $min_length_filter_treatments.min_length_filter_treatment_value | |
| 62 #end if | |
| 63 | |
| 64 #set max_length_filter_treatments=$length_filter_treatments.max_length_filter_treatments | |
| 65 #if $max_length_filter_treatments.apply_max_length_filter_treatments == "true": | |
| 66 -max_len $max_length_filter_treatments.max_length_filter_treatment_value | |
| 67 #end if | |
| 68 #end if | |
| 69 | |
| 70 #set quality_filter_treatments=$filter_treatments.quality_filter_treatments | |
| 71 #if $quality_filter_treatments.apply_quality_filter_treatments == "true": | |
| 72 #set min_quality_filter_treatments=$quality_filter_treatments.min_quality_filter_treatments | |
| 73 #if $min_quality_filter_treatments.apply_min_quality_filter_treatments == "true": | |
| 74 -min_qual_score $min_quality_filter_treatments.min_quality_filter_treatment_value | |
| 75 #end if | |
| 76 | |
| 77 #set max_quality_filter_treatments=$quality_filter_treatments.max_quality_filter_treatments | |
| 78 #if $max_quality_filter_treatments.apply_max_quality_filter_treatments == "true": | |
| 79 -max_qual_score $max_quality_filter_treatments.max_quality_filter_treatment_value | |
| 80 #end if | |
| 81 | |
| 82 #set mean_quality_filter_treatments=$quality_filter_treatments.mean_quality_filter_treatments | |
| 83 #if $mean_quality_filter_treatments.apply_mean_quality_filter_treatments == "true": | |
| 84 #set min_mean_quality_filter_treatments=$mean_quality_filter_treatments.min_mean_quality_filter_treatments | |
| 85 #if $min_mean_quality_filter_treatments.apply_min_mean_quality_filter_treatments == "true": | |
| 86 -min_qual_mean $min_mean_quality_filter_treatments.min_mean_quality_filter_treatment_value | |
| 87 #end if | |
| 88 | |
| 89 #set max_mean_quality_filter_treatments=$mean_quality_filter_treatments.max_mean_quality_filter_treatments | |
| 90 #if $max_mean_quality_filter_treatments.apply_max_mean_quality_filter_treatments == "true": | |
| 91 -max_qual_mean $max_mean_quality_filter_treatments.max_mean_quality_filter_treatment_value | |
| 92 #end if | |
| 93 #end if | |
| 94 #end if | |
| 95 | |
| 96 #set base_content_filter_treatments=$filter_treatments.base_content_filter_treatments | |
| 97 #if $base_content_filter_treatments.apply_base_content_filter_treatments == "true": | |
| 98 #set GC_perc_content_filter_treatments=$base_content_filter_treatments.GC_perc_content_filter_treatments | |
| 99 #if $GC_perc_content_filter_treatments.apply_GC_perc_content_filter_treatments == "true": | |
| 100 #set min_GC_perc_content_filter_treatments=$GC_perc_content_filter_treatments.min_GC_perc_content_filter_treatments | |
| 101 #if $min_GC_perc_content_filter_treatments.apply_min_GC_perc_content_filter_treatments == "true": | |
| 102 -min_gc $min_GC_perc_content_filter_treatments.min_GC_perc_content_filter_treatment_value | |
| 103 #end if | |
| 104 | |
| 105 #set max_GC_perc_content_filter_treatments=$GC_perc_content_filter_treatments.max_GC_perc_content_filter_treatments | |
| 106 #if $max_GC_perc_content_filter_treatments.apply_max_GC_perc_content_filter_treatments == "true": | |
| 107 -max_gc $max_GC_perc_content_filter_treatments.max_GC_perc_content_filter_treatment_value | |
| 108 #end if | |
| 109 #end if | |
| 110 | |
| 111 #set N_number_content_filter_treatments=$base_content_filter_treatments.N_number_content_filter_treatments | |
| 112 #if $N_number_content_filter_treatments.apply_N_number_content_filter_treatments == "true": | |
| 113 -ns_max_n $N_number_content_filter_treatments.N_number_content_filter_treatment_value | |
| 114 #end if | |
| 115 | |
| 116 #set N_percentage_content_filter_treatments=$base_content_filter_treatments.N_percentage_content_filter_treatments | |
| 117 #if $N_percentage_content_filter_treatments.apply_N_percentage_content_filter_treatments == "true": | |
| 118 -ns_max_p $N_percentage_content_filter_treatments.N_percentage_content_filter_treatment_value | |
| 119 #end if | |
| 120 | |
| 121 $base_content_filter_treatments.apply_other_base_content_filter_treatments | |
| 122 #end if | |
| 123 | |
| 124 #set complexity_filter_treatments=$filter_treatments.complexity_filter_treatments | |
| 125 #if $complexity_filter_treatments.apply_complexity_filter_treatments == "true": | |
| 126 -lc_method $complexity_filter_treatments.method_complexity_filter_treatments | |
| 127 -lc_threshold $complexity_filter_treatments.threshold_complexity_filter_treatments | |
| 128 #end if | |
| 129 | |
| 130 #end if | |
| 131 | |
| 132 #if $trimming_treatments.apply_trimming_treatments == "true": | |
| 133 #set length_trimming_treatments=$trimming_treatments.length_trimming_treatments | |
| 134 #if $length_trimming_treatments.apply_length_trimming_treatments == "true": | |
| 135 -trim_to_len $length_trimming_treatments.length_trimming_treatment_value | |
| 136 #end if | |
| 137 | |
| 138 #set position_trimming_treatments=$trimming_treatments.position_trimming_treatments | |
| 139 #if $position_trimming_treatments.apply_position_trimming_treatments == "true": | |
| 140 #set nb_position_trimming_treatments=$position_trimming_treatments.nb_position_trimming_treatments | |
| 141 #if $nb_position_trimming_treatments.apply_nb_position_trimming_treatments == "true": | |
| 142 #set left_position_trimming_treatments=$nb_position_trimming_treatments.left_position_trimming_treatments | |
| 143 #if $left_position_trimming_treatments.apply_left_position_trimming_treatments == "true": | |
| 144 -trim_left $left_position_trimming_treatments.left_position_trimming_treatment_value | |
| 145 #end if | |
| 146 | |
| 147 #set right_position_trimming_treatments=$nb_position_trimming_treatments.right_position_trimming_treatments | |
| 148 #if $right_position_trimming_treatments.apply_right_position_trimming_treatments == "true": | |
| 149 -trim_right $right_position_trimming_treatments.right_position_trimming_treatment_value | |
| 150 #end if | |
| 151 #end if | |
| 152 | |
| 153 #set percentage_position_trimming_treatments=$position_trimming_treatments.percentage_position_trimming_treatments | |
| 154 #if $percentage_position_trimming_treatments.apply_percentage_position_trimming_treatments == "true": | |
| 155 #set left_percentage_position_trimming_treatments=$percentage_position_trimming_treatments.left_percentage_position_trimming_treatments | |
| 156 #if $left_percentage_position_trimming_treatments.apply_left_percentage_position_trimming_treatments == "true": | |
| 157 -trim_left_p $left_percentage_position_trimming_treatments.left_percentage_position_trimming_treatment_value | |
| 158 #end if | |
| 159 | |
| 160 #set right_percentage_position_trimming_treatments=$percentage_position_trimming_treatments.right_percentage_position_trimming_treatments | |
| 161 #if $right_percentage_position_trimming_treatments.apply_right_percentage_position_trimming_treatments == "true": | |
| 162 -trim_right_p $right_percentage_position_trimming_treatments.right_percentage_position_trimming_treatment_value | |
| 163 #end if | |
| 164 #end if | |
| 165 #end if | |
| 166 | |
| 167 #set tail_trimming_treatments=$trimming_treatments.tail_trimming_treatments | |
| 168 #if $tail_trimming_treatments.apply_tail_trimming_treatments == "true": | |
| 169 #set a_t_tail_trimming_treatments=$tail_trimming_treatments.a_t_tail_trimming_treatments | |
| 170 #if $a_t_tail_trimming_treatments.apply_a_t_tail_trimming_treatments == "true": | |
| 171 #set left_a_t_tail_trimming_treatments=$a_t_tail_trimming_treatments.left_a_t_tail_trimming_treatments | |
| 172 #if $left_a_t_tail_trimming_treatments.apply_left_a_t_tail_trimming_treatments == "true": | |
| 173 -trim_tail_left $left_a_t_tail_trimming_treatments.left_a_t_tail_trimming_treatment_value | |
| 174 #end if | |
| 175 | |
| 176 #set right_a_t_tail_trimming_treatments=$a_t_tail_trimming_treatments.right_a_t_tail_trimming_treatments | |
| 177 #if $right_a_t_tail_trimming_treatments.apply_right_a_t_tail_trimming_treatments == "true": | |
| 178 -trim_tail_right $right_a_t_tail_trimming_treatments.right_a_t_tail_trimming_treatment_value | |
| 179 #end if | |
| 180 #end if | |
| 181 | |
| 182 #set ns_tail_trimming_treatments=$tail_trimming_treatments.ns_tail_trimming_treatments | |
| 183 #if $ns_tail_trimming_treatments.apply_ns_tail_trimming_treatments == "true": | |
| 184 #set left_ns_tail_trimming_treatments=$ns_tail_trimming_treatments.left_ns_tail_trimming_treatments | |
| 185 #if $left_ns_tail_trimming_treatments.apply_left_ns_tail_trimming_treatments == "true": | |
| 186 -trim_ns_left $left_ns_tail_trimming_treatments.left_ns_tail_trimming_treatment_value | |
| 187 #end if | |
| 188 | |
| 189 #set right_ns_tail_trimming_treatments=$ns_tail_trimming_treatments.right_ns_tail_trimming_treatments | |
| 190 #if $right_ns_tail_trimming_treatments.apply_right_ns_tail_trimming_treatments == "true": | |
| 191 -trim_ns_right $right_ns_tail_trimming_treatments.right_ns_tail_trimming_treatment_value | |
| 192 #end if | |
| 193 #end if | |
| 194 #end if | |
| 195 | |
| 196 #set quality_trimming_treatments=$trimming_treatments.quality_trimming_treatments | |
| 197 #if $quality_trimming_treatments.apply_quality_trimming_treatments == "true": | |
| 198 #set left_quality_trimming_treatments=$quality_trimming_treatments.left_quality_trimming_treatments | |
| 199 #if $left_quality_trimming_treatments.apply_left_quality_trimming_treatments == "true": | |
| 200 -trim_qual_left $left_quality_trimming_treatments.left_quality_trimming_treatment_value | |
| 201 #end if | |
| 202 | |
| 203 #set right_quality_trimming_treatments=$quality_trimming_treatments.right_quality_trimming_treatments | |
| 204 #if $right_quality_trimming_treatments.apply_right_quality_trimming_treatments == "true": | |
| 205 -trim_qual_right $right_quality_trimming_treatments.right_quality_trimming_treatment_value | |
| 206 #end if | |
| 207 | |
| 208 -trim_qual_type $quality_trimming_treatments.type_quality_trimming_treatments | |
| 209 -trim_qual_rule $quality_trimming_treatments.rule_quality_trimming_treatments | |
| 210 -trim_qual_window $quality_trimming_treatments.window_quality_trimming_treatments | |
| 211 -trim_qual_step $quality_trimming_treatments.step_quality_trimming_treatments | |
| 212 #end if | |
| 213 | |
| 214 #end if | |
| 215 | |
| 216 #* | |
| 217 -graph_stats "$graph_stats" | |
| 218 -graph_data tmp/stats.gd | |
| 219 | |
| 220 | |
| 221 && | |
| 222 | |
| 223 prinseq-graphs-noPCA.pl -i "tmp/stats.gd" -html_all -o stats_html | |
| 224 *# | |
| 225 ]]> | |
| 226 </command> | |
| 227 | |
| 228 <inputs> | |
| 229 <conditional name="seq_type"> | |
| 230 <param name="seq_type_opt" type="select" label="Is this library paired- or single-end?"> | |
| 231 <option value="single" selected="true">Single-end</option> | |
| 232 <option value="paired">Paired-end</option> | |
| 233 </param> | |
| 234 <when value="single"> | |
| 235 <param name="input_singles" type="data" format="fastqsanger,fastqillumina,fastq" label="FASTQ file" help="FASTQ files." /> | |
| 236 </when> | |
| 237 <when value="paired"> | |
| 238 <param name="input_mate1" type="data" format="fastqsanger,fastqillumina,fastq" label="FASTQ file" help="FASTQ files." /> | |
| 239 <param name="input_mate2" type="data" format="fastqsanger,fastqillumina,fastq" label="FASTQ file" help="FASTQ files." /> | |
| 240 </when> | |
| 241 </conditional> | |
| 242 | |
| 243 <conditional name="filter_treatments"> | |
| 244 <param name="apply_filter_treatments" type="select" label="Apply filter treatments?"> | |
| 245 <option value="true" selected="true">Yes</option> | |
| 246 <option value="false">No</option> | |
| 247 </param> | |
| 248 <when value="true"> | |
| 249 <conditional name="length_filter_treatments"> | |
| 250 <param name="apply_length_filter_treatments" type="select" label="Filter sequence based on their length?" help="By default, sequences smaller than 60 bp are removed. No top threshold is defined"> | |
| 251 <option value="true" selected="true">Yes</option> | |
| 252 <option value="false">No</option> | |
| 253 </param> | |
| 254 <when value="true"> | |
| 255 <conditional name="min_length_filter_treatments"> | |
| 256 <param name="apply_min_length_filter_treatments" type="select" label="Filter too small sequences?" help="By default, sequences smaller than 60 bp are removed."> | |
| 257 <option value="true" selected="true">Yes</option> | |
| 258 <option value="false">No</option> | |
| 259 </param> | |
| 260 <when value="true"> | |
| 261 <param name="min_length_filter_treatment_value" type="integer" min="0" max="3000" value="60" label="Minimum length threshold to conserve sequences" help="(-min_len)"/> | |
| 262 </when> | |
| 263 <when value="false" /> | |
| 264 </conditional> | |
| 265 <conditional name="max_length_filter_treatments"> | |
| 266 <param name="apply_max_length_filter_treatments" type="select" label="Filter too big sequences?" help="By default, no treatment based on a maximal length is made."> | |
| 267 <option value="true">Yes</option> | |
| 268 <option value="false" selected="true">No</option> | |
| 269 </param> | |
| 270 <when value="true"> | |
| 271 <param name="max_length_filter_treatment_value" type="integer" min="0" max="3000" value="1000" label="Maximal length threshold to conserve sequences" help="(-max_len)"/> | |
| 272 </when> | |
| 273 <when value="false" /> | |
| 274 </conditional> | |
| 275 </when> | |
| 276 <when value="false" /> | |
| 277 </conditional> | |
| 278 <conditional name="quality_filter_treatments"> | |
| 279 <param name="apply_quality_filter_treatments" type="select" label="Filter sequences based on quality score?" help="By default, sequences with a mean score below 15 are removed."> | |
| 280 <option value="true" selected="true">Yes</option> | |
| 281 <option value="false">No</option> | |
| 282 </param> | |
| 283 <when value="true"> | |
| 284 <conditional name="min_quality_filter_treatments"> | |
| 285 <param name="apply_min_quality_filter_treatments" type="select" label="Filter sequences based on their minimum score?" help="By default, no treatment based on a minimum score is made."> | |
| 286 <option value="true">Yes</option> | |
| 287 <option value="false" selected="true">No</option> | |
| 288 </param> | |
| 289 <when value="true"> | |
| 290 <param name="min_quality_filter_treatment_value" type="integer" min="0" max="40" value="2" label="Minimum score threshold to conserve sequences" help="(-min_qual_score)"/> | |
| 291 </when> | |
| 292 <when value="false" /> | |
| 293 </conditional> | |
| 294 <conditional name="max_quality_filter_treatments"> | |
| 295 <param name="apply_max_quality_filter_treatments" type="select" label="Filter sequences based on their maximum score?" help="By default, no treatment based on a minimum score is made."> | |
| 296 <option value="true">Yes</option> | |
| 297 <option value="false" selected="true">No</option> | |
| 298 </param> | |
| 299 <when value="true"> | |
| 300 <param name="max_quality_filter_treatment_value" type="integer" min="0" max="40" value="38" label="Maximum score threshold to conserve sequences" help="(-max_qual_score)"/> | |
| 301 </when> | |
| 302 <when value="false" /> | |
| 303 </conditional> | |
| 304 <conditional name="mean_quality_filter_treatments"> | |
| 305 <param name="apply_mean_quality_filter_treatments" type="select" label="Filter sequences based on their mean score?" help="By default, sequences with a mean score below 15 are removed."> | |
| 306 <option value="true" selected="true">Yes</option> | |
| 307 <option value="false">No</option> | |
| 308 </param> | |
| 309 <when value="true"> | |
| 310 <conditional name="min_mean_quality_filter_treatments"> | |
| 311 <param name="apply_min_mean_quality_filter_treatments" type="select" label="Filter sequences based with too small mean score?" help="By default, sequences with a mean score below 15 are removed."> | |
| 312 <option value="true" selected="true">Yes</option> | |
| 313 <option value="false">No</option> | |
| 314 </param> | |
| 315 <when value="true"> | |
| 316 <param name="min_mean_quality_filter_treatment_value" type="integer" min="0" max="40" value="15" label="Minimum mean score threshold to conserve sequences" help="(-min_qual_mean)"/> | |
| 317 </when> | |
| 318 <when value="false" /> | |
| 319 </conditional> | |
| 320 <conditional name="max_mean_quality_filter_treatments"> | |
| 321 <param name="apply_max_mean_quality_filter_treatments" type="select" label="Filter sequences based with too high mean score?" help="By default, no treatment based on a maximum mean score is made."> | |
| 322 <option value="true">Yes</option> | |
| 323 <option value="false" selected="true">No</option> | |
| 324 </param> | |
| 325 <when value="true"> | |
| 326 <param name="max_mean_quality_filter_treatment_value" type="integer" min="0" max="40" value="40" label="Maximum mean score threshold to conserve sequences" help="(-max_qual_mean)"/> | |
| 327 </when> | |
| 328 <when value="false" /> | |
| 329 </conditional> | |
| 330 </when> | |
| 331 <when value="false" /> | |
| 332 </conditional> | |
| 333 </when> | |
| 334 <when value="false" /> | |
| 335 </conditional> | |
| 336 <conditional name="base_content_filter_treatments"> | |
| 337 <param name="apply_base_content_filter_treatments" type="select" label="Filter sequences based on their base content?" help="By default, sequences with more than 2% of N bases are removed."> | |
| 338 <option value="true" selected="true">Yes</option> | |
| 339 <option value="false">No</option> | |
| 340 </param> | |
| 341 <when value="true"> | |
| 342 <conditional name="GC_perc_content_filter_treatments"> | |
| 343 <param name="apply_GC_perc_content_filter_treatments" type="select" label="Filter sequences based on their GC percentage?" help="By default, no treatment based on GC percentage is made."> | |
| 344 <option value="true">Yes</option> | |
| 345 <option value="false" selected="true">No</option> | |
| 346 </param> | |
| 347 <when value="true"> | |
| 348 <conditional name="min_GC_perc_content_filter_treatments"> | |
| 349 <param name="apply_min_GC_perc_content_filter_treatments" type="select" label="Filter sequences with too small GC percentage?" help="By default, no treatment based on GC percentage is made."> | |
| 350 <option value="true">Yes</option> | |
| 351 <option value="false" selected="true">No</option> | |
| 352 </param> | |
| 353 <when value="true"> | |
| 354 <param name="min_GC_perc_content_filter_treatment_value" type="integer" min="0" max="100" value="10" label="Minimal GC percentage threshold to conserve sequences" help="(-min_gc)"/> | |
| 355 </when> | |
| 356 <when value="false" /> | |
| 357 </conditional> | |
| 358 <conditional name="max_GC_perc_content_filter_treatments"> | |
| 359 <param name="apply_max_GC_perc_content_filter_treatments" type="select" label="Filter sequences with too high GC percentage?" help="By default, no treatment based on GC percentage is made."> | |
| 360 <option value="true">Yes</option> | |
| 361 <option value="false" selected="true">No</option> | |
| 362 </param> | |
| 363 <when value="true"> | |
| 364 <param name="max_GC_perc_content_filter_treatment_value" type="integer" min="0" max="100" value="90" label="Maximal GC percentage threshold to conserve sequences" help="(-max_gc)"/> | |
| 365 </when> | |
| 366 <when value="false" /> | |
| 367 </conditional> | |
| 368 </when> | |
| 369 <when value="false" /> | |
| 370 </conditional> | |
| 371 <conditional name="N_number_content_filter_treatments"> | |
| 372 <param name="apply_N_number_content_filter_treatments" type="select" label="Filter sequences based on their number of N bases?" help="By default, no treatment based on N number is made."> | |
| 373 <option value="true">Yes</option> | |
| 374 <option value="false" selected="true">No</option> | |
| 375 </param> | |
| 376 <when value="true"> | |
| 377 <param name="N_number_content_filter_treatment_value" type="integer" min="0" max="3000" value="10" label="Maximal N number threshold to conserve sequences" help="(-ns_max_n)"/> | |
| 378 </when> | |
| 379 <when value="false" /> | |
| 380 </conditional> | |
| 381 <conditional name="N_percentage_content_filter_treatments"> | |
| 382 <param name="apply_N_percentage_content_filter_treatments" type="select" label="Filter sequences based on their percentage of N bases?" help="By default, sequences with more than 2% of N bases are removed."> | |
| 383 <option value="true" selected="true">Yes</option> | |
| 384 <option value="false">No</option> | |
| 385 </param> | |
| 386 <when value="true"> | |
| 387 <param name="N_percentage_content_filter_treatment_value" type="integer" min="0" max="100" value="2" label="Maximal N percentage threshold to conserve sequences" help="(-ns_max_p)"/> | |
| 388 </when> | |
| 389 <when value="false" /> | |
| 390 </conditional> | |
| 391 <param name='apply_other_base_content_filter_treatments' type='boolean' truevalue="-noniupac" falsevalue="" checked="false" label="Filter sequences with characters other than A, T, C, G and N?" help="By default, this treatment is not made. (-noniupac)"/> | |
| 392 </when> | |
| 393 <when value="false" /> | |
| 394 </conditional> | |
| 395 <conditional name="complexity_filter_treatments"> | |
| 396 <param name="apply_complexity_filter_treatments" type="select" label="Filter sequences based on their complexity?" help="By default, no complexity filter is applied."> | |
| 397 <option value="true">Yes</option> | |
| 398 <option value="false" selected="true">No</option> | |
| 399 </param> | |
| 400 <when value="true"> | |
| 401 <param name="method_complexity_filter_treatments" type="select" display="radio" label="Method to filter low complexity sequences" help="(-lc_method)"> | |
| 402 <option value="dust">Dust</option> | |
| 403 <option value="entropy" >Entropy</option> | |
| 404 </param> | |
| 405 <param name="threshold_complexity_filter_treatments" type="integer" min="0" max="100" value="2" label="Threshold value used to filter sequences by sequence complexity" help="The dust method uses the threshold as maximum allowed score and the entropy method as minimum allowed value.(-lc_threshold)"/> | |
| 406 </when> | |
| 407 <when value="false" /> | |
| 408 </conditional> | |
| 409 </when> | |
| 410 <when value="false" /> | |
| 411 </conditional> | |
| 412 | |
| 413 <conditional name="trimming_treatments"> | |
| 414 <param name="apply_trimming_treatments" type="select" label="Apply trimming treatments?" help=""> | |
| 415 <option value="true" selected="true">Yes</option> | |
| 416 <option value="false">No</option> | |
| 417 </param> | |
| 418 <when value="true"> | |
| 419 <conditional name="length_trimming_treatments"> | |
| 420 <param name="apply_length_trimming_treatments" type="select" label="Trim all sequences from the 3'-end to a defined length?" help="By default, no length trimming is made"> | |
| 421 <option value="true">Yes</option> | |
| 422 <option value="false" selected="true">No</option> | |
| 423 </param> | |
| 424 <when value="true"> | |
| 425 <param name="length_trimming_treatment_value" type="integer" min="0" max="3000" value="100" label="Length of sequences after trimming" help="(-trim_to_len)"/> | |
| 426 </when> | |
| 427 <when value="false" /> | |
| 428 </conditional> | |
| 429 <conditional name="position_trimming_treatments"> | |
| 430 <param name="apply_position_trimming_treatments" type="select" label="Trim all sequences from the ends?" help="By default, no position trimming is made"> | |
| 431 <option value="true">Yes</option> | |
| 432 <option value="false" selected="true">No</option> | |
| 433 </param> | |
| 434 <when value="true"> | |
| 435 <conditional name="nb_position_trimming_treatments"> | |
| 436 <param name="apply_nb_position_trimming_treatments" type="select" label="Trim sequences by a defined number of positions?" help="By default, no position trimming is made"> | |
| 437 <option value="true">Yes</option> | |
| 438 <option value="false" selected="true">No</option> | |
| 439 </param> | |
| 440 <when value="true"> | |
| 441 <conditional name="left_position_trimming_treatments"> | |
| 442 <param name="apply_left_position_trimming_treatments" type="select" label="Trim sequences at the 5'-end by a defined number of positions?" help="By default, no position trimming is made"> | |
| 443 <option value="true">Yes</option> | |
| 444 <option value="false" selected="true">No</option> | |
| 445 </param> | |
| 446 <when value="true"> | |
| 447 <param name="left_position_trimming_treatment_value" type="integer" min="0" max="3000" value="100" label="Number of positions to trim on 5'-end" help="(-trim_left)"/> | |
| 448 </when> | |
| 449 <when value="false" /> | |
| 450 </conditional> | |
| 451 <conditional name="right_position_trimming_treatments"> | |
| 452 <param name="apply_right_position_trimming_treatments" type="select" label="Trim sequences at the 3'-end by a defined number of positions?" help="By default, no position trimming is made"> | |
| 453 <option value="true">Yes</option> | |
| 454 <option value="false" selected="true">No</option> | |
| 455 </param> | |
| 456 <when value="true"> | |
| 457 <param name="right_position_trimming_treatment_value" type="integer" min="0" max="3000" value="100" label="Number of positions to trim on 3'-end" help="(-trim_right)"/> | |
| 458 </when> | |
| 459 <when value="false" /> | |
| 460 </conditional> | |
| 461 </when> | |
| 462 <when value="false" /> | |
| 463 </conditional> | |
| 464 <conditional name="percentage_position_trimming_treatments"> | |
| 465 <param name="apply_percentage_position_trimming_treatments" type="select" label="Trim sequences by a defined percentage of read length?" help="The trim length is rounded towards the lower integer. By default, no position trimming is made"> | |
| 466 <option value="true">Yes</option> | |
| 467 <option value="false" selected="true">No</option> | |
| 468 </param> | |
| 469 <when value="true"> | |
| 470 <conditional name="left_percentage_position_trimming_treatments"> | |
| 471 <param name="apply_left_percentage_position_trimming_treatments" type="select" label="Trim sequences at the 5'-end by a defined percentage of read length?" help="The trim length is rounded towards the lower integer. By default, no position trimming is made"> | |
| 472 <option value="true">Yes</option> | |
| 473 <option value="false" selected="true">No</option> | |
| 474 </param> | |
| 475 <when value="true"> | |
| 476 <param name="left_percentage_position_trimming_treatment_value" type="integer" min="0" max="100" value="2" label="Percentage of positions to trim on 5'-end" help="(-trim_left_p)"/> | |
| 477 </when> | |
| 478 <when value="false" /> | |
| 479 </conditional> | |
| 480 <conditional name="right_percentage_position_trimming_treatments"> | |
| 481 <param name="apply_right_percentage_position_trimming_treatments" type="select" label="Trim sequences at the 3'-end by a defined percentage of read length?" help="The trim length is rounded towards the lower integer. By default, no position trimming is made"> | |
| 482 <option value="true">Yes</option> | |
| 483 <option value="false" selected="true">No</option> | |
| 484 </param> | |
| 485 <when value="true"> | |
| 486 <param name="right_percentage_position_trimming_treatment_value" type="integer" min="0" max="100" value="2" label="Percentage of positions to trim on 3'-end" help="(-trim_right_p)"/> | |
| 487 </when> | |
| 488 <when value="false" /> | |
| 489 </conditional> | |
| 490 </when> | |
| 491 <when value="false" /> | |
| 492 </conditional> | |
| 493 </when> | |
| 494 <when value="false" /> | |
| 495 </conditional> | |
| 496 <conditional name="tail_trimming_treatments"> | |
| 497 <param name="apply_tail_trimming_treatments" type="select" label="Trim tails?" help="By default, no tail trimming is made"> | |
| 498 <option value="true">Yes</option> | |
| 499 <option value="false" selected="true">No</option> | |
| 500 </param> | |
| 501 <when value="true"> | |
| 502 <conditional name="a_t_tail_trimming_treatments"> | |
| 503 <param name="apply_a_t_tail_trimming_treatments" type="select" label="Trim poly-A/T tail?" help="By default, no poly-A/T tail trimming is made"> | |
| 504 <option value="true">Yes</option> | |
| 505 <option value="false" selected="true">No</option> | |
| 506 </param> | |
| 507 <when value="true"> | |
| 508 <conditional name="left_a_t_tail_trimming_treatments"> | |
| 509 <param name="apply_left_a_t_tail_trimming_treatments" type="select" label="Trim poly-A/T tail at the 5'-end?" help="By default, no 5'-end poly-A/T tail trimming is made"> | |
| 510 <option value="true">Yes</option> | |
| 511 <option value="false" selected="true">No</option> | |
| 512 </param> | |
| 513 <when value="true"> | |
| 514 <param name="left_a_t_tail_trimming_treatment_value" type="integer" min="0" max="3000" value="100" label="Minimum length of poly-A/T to trim at the 5'-end" help="(-trim_tail_left)"/> | |
| 515 </when> | |
| 516 <when value="false" /> | |
| 517 </conditional> | |
| 518 <conditional name="right_a_t_tail_trimming_treatments"> | |
| 519 <param name="apply_right_a_t_tail_trimming_treatments" type="select" label="Trim poly-A/T tail at the 3'-end?" help="By default, no 3'-end poly-A/T tail trimming is made"> | |
| 520 <option value="true">Yes</option> | |
| 521 <option value="false" selected="true">No</option> | |
| 522 </param> | |
| 523 <when value="true"> | |
| 524 <param name="right_a_t_tail_trimming_treatment_value" type="integer" min="0" max="3000" value="100" label="Minimum length of poly-A/T to trim at the 5'-end" help="(-trim_tail_right)"/> | |
| 525 </when> | |
| 526 <when value="false" /> | |
| 527 </conditional> | |
| 528 </when> | |
| 529 <when value="false" /> | |
| 530 </conditional> | |
| 531 <conditional name="ns_tail_trimming_treatments"> | |
| 532 <param name="apply_ns_tail_trimming_treatments" type="select" label="Trim poly-N tail?" help="By default, no poly-N tail trimming is made"> | |
| 533 <option value="true">Yes</option> | |
| 534 <option value="false" selected="true">No</option> | |
| 535 </param> | |
| 536 <when value="true"> | |
| 537 <conditional name="left_ns_tail_trimming_treatments"> | |
| 538 <param name="apply_left_ns_tail_trimming_treatments" type="select" label="Trim poly-N tail at the 5'-end?" help="By default, no 5'-end poly-N tail trimming is made"> | |
| 539 <option value="true">Yes</option> | |
| 540 <option value="false" selected="true">No</option> | |
| 541 </param> | |
| 542 <when value="true"> | |
| 543 <param name="left_ns_tail_trimming_treatment_value" type="integer" min="0" max="3000" value="100" label="Minimum length of poly-N to trim at the 5'-end" help="(-trim_ns_left)"/> | |
| 544 </when> | |
| 545 <when value="false" /> | |
| 546 </conditional> | |
| 547 <conditional name="right_ns_tail_trimming_treatments"> | |
| 548 <param name="apply_right_ns_tail_trimming_treatments" type="select" label="Trim poly-N tail at the 3'-end?" help="By default, no 3'-end poly-N tail trimming is made"> | |
| 549 <option value="true">Yes</option> | |
| 550 <option value="false" selected="true">No</option> | |
| 551 </param> | |
| 552 <when value="true"> | |
| 553 <param name="right_ns_tail_trimming_treatment_value" type="integer" min="0" max="3000" value="100" label="Minimum length of poly-N to trim at the 5'-end" help="(-trim_ns_right)"/> | |
| 554 </when> | |
| 555 <when value="false" /> | |
| 556 </conditional> | |
| 557 </when> | |
| 558 <when value="false" /> | |
| 559 </conditional> | |
| 560 </when> | |
| 561 <when value="false" /> | |
| 562 </conditional> | |
| 563 <conditional name="quality_trimming_treatments"> | |
| 564 <param name="apply_quality_trimming_treatments" type="select" label="Trim sequence by quality score?" help="By default, a 3'-end trimming is made to remove ends with a minimum quality score over 5 bp below 20"> | |
| 565 <option value="true" selected="true">Yes</option> | |
| 566 <option value="false">No</option> | |
| 567 </param> | |
| 568 <when value="true"> | |
| 569 <conditional name="left_quality_trimming_treatments"> | |
| 570 <param name="apply_left_quality_trimming_treatments" type="select" label="Trim sequence by quality score from the 5'-end?" help="By default, no 5'-end quality trimming is made"> | |
| 571 <option value="true">Yes</option> | |
| 572 <option value="false" selected="true">No</option> | |
| 573 </param> | |
| 574 <when value="true"> | |
| 575 <param name="left_quality_trimming_treatment_value" type="integer" min="0" max="40" value="20" label="Quality score threshold to trim positions" help="(-trim_qual_left)"/> | |
| 576 </when> | |
| 577 <when value="false" /> | |
| 578 </conditional> | |
| 579 <conditional name="right_quality_trimming_treatments"> | |
| 580 <param name="apply_right_quality_trimming_treatments" type="select" label="Trim sequence by quality score from the 3'-end?" help="By default, 3'-end trimming is made based on a score of 20"> | |
| 581 <option value="true" selected="true">Yes</option> | |
| 582 <option value="false">No</option> | |
| 583 </param> | |
| 584 <when value="true"> | |
| 585 <param name="right_quality_trimming_treatment_value" type="integer" min="0" max="40" value="20" label="Quality score threshold to trim positions" help="(-trim_qual_right)"/> | |
| 586 </when> | |
| 587 <when value="false" /> | |
| 588 </conditional> | |
| 589 <param name="type_quality_trimming_treatments" type="select" display="radio" label="Type of quality score calculation to use" help="By default, min is used. (-trim_qual_type)"> | |
| 590 <option value="min" selected="true">Mininum</option> | |
| 591 <option value="mean" >Mean</option> | |
| 592 <option value="max" >Max</option> | |
| 593 <option value="sum" >Sum</option> | |
| 594 </param> | |
| 595 <param name="rule_quality_trimming_treatments" type="select" display="radio" label="Rule tu use to compare quality score to calculated value" help="By default, 'less than' is used. (-trim_qual_rule)"> | |
| 596 <option value="lt" selected="true">Less than</option> | |
| 597 <option value="gt" >Greater than</option> | |
| 598 <option value="et" >Equal to</option> | |
| 599 </param> | |
| 600 <param name="window_quality_trimming_treatments" type="integer" min="0" max="300" value="1" label="Size of the sliding window used to calculated quality score by type" help="To stop at the first base that fails the rule defined, use a window size of 1 (default value). (-trim_qual_window)"/> | |
| 601 <param name="step_quality_trimming_treatments" type="integer" min="0" max="300" value="1" label="Step size used to move the sliding window" help="To move the window over all quality scores without missing any, the step size sould be less or equal to the window size. The default value is 1. (-trim_qual_step)"/> | |
| 602 </when> | |
| 603 <when value="false" /> | |
| 604 </conditional> | |
| 605 </when> | |
| 606 <when value="false" /> | |
| 607 </conditional> | |
| 608 | |
| 609 <!--<param name="graph_stats" type="select" multiple="True" label="Which statistics should be calculated included in the graph_data file" help="(-graph_stats)"> | |
| 610 <option value="ld" selected="True">Length distribution</option> | |
| 611 <option value="gc" selected="True">GC content distribution</option> | |
| 612 <option value="qd" selected="True">Base quality distribution</option> | |
| 613 <option value="ns" selected="True">Occurence of N</option> | |
| 614 <option value="pt" selected="True">Poly-A/T tails</option> | |
| 615 <option value="ts" selected="True">Tag sequence check</option> | |
| 616 <option value="aq" selected="True">Assembly quality measure</option> | |
| 617 <option value="de" selected="True">Sequence duplication - exact only</option> | |
| 618 <option value="da" selected="True">Sequence duplication - exact + 5'/3'</option> | |
| 619 <option value="sc" selected="True">Sequence complexity</option> | |
| 620 <option value="dn" selected="True">Dinucleotide odds ratios, includes the PCA plots</option> | |
| 621 </param>--> | |
| 622 </inputs> | |
| 623 | |
| 624 <outputs> | |
| 625 <data format="fastq" name="good_sequence_file" | |
| 626 from_work_dir="tmp/good_sequences.fastq" | |
| 627 label="${tool.name} on ${on_string}: Good sequences" > | |
| 628 <filter>seq_type['seq_type_opt'] == "single"</filter> | |
| 629 </data> | |
| 630 <data format="fastq" name="rejected_sequence_file" | |
| 631 from_work_dir="tmp/rejected_sequences.fastq" | |
| 632 label="${tool.name} on ${on_string}: Rejected sequences" > | |
| 633 <filter>seq_type['seq_type_opt'] == "single"</filter> | |
| 634 </data> | |
| 635 | |
| 636 <data format="fastq" name="good_sequences_1_file" | |
| 637 from_work_dir="tmp/good_sequences_1.fastq" | |
| 638 label="${tool.name} on ${on_string}: Good sequences for R1" > | |
| 639 <filter>seq_type['seq_type_opt'] == "paired"</filter> | |
| 640 </data> | |
| 641 <data format="fastq" name="good_sequences_1_singletons_file" | |
| 642 from_work_dir="tmp/good_sequences_1_singletons.fastq" | |
| 643 label="${tool.name} on ${on_string}: Good singleton sequences for R1" > | |
| 644 <filter>seq_type['seq_type_opt'] == "paired"</filter> | |
| 645 </data> | |
| 646 <data format="fastq" name="rejected_sequence_1_file" | |
| 647 from_work_dir="tmp/rejected_sequences_1.fastq" | |
| 648 label="${tool.name} on ${on_string}: Rejected sequences for R1" > | |
| 649 <filter>seq_type['seq_type_opt'] == "paired"</filter> | |
| 650 </data> | |
| 651 <data format="fastq" name="good_sequences_2_file" | |
| 652 from_work_dir="tmp/good_sequences_2.fastq" | |
| 653 label="${tool.name} on ${on_string}: Good sequences for R2" > | |
| 654 <filter>seq_type['seq_type_opt'] == "paired"</filter> | |
| 655 </data> | |
| 656 <data format="fastq" name="good_sequences_2_singletons_file" | |
| 657 from_work_dir="tmp/good_sequences_2_singletons.fastq" | |
| 658 label="${tool.name} on ${on_string}: Good singleton sequences for R2" > | |
| 659 <filter>seq_type['seq_type_opt'] == "paired"</filter> | |
| 660 </data> | |
| 661 <data format="fastq" name="rejected_sequence_2_file" | |
| 662 from_work_dir="tmp/rejected_sequences_2.fastq" | |
| 663 label="${tool.name} on ${on_string}: Rejected sequences for R2" > | |
| 664 <filter>seq_type['seq_type_opt'] == "paired"</filter> | |
| 665 </data> | |
| 666 | |
| 667 <!--<data format="html" name="html_file" | |
| 668 from_work_dir="stats_html.html" | |
| 669 label="${tool.name} on ${on_string}: Summary" />--> | |
| 670 </outputs> | |
| 671 | |
| 672 <tests> | |
| 673 <test> | |
| 674 <param name='seq_type_opt' value="single"/> | |
| 675 <param name="input_singles" value="prinseq_input_sequences.fastq"/> | |
| 676 <param name='apply_filter_treatments' value="true"/> | |
| 677 <param name='apply_length_filter_treatments' value="true"/> | |
| 678 <param name='apply_min_length_filter_treatments' value="true"/> | |
| 679 <param name="min_length_filter_treatment_value" value="60"/> | |
| 680 <param name='apply_max_length_filter_treatments' value="false" /> | |
| 681 <param name='apply_quality_filter_treatments' value="true"/> | |
| 682 <param name='apply_min_quality_filter_treatments' value="false" /> | |
| 683 <param name='apply_max_quality_filter_treatments' value="false"/> | |
| 684 <param name='apply_mean_quality_filter_treatments' value="true"/> | |
| 685 <param name='apply_min_mean_quality_filter_treatments' value="true"/> | |
| 686 <param name="min_mean_quality_filter_treatment_value" value="15"/> | |
| 687 <param name='apply_max_mean_quality_filter_treatments' value="false"/> | |
| 688 <param name='apply_base_content_filter_treatments' value="true"/> | |
| 689 <param name='apply_GC_perc_content_filter_treatments' value="false"/> | |
| 690 <param name='apply_N_number_content_filter_treatments' value="false"/> | |
| 691 <param name='apply_N_percentage_content_filter_treatments' value="true"/> | |
| 692 <param name="N_percentage_content_filter_treatment_value" value="2"/> | |
| 693 <param name='apply_other_base_content_filter_treatments' value="false"/> | |
| 694 <param name='apply_complexity_filter_treatments' value="false"/> | |
| 695 <param name='apply_trimming_treatments' value="true" /> | |
| 696 <param name='apply_length_trimming_treatments' value="false"/> | |
| 697 <param name='apply_position_trimming_treatments' value="false"/> | |
| 698 <param name='apply_tail_trimming_treatments' value="false"/> | |
| 699 <param name='apply_quality_trimming_treatments' value="true"/> | |
| 700 <param name='apply_left_quality_trimming_treatments' value="false"/> | |
| 701 <param name='apply_right_quality_trimming_treatments' value="true" /> | |
| 702 <param name="right_quality_trimming_treatment_value" value="20"/> | |
| 703 <param name="type_quality_trimming_treatments" value="min"/> | |
| 704 <param name="rule_quality_trimming_treatments" value="lt" /> | |
| 705 <param name="window_quality_trimming_treatments" value="1"/> | |
| 706 <param name="step_quality_trimming_treatments" value="1"/> | |
| 707 | |
| 708 <output name="good_sequence_file" file="prinseq_good_sequences.fastq"/> | |
| 709 </test> | |
| 710 </tests> | |
| 711 | |
| 712 <help><![CDATA[ | |
| 713 | |
| 714 **What it does** | |
| 715 | |
| 716 PRINSEQ is a tool for easy and rapid quality control and data processing of metagenomic and metatranscriptomic datasets. | |
| 717 This tool allow to process the sequences with filtering and trimming. | |
| 718 More information on `PRINSEQ manual <http://prinseq.sourceforge.net/manual.html>`_. | |
| 719 | |
| 720 ----- | |
| 721 | |
| 722 **Input** | |
| 723 | |
| 724 The input file is sequence file in fastq format (sequences and quality):: | |
| 725 | |
| 726 @HWI-M00234:263:000000000-ADM55:1:1101:7508:4067 1:N:0:ATCACG | |
| 727 GGTGCACTAGGATCGTAGTTGGCTACTTTCCCGTTTTCAATGTATACGCAAGGTACACGGTCAGCGGT | |
| 728 + | |
| 729 CCCCCGFGED8DDCAFDAEE9DFGGGG9CFAFFCC@@CFGFGGCGFGG>GGGFFGDGEFFEFG8>4GF | |
| 730 | |
| 731 ----- | |
| 732 | |
| 733 **Parameters** | |
| 734 | |
| 735 The parameters are numerous in PRINSEQ given the wanted treatments. | |
| 736 | |
| 737 Several filter treatments are proposed: | |
| 738 | |
| 739 - Filters based on sequence length | |
| 740 - Filters based on quality score | |
| 741 - Filters based on base content | |
| 742 | |
| 743 And several trimming treatments eliminate sequence parts: | |
| 744 | |
| 745 - Trim of ends | |
| 746 - Trim of tails | |
| 747 - Trim based quality score | |
| 748 | |
| 749 All these treaments can be customed using proposed parameters. | |
| 750 | |
| 751 ----- | |
| 752 | |
| 753 **Output** | |
| 754 | |
| 755 The output file is a sequence file with sequences and quality from input file | |
| 756 which have undergone filter and trimming. | |
| 757 | |
| 758 ]]> | |
| 759 </help> | |
| 760 | |
| 761 <citations> | |
| 762 <citation type="doi">10.1093/bioinformatics/btr026</citation> | |
| 763 </citations> | |
| 764 </tool> |