changeset 0:8ec117da1796 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/purge_dups commit ed3bf33e007841e359d164b2aa9e2ecf7fa5fa96"
author iuc
date Fri, 05 Feb 2021 17:52:51 +0000
parents
children 29151e779524
files purge_dups.xml test-data/calcuts_out.tsv test-data/cutoffs.tsv test-data/dups.bed test-data/ngsc_out.cov test-data/out.cov test-data/out.wig test-data/purge_dups_out.bed test-data/purged_out.fa test-data/split_out.fasta test-data/test.bam test-data/test.cov test-data/test.fasta test-data/test.paf test-data/test.stat
diffstat 15 files changed, 1584 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/purge_dups.xml	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,330 @@
+<tool id="purge_dups" name="Purge haplotigs" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="20.01">
+    <description>and overlaps in an assembly based on read depth</description>
+    <macros>
+        <token name="@TOOL_VERSION@">1.2.5</token>
+        <token name="@VERSION_SUFFIX@">0</token>
+    </macros>
+    <requirements>
+        <requirement type="package" version="@TOOL_VERSION@">purge_dups</requirement>
+    </requirements>
+    <command detect_errors="exit_code"><![CDATA[
+        #if $function_select.functions == "purge_dups":
+            purge_dups
+            #if $function_select.coverage:
+                -c '$function_select.coverage'
+            #end if
+            #if $function_select.cutoffs:
+                -T '$function_select.cutoffs'
+            #end if
+            #if $function_select.min_bad:
+                -f $function_select.min_bad
+            #end if
+            #if $function_select.min_align:
+                -a $function_select.min_align
+            #end if
+            #if $function_select.min_match:
+                -b $function_select.min_match
+            #end if
+            #if $function_select.min_chain:
+                -m $function_select.min_chain
+            #end if
+            #if $function_select.max_gap:
+                -M $function_select.max_gap
+            #end if
+            #if $function_select.double_chain.chaining_rounds == "two":
+                -2
+                #if $function_select.double_chain.max_gap_2:
+                    -G $function_select.double_chain.max_gap_2
+                #end if
+            #end if
+            #if $function_select.min_chain_score:
+                -l $function_select.min_chain_score
+            #end if
+            #if $function_select.max_extend:
+                -E $function_select.max_extend
+            #end if
+            '$function_select.input' > dups.bed 2> purge_dups.log
+        #else if $function_select.functions == "split_fa":
+            split_fa
+            #if $function_select.split:
+                -n $function_select.split
+            #end if
+            '$function_select.input' > split.fasta
+        #else if $function_select.functions == "pbcstat":
+            pbcstat
+            #if $function_select.max_cov:
+                -M $function_select.max_cov
+            #end if
+            #if $function_select.min_map_ratio:
+                -f $function_select.min_map_ratio
+            #end if
+            #if $function_select.min_map_qual:
+                -q $function_select.min_map_qual
+            #end if
+            #if $function_select.flank:
+                -l $function_select.flank
+            #end if
+            $function_select.primary_alignments
+            '$function_select.input'
+        #else if $function_select.functions == "ngscstat":
+            ngscstat
+            #if $function_select.min_align_qual:
+                -q $function_select.min_align_qual
+            #end if
+    ##        #if $function_select.max_depth:
+    ##            -M $function_select.max_depth
+    ##        #end if
+            #if $function_select.max_insert:
+                -L $function_select.max_insert
+            #end if
+            '$function_select.input'
+        #else if $function_select.functions == "calcuts":
+            calcuts
+            #if $function_select.min_depth:
+                -f $function_select.min_depth
+            #end if
+            #if $function_select.low_depth:
+                -l $function_select.low_depth
+            #end if
+            #if $function_select.transition:
+                -m $function_select.transition
+            #end if
+            #if $function_select.upper_depth:
+                -u $function_select.upper_depth
+            #end if
+            $function_select.ploidy
+            '$function_select.input' > cutoffs.tsv 2>calcuts.log
+        #else if $function_select.functions == "get_seqs":
+            get_seqs
+            $function_select.coverage
+            $function_select.haplotigs
+            $function_select.end_trim
+            $function_select.split
+            #if $function_select.length:
+                -l $function_select.length
+            #end if
+            #if $function_select.min_ratio:
+                -m $function_select.min_ratio
+            #end if
+            #if $function_select.min_gap:
+                -g $function_select.min_gap
+            #end if
+            '$function_select.bed_input' '$function_select.fasta_input'
+        #end if
+    ]]></command>
+    <inputs>
+        <conditional name="function_select">
+            <param type="select" name="functions" label="Select the purge_dups function">
+                <option value="purge_dups">purge haplotigs and overlaps for an assembly</option>
+                <option value="split_fa">split FASTA file by 'N's</option>
+                <option value="pbcstat">create read depth histogram and base-level read depth for pacbio data</option>
+                <option value="ngscstat">create read depth histogram and base-level read detph for illumina data</option>
+                <option value="calcuts">calculate coverage cutoffs</option>
+                <option value="get_seqs">obtain seqeuences after purging</option>
+            </param>
+            <when value="purge_dups">
+                <param name="input" type="data" format="paf" label="PAF input file"/>
+                <param name="coverage" type="data" format="tabular" optional="true" argument="-c" label="Base-level coverage file" />
+                <param name="cutoffs" type="data" format="tabular" label ="Cutoffs file" optional="true" argument="-T"/>
+                <param name="min_bad" type="float" min="0" max="1" argument="-f" optional="true" label="Minimum fraction of haploid/diploid/bad/repetitive bases in a sequence" help="Default = 0.8"/>
+                <param name="min_align" type="integer" label="Minimum alignment score" argument="-a" optional="true"/>
+                <param name="min_match" type="integer" label="Minimum max match score" argument="-b" optional="true"/>
+                <param name="min_chain" label="Minimum matching bases for chaining" type="integer" argument="-m" optional="true"/>
+                <param name="max_gap" label="Maximum gap size for chaining" type="integer" argument="-M" optional="true"/>
+                <conditional name="double_chain">
+                    <param type="select" name="chaining_rounds" label="Rounds of chaining">
+                        <option value="one">1 round</option>
+                        <option value="two">2 rounds</option>
+                    </param>
+                    <when value="two">
+                        <param name="max_gap_2" argument="-G" optional="true" label="Maximum gap size for second round of chaining" type="integer"/>
+                    </when>
+                    <when value="one"/>
+                </conditional>
+                <param name="min_chain_score" argument="-l" optional="true" label="Minimum chaining score for a match" type="integer" />
+                <param name="max_extend" argument="-E" optional="true" label="Maximum extension for contig ends" type="integer" />
+            </when>
+            <when value="split_fa">
+                <param name="input" type="data" format="fasta" label="Base-level coverage file"/>
+                <param name="split" type="boolean" truevalue="-n" falsevalue="" checked="false" label="Base-level coverage file" />
+            </when>
+            <when value="pbcstat">
+                <param name="input" type="data" format="paf" label="PAF input file"/>
+                <param name="max_cov" type="integer" label="Maximum coverage" argument="-M" optional="true"/>
+                <param name="min_map_ratio" argument="-f" type="float" min="0" max="1" value="0" label="Minimum mapping length ratio"/>
+                <param name="min_map_qual" type="integer"  argument="-q" optional="true" label="Minimum mapping quality"/>
+                <param name="flank" type="integer" argument="-l" optional="true" label="Flanking space" />
+                <param name="primary_alignments" argument="-p" type="boolean" truevalue="-p" falsevalue="" checked="true" label="Use only primary alignments" />
+            </when>
+            <when value="ngscstat">
+                <param name="input" type="data" format="bam" label="BAM input file"/>
+                <param name="min_align_qual" type="integer"  argument="-q" optional="true" label="Minimum alignment quality" />
+                <!-- Param exists in help text, but isn't actually part of the code. Maybe in the next release? -->
+                <!-- <param name="max_depth" type="integer" label="Maximum read depth" argument="-M" optional="true"/> -->
+                <param name="max_insert" type="integer"  argument="-L" optional="true" label="Maximum insert size"/>
+            </when>
+            <when value="calcuts">
+                <param name="input" type="data" format="tabular" label="STAT input file"/>
+                <param name="min_depth" type="float" label="Minimum depth count fraction to maximum depth coun" min="0" max="1" argument="-f" optional="true" help="Default = 0.1"/>
+                <param name="low_depth" label="Lower bound for read depth" type="integer" argument="-l" optional="true"/>
+                <param name="transition" label="Transition between haploid and diploid" type="integer" argument="-m" optional="true"/>
+                <param name="upper_depth" label="Upper bound for read depth" type="integer" argument="-u" optional="true"/>
+                <param name="ploidy" argument="-d" type="select" label="Ploidy">
+                    <option value="-d 0" selected="true">Diploid [0]</option>
+                    <option value="-d 1">Haploid [1]</option>
+                </param>
+            </when>
+            <when value="get_seqs">
+                <param name="fasta_input" type="data" format="fasta" label="Fasta input file"/>
+                <param name="bed_input" type="data" format="bed" label="Bed input file"/>
+                <param name="coverage" type="boolean" argument="-c" truevalue="-c" falsevalue="" checked="false" label="Keep high coverage contigs in the primary contig set"/>
+                <param name="haplotigs" type="boolean" argument="-a" truevalue="-a" falsevalue="" checked="false" label="Do not add prefix to haplotigs"/>
+                <param name="length" type="integer" argument="-l" optional="true" label="Minimum primary contig length" help="Default: 1000"/>
+                <param name="min_ratio" type="float" min="0" max="1" argument="-m" optional="true" label="Minimum ratio of remaining primary contig length to the original contig length"/>
+                <param name="end_trim" type="boolean" argument="-e" truevalue="-e" falsevalue="" checked="true" label="Trim end sequences" help="Only remove sequences at end of halplotigs If you also want to remove the duplications in the middle, set to false, however that may delete false positive duplications."/>
+                <param name="split" type="boolean" argument="-s" truevalue="-s" falsevalue="" checked="false" label="Split contigs"/>
+                <param name="min_gap" type="integer" argument="-g" optional="true" help="default=10k" label="Minimum gap size between duplications" />
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <!-- Get Seqs -->
+        <data name="get_seqs_hap" format="fasta" from_work_dir="hap.fa" label="${tool.name} on ${on_string}: get seqs haplotype fasta" >
+            <filter>function_select['functions'] == 'get_seqs'</filter>
+        </data>
+        <data name="get_seqs_purged" format="fasta" from_work_dir="purged.fa" label="${tool.name} on ${on_string}: get seqs purged fasta">
+            <filter>function_select['functions'] == 'get_seqs'</filter>
+        </data>
+        <!-- Split FA -->
+        <data name="split_fasta" format="fasta" from_work_dir="split.fasta" label="${tool.name} on ${on_string}: split fasta">
+            <filter>function_select['functions'] == 'split_fa'</filter>
+        </data>
+        <!-- Ngscstat -->
+        <data name="ngscstat_cov" format="tabular" from_work_dir="TX.base.cov" label="${tool.name} on ${on_string}: ngscstat base coverage file">
+            <filter>function_select['functions'] == 'ngscstat'</filter>
+        </data>
+        <data name="ngscstat_stat" format="tabular" from_work_dir="TX.stat"  label="${tool.name} on ${on_string}: ngscstat stat file">
+            <filter>function_select['functions'] == 'ngscstat'</filter>
+        </data>
+        <!-- Pbcstat -->
+        <data name="pbcstat_cov" format="tabular" from_work_dir="PB.base.cov"  label="${tool.name} on ${on_string}: pbcstat base coverage file">
+            <filter>function_select['functions'] == 'pbcstat'</filter>
+        </data>
+        <data name="pbcstat_wig" format="wig" from_work_dir="PB.cov.wig" label="${tool.name} on ${on_string}: pbcstat base wig file">
+            <filter>function_select['functions'] == 'pbcstat'</filter>
+        </data>
+        <data name="pbcstat_stat" format="tabular" from_work_dir="PB.stat" label="${tool.name} on ${on_string}: stat file">
+            <filter>function_select['functions'] == 'pbcstat'</filter>
+        </data>
+        <!-- Calcuts -->
+        <data name="calcuts_log" format="txt" from_work_dir="calcuts.log" label="${tool.name} on ${on_string}: calcuts log file">
+            <filter>function_select['functions'] == 'calcuts'</filter>
+        </data>
+        <data name="calcuts_tab" format="tabular" from_work_dir="cutoffs.tsv" label="${tool.name} on ${on_string}: calcuts cutoff file">
+            <filter>function_select['functions'] == 'calcuts'</filter>
+        </data>
+        <!-- Purge dups -->
+        <data name="purge_dups_log" format="txt" from_work_dir="purge_dups.log" label="${tool.name} on ${on_string}: purge_dups log file">
+            <filter>function_select['functions'] == 'purge_dups'</filter>
+        </data>
+        <data name="purge_dups_bed" format="bed" from_work_dir="dups.bed" label="${tool.name} on ${on_string}: purge_dups bed file">
+            <filter>function_select['functions'] == 'purge_dups'</filter>
+        </data>
+    </outputs>
+    <tests>
+        <!-- Purge dups -->
+        <test expect_num_outputs="2">
+            <conditional name="function_select">
+                <param name="functions" value="purge_dups"/>
+                <param name="input" value="test.paf"/>
+                <param name="coverage" value="test.cov" ftype="tabular"/>
+                <param name="cutoffs" value="cutoffs.tsv" ftype="tabular"/>
+                <param name="min_bad" value="0.01"/>
+                <param name="min_align" value="10"/>
+                <param name="min_match" value="100"/>
+                <param name="min_chain" value="1"/>
+                <param name="max_gap" value="1000"/>
+                <conditional name="double_chain">
+                    <param name="chaining_rounds" value="two"/>
+                    <param name="max_gap_2" value="1001"/>
+                </conditional>
+                <param name="min_chain_score" value="1"/>
+                <param name="max_extend" value="100"/>
+            </conditional>
+            <output name="purge_dups_bed" value="purge_dups_out.bed"/>
+        </test>
+        <!-- Split fa -->
+        <test expect_num_outputs="1">
+            <conditional name="function_select">
+                <param name="functions" value="split_fa"/>
+                <param name="input" value="test.fasta"/>
+                <param name="split" value="-n"/>
+            </conditional>
+            <output name="split_fasta" value="split_out.fasta"/>
+        </test>
+        <!-- pbcstat -->
+        <test expect_num_outputs="3">
+            <conditional name="function_select">
+                <param name="functions" value="pbcstat"/>
+                <param name="input" value="test.paf"/>
+                <param name="max_cov" value="1000"/>
+                <param name="min_map_ratio" value="0.01"/>
+                <param name="min_map_qual" value="1"/>
+                <param name="flank" value="1"/>
+                <param name="primary_alignments" value="-p"/>
+            </conditional>
+            <output name="pbcstat_cov" value="out.cov"/>
+            <output name="pbcstat_wig" value="out.wig"/>
+        </test>
+        <!-- ngscstat -->
+        <test expect_num_outputs="2">
+            <conditional name="function_select">
+                <param name="functions" value="ngscstat"/>
+                <param name="input" value="test.bam"/>
+                <param name="min_align_qual" value="10"/>
+                <param name="max_insert" value="100"/>
+            </conditional>
+            <output name="ngscstat_cov" value="ngsc_out.cov"/>
+        </test>
+        <!-- Calcuts -->
+        <test expect_num_outputs="2">
+            <conditional name="function_select">
+                <param name="functions" value="calcuts"/>
+                <param name="input" value="test.stat"/>
+                <param name="min_depth" value="0.01"/>
+                <param name="low_depth" value="1"/>
+                <param name="transition" value="1"/>
+                <param name="upper_depth" value="100"/>
+                <param name="ploidy" value="-d 0"/>
+            </conditional>
+            <output name="calcuts_tab" value="calcuts_out.tsv"/>
+        </test>
+        <!-- Get seqs -->
+        <test expect_num_outputs="2">
+            <conditional name="function_select">
+                <param name="functions" value="get_seqs"/>
+                <param name="fasta_input" value="split_out.fasta"/>
+                <param name="bed_input" value="dups.bed"/>
+                <param name="coverage" value="-c"/>
+                <param name="length" value="10"/>
+                <param name="haplotigs" value="-a"/>
+                <param name="min_ratio" value=".01"/>
+                <param name="end_trim" value="-e"/>
+                <param name="split" value="-s"/>
+                <param name="min_gap" value="100000"/>
+            </conditional>
+            <output name="get_seqs_purged" value="purged_out.fa"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+        .. class:: infomark
+        
+        **What it does**
+
+        The purge_dups tools are designed to remove haplotigs and contig overlaps in a de novo assembly based on read depth.
+
+    ]]></help>
+        <citations>
+        <citation type="doi">10.1093/bioinformatics/btaa025</citation>
+    </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/calcuts_out.tsv	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,1 @@
+1	0	0	1	1	100
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cutoffs.tsv	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,1 @@
+5	3	3	5	7	15
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/dups.bed	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,1 @@
+gi|157734152	29655295	29712160	HAPLOTIG	gi|528476637
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ngsc_out.cov	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,336 @@
+>>chrM	0
+1	0	0
+>GTATTCTTACTCCATAAACACATAGGCTTGGTCCTAGCCTTTTTATTAGT	0
+1	0	0
+>CTAAATCACGTCTCTACGATTAAAAGGAGCAGGTATCAAGCACACTAGAA	0
+1	0	0
+>ATAAAAATTAAGCTATGAACGAAAGTTCGACTAAGTCATATTAAATAAGG	0
+1	0	0
+>ATAAATCTCCGGCGTAAAGCGTGTCAAAGACTAATACCAAAATAAAGTTA	0
+1	0	0
+>AAGTGACTTTAATACCTCTGACTACACGATAGCTAAGACCCAAACTGGGA	0
+1	0	0
+>AAGCTATTCGCCAGAGTACTACTAGCAACAGCCTAAAACTCAAAGGACTT	0
+1	0	0
+>CCGATAAACCCCACCATCCCTTGCTAATTCAGCCTATATACCGCCATCTT	0
+1	0	0
+>AACGTTAGGTCAAGGTGTAGCCCATGGGATGGAGAGAAATGGGCTACATT	0
+1	0	0
+>TGGAGACTAAAGGAGGATTTAGCAGTAAATTAAGAATAGAGAGCTTAATT	0
+1	0	0
+>CACAAATCATAACATAACATAAAACCGTGACCCAAACATATGAAAGGAGA	0
+1	0	0
+>TGTAGCTTAAACAAAGCATCCAGCTTACACCTAGAAGATTTCACTCAAAA	0
+1	0	0
+>TTAGTCACTTAACTAAAACATTCACCAAACCATTAAAGTATAGGAGATAG	0
+1	0	0
+>ATGCATTAAAAGTACTAAACAGCAAAGCTTACCCCTTTTACCTTTTGCAT	0
+1	0	0
+>CGAAACCAGACGAGCTACCTATGAACAGTTACAAATGAACCAACTCATCT	0
+1	0	0
+>AGCCTGGTGATAGCTGGTTGTCCAGAAACAGAATTTCAGTTCAAATTTAA	0
+1	0	0
+>AAAGGTACAGCTTTTTAGATACAGGTTACAACCTTCATTAGAGAGTAAGA	0
+1	0	0
+>TTCAAGCTCAACGACACATCTATCTTAATCCCAACAATCAACCCAAACTA	0
+1	0	0
+>TTAATATGAGTAACAAGAATTATTTCTCCTTGCATAAGCTTATATCAGAA	0
+1	0	0
+>TCATCTATTTAAACCATTGTTAACCCAACACAGGCATGCATCTATAAGGA	0
+1	0	0
+>ACCAAAAACATCACCTCTAGCATTTCCAGTATTAGAGGCACTGCCTGCCC	0
+1	0	0
+>taatcacttgttccctaaatagggacttgtatgaatggccacacgagggt	0
+1	0	0
+>cgggaatgactaaataagacgagaagaccctatggagcttTAATTAACTG	0
+1	0	0
+>TTGATTGAATCAGCAATTTCGGTTGGGGTGACCTCGGAGAACAAAACAAC	0
+1	0	0
+>TTGATCCAAACCATTGATCAACGGAACAAGTTACCCTAGGGATAACAGCG	0
+1	0	0
+>TTGGATCAAGACATCCTAATGGTGCAACCGCTATTAAGGGTTCGTTTGTT	0
+1	0	0
+>CGGTTTCTATCTATTCTATACTTTTCCCAGTACGAAAGGACAAGAAAAGT	0
+1	0	0
+>AATCTAACTAATTTATAACTTCTACCGCCCTAGAACAGGGCTCgttaggg	0
+1	0	0
+>caactcctctccctaacaacaTGTTCATAATTAACGTCCTCCTCCTAATT	0
+1	0	0
+>CTTAGGCTATATGCAACTTCGCAAAGGACCCAACATCGTAGGCCCCTATG	0
+1	0	0
+>CTACAACCACTAACATCATCGACATCCATATTCATCATCGCACCAATCCT	0
+1	0	0
+>CACTAATCAACATAAACCTAGGAATTCTATTCATACTAGCCATGTCCAGC	0
+1	0	0
+>CGCCCTAATTGGAGCTCTACGAGCAGTAGCACAAACCATCTCATACGAAG	0
+1	0	0
+>ACATTATCAACACTTATTATTACCCAAGAATACCTCTGATTAATCTTCCC	0
+1	0	0
+>ACCGAGCTCCATTTGACCTAACAGAAGGAGAATCAGAACTCGTCTCTGGA	0
+1	0	0
+>ATACGCAAACATCATCATGATAAACATCTTCACAACAACCCTATTTCTAG	0
+1	0	0
+>ATTAAAGCTCTCCTTCTAACATGTTCCTTCCTATGAATCCGAGCATCCTA	0
+1	0	0
+>TACCACTCACACTAGCCCTCTGCATATGACACGTCTCACTTCCAATCATA	0
+1	0	0
+>ACTTTGATAGAGTAAAACATAGAGGCTCAAACCCTCTTATTTctagaact	0
+1	0	0
+>ttacaccatgtcctaCAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCAT	0
+1	0	0
+>CTTCACAACTATTCTAATAACAGTTCTTCTAGGAACTATAATCGTTATAA	0
+1	0	0
+>GCCATTATCCCTATCCTAATAAAAAAGTACAATCCCCGAACCATAGAAGC	0
+1	0	0
+>TAGCGATCATCATTAACCTCATACACTCAGGCCAATGAACAATCACAAAA	0
+1	0	0
+>ACTTGGACTCACACCATTCCACTTCTGAGTACCCGAAGTCACACAGGGCA	0
+1	0	0
+>ATATCAATCCTATATCAAATCTCACCCTCAATTAACCTAAATATCTTATT	0
+1	0	0
+>AAACCCAACTACGAAAAATCATAGCATACTCGTCAATCGCGCATATAGGA	0
+1	0	0
+>ATTAATTTACATTATAATAACACTCACAATATTCATACTATTTATCCACA	0
+1	0	0
+>CTAACCACTACACTAATCTTAATTACCTTACTATCCATAGGAGGCCTCCC	0
+1	0	0
+>AAAATAGCAGCATCATCCTCCCCACACTAATAGCCATTATAGCACTACTC	0
+1	0	0
+>CCCATCCACAAACAACATAAAAATAAAATGACAATTCGAAACCAAACGAA	0
+1	0	0
+>ACCCCCATACTATCAATTTTGGACTAGGAATTTAGGTTAACATCCCAGAC	0
+1	0	0
+>TAAGGACTGCGAGACTCTATCTCACATCAATTGAACGCAAATCAAACTCT	0
+1	0	0
+>TTTAGTTAACAGCTAAATACCCTAATCAACTGGCTTCAATCTACTTCTCC	0
+1	0	0
+>TCCTTTGAATTTGCAATTCAATGTGAAAATTCACCACGGGACTTGATAAG	0
+1	0	0
+>CCATCTTACCTATGTTCATCAACCGCTGACTATTTTCAACTAACCACAAA	0
+1	0	0
+>AACTGCCCTAAGCCTCCTAATCCGTGCTGAATTAGGCCAACCTGGGACCC	0
+1	0	0
+>GTAATAATTTTCTTTATGGTCATACCCATTATAATCGGAGGATTCGGAAA	0
+1	0	0
+>TAAACAACATAAGCTTCTGATTACTTCCCCCATCATTCCTACTTCTTCTC	0
+1	0	0
+>TCCTCTAGCTGGAAATCTGGCGCATGCAGGAGCCTCTGTTGACTTAACCA	0
+1	0	0
+>TTTATTACCACAATCATTAACATAAAACCACCAGCCCTATCCCAATATCA	0
+1	0	0
+>TAGCCCTCCCGGTCCTAGCAGCAGGCATTACCATGCTTCTCACAGACCGT	0
+1	0	0
+>TTATCAACACCTATTCTGATTCTTCGGACACCCCGAAGTCTATATTCTTA	0
+1	0	0
+>AAAAAGGAACCTTTTGGCTACATGGGTATAGTGTGAGCTATAATATCCAT	0
+1	0	0
+>TAGACGTTGACACACGAGCATACTTCACATCAGCTACCATAATCATCGCT	0
+1	0	0
+>AAATATCAAATGATCTCCAGCTATACTCTGAGCTCTAGGCTTCATCTTCT	0
+1	0	0
+>GATATTGTTCTCCACGATACTTATTATGTAGTAGCACATTTCCATTATGT	0
+1	0	0
+>TCCCTCTATTCTCAGGATACACACTCAACCAAACCTGAGCAAAAATCCAC	0
+1	0	0
+>CCTTGGCCTCTCAGGAATGCCACGACGCTATTCTGATTATCCAGACGCAT	0
+1	0	0
+>GCAGTGATACTAATAATTTTCATAATTTGAGAAGCGTTCGCATCCAAACG	0
+1	0	0
+>GATGCCCCCCACCATACCACACATTTGAAGAACCCACCTACGTAAACCTA	0
+1	0	0
+>tcataaccactatgtctttctcCATCAATTGAGGTATTAGTAAAAATTAC	0
+1	0	0
+>GCCTACCCCTTCCAACTAGGATTCCAAGACGCAACATCCCCTATTATAGA	0
+1	0	0
+>GCTCTCTAGTATTATATATTATCTCATCAATACTAACAACTAAATTAACC	0
+1	0	0
+>ACCAGCCATCATCCTTATTCTAATCGCCCTCCCATCCCTACGAATTCTAT	0
+1	0	0
+>CACCAATGATACTGAAGCTACGAGTATACCGATTACGAAGACTTGACCTT	0
+1	0	0
+>TTCTAGAAGTCGACAATCGAGTGGTTCTCCCCATAGAAATAACCATCCGA	0
+1	0	0
+>AGGCCTAAAAACAGACGCTATCCCTGGGCGCCTAAATCAGACAACTCTCG	0
+1	0	0
+>TCAAACCACAGCTTTATACCAATTGTCCTTGAACTAGTTCCACTGAAACA	0
+1	0	0
+>TAGCATTAACCTTTTAAGTTAAAGATTGAGGGTTCAACCCCCTCCCTAGT	0
+1	0	0
+>AATCCTAACTCTATTTATTGTATTTCAACTAAAAATCTCAAAGCACTCCT	0
+1	0	0
+>CCTTGAGAATCAAAATGAACGAAAATCTATTCGCCTCTTTCGCTACCCCA	0
+1	0	0
+>CCTATTCCCCTCACCCAACCGACTAATCAACAATCGCCTAATCTCAATTC	0
+1	0	0
+>AGCAAAGGACAAACCTGAACTCTTATACTCATATCACTGATCCTATTCAT	0
+1	0	0
+>CACAACTATCAATAAACCTAGGCATAGCTATTCCCCTATGGGCAGGGACA	0
+1	0	0
+>ACCTCAAGGGACGCCCATTTTCCTCATCCCCATACTAGTAATTATCGAGA	0
+1	0	0
+>AACATTACCGCCGGACACCTCCTAATACACCTCATCGGAGGGGCAACACT	0
+1	0	0
+>TAATTCTACTAACTATCCTCGAATTCGCAGTAGCTATAATCCAAGCCTAC	0
+1	0	0
+>CACCAAACCCACGCTTACCACATAGTAAACCCCAGCCCATGACCACTTAC	0
+1	0	0
+>ACTTTAACTCAACCTTACTTCTAGCTATAGGGCTATTAACTAACATCCTT	0
+1	0	0
+>CCATCACACATCAATCGTTCAAAAGGGACTCCGATATGGCATAATCCTTT	0
+1	0	0
+>CACTCAAGCCTAGCCCCCACACCCGAACTAGGCGGCTGCTGACCACCCAC	0
+1	0	0
+>TGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCACCATAGCCTAATA	0
+1	0	0
+>AGGCGTATACTTCACCCTTCTCCAAGCCTCAGAATACTATGAAGCCTCAT	0
+1	0	0
+>TTCCACGGACTACACGTAATTATCGGATCTACCTTCCTCATTGTATGTTT	0
+1	0	0
+>AAGCAGCCGCTTGATACTGACACTTCGTCGACGTAGTCTGACTATTCTTG	0
+1	0	0
+>CAATTGACTTCCAATCAATCAGCTTCGGTATAACCCGAAAAAGAATAATA	0
+1	0	0
+>ACTCATCGCATTCTGACTACCACAACTAAACATCTATGCAGAAAAAACCA	0
+1	0	0
+>TCAATAAAATTTTTCTTAGTGGCCATTACATTTCTGCTATTCGACTTAGA	0
+1	0	0
+>ACACTATACTTATCATAGCACTAGTCCTAATCTCTCTTCTAGCCATCAGC	0
+1	0	0
+>TTAGTTTAAACCAAAACAAATGATTTCGACTCATTAAACTATGATTAACT	0
+1	0	0
+>ACAGTATCCCTCGTAGGCCTACTAATGTACCGATCCCACCTAATATCCTC	0
+1	0	0
+>TAATAGTCCTAAACACCCACTTCACACTAGCTAGTATAATACCTATCATC	0
+1	0	0
+>CATAGTCTCCAATACTTATGGAGTAGACCACGTACAAAACCTTAACCTCC	0
+1	0	0
+>GACTATCAAAAAAGAATATAATCTGAATCAACACTACAACCTATAGTCTA	0
+1	0	0
+>CCTAAACTTCTCACTAATATTCTTCTCCGATCCCCTATCAGCCCCACTTC	0
+1	0	0
+>CATCTATCTAAGGAACCACTAATCCGAAAAAAACTCTACATCACCATGCT	0
+1	0	0
+>TCTCCTTCTACATCCTATTTGAAGCCACATTAGTTCCAACACTAATTATC	0
+1	0	0
+>CCTATTCTACACACTAATAGGTTCCCTCCCACTCTTAGTTGCACTAATCT	0
+1	0	0
+>AACCAAGCACTACCCGACTCTTGATCCAATATTTTCCTATGACTAGCATG	0
+1	0	0
+>TCCCAAAAGCCCATGTAGAAGCCCCAATTGCCGGATCCATAGTGCTAGCA	0
+1	0	0
+>ACTAAACCCCCAAACTAGCTTTATAGCCTACCCCTTCCTCATACTATCCC	0
+1	0	0
+>AAATCACTTATTGCATACTCCTCTGTCAGCCACATAGCCCTAGTAATCGT	0
+1	0	0
+>TAATCGCTCACGGCCTTACATCATCAATACTATTCTGCCTGGCAAACTCA	0
+1	0	0
+>AACACTTCTTCCCCTTATAGCAGCCTGATGACTATTAGCCAGCCTAACCA	0
+1	0	0
+>ATATCATCATTCTCATGATCAAATATTACCATTATCCTAATAGGAGCCAA	0
+1	0	0
+>GAGGGAAATACACACACCATATCAACAGCATTAAACCTTCATTTACACGA	0
+1	0	0
+>TAACCCTAAAATTATCCTAGGCTTTACGTACTGTAAATATAGTTTAACAA	0
+1	0	0
+>CGAGAAAGTATGCAAGAACTGCTAATTCATGCCCCCATGTCCAACAAACA	0
+1	0	0
+>CCAAAAAATTGGTGCAACTCCAAATAAAAGTAATCAACATGTTCTCCTCC	0
+1	0	0
+>CTTCAATACCTACAAAAACAGCACGTTCCCGCATCATGTAAAAAACACTA	0
+1	0	0
+>TCTGGACAAGAAACAATTATCTCAAACTGACACTGAATAACCATACAAAC	0
+1	0	0
+>TACCAGTAGCCCTATTCGTAACATGATCTATTATGGAATTCTCCCTATGA	0
+1	0	0
+>ATTCCTCATCACTATAATAATTCTAGTCACAGCTAACAACCTTTTCCAAC	0
+1	0	0
+>TGATGATACGGCCGAACAGATGCCAACACCGCGGCCCTTCAAGCAATCCT	0
+1	0	0
+>TATTCAACACCAACACATGAGACCTCCAACAAATCTTCATACTCGACCCC	0
+1	0	0
+>ATCCGCTCAATTTGGACTCCACCCATGACTTCCTTCAGCCATAGAGGGCC	0
+1	0	0
+>GTCTTCCTGCTAATCCGCTTCCATCCACTAATAGAAAACAACAAAACAAT	0
+1	0	0
+>TCTGCGCACTCACTCAAAACGATATCAAAAAAATCATTGCTTTCTCCACC	0
+1	0	0
+>CCTAGCATTCCTCCACATTTGCACTCACGCATTCTTCAAAGCTATACTAT	0
+1	0	0
+>CGAAAAATAGGCGGACTATTTAATGCAATACCCTTCACCACCACATCTCT	0
+1	0	0
+>ACTCCAAAGACCTCATCATCGAAACCGCCAACACATCGTACACCAACGCC	0
+1	0	0
+>TACCCGAATCATCTTCTTTGCACTCCTAGGGCAACCCCGCTTCCTCCCTC	0
+1	0	0
+>CTCTTAATTGGCAGCATTTTTGCCGGATTCTTCATCTCCAACAATATCTA	0
+1	0	0
+>CCCTCGCAGTAACCATCCTAGGATTTACACTAGCCCTAGAACTAAGCTTG	0
+1	0	0
+>CAACCTCCTAGGATACTACCCAACAATTATACACCGACTCCCACCGCTCG	0
+1	0	0
+>TGACTAGAAAACATCCTGCCAAAATCTATCTCCCAGTTCCAAATAAAAAC	0
+1	0	0
+>CATTCCTCATCACCCTTACCCTAAGCATACTACTTTTTAATCTCCACGAG	0
+1	0	0
+>ATCACAACCCAAGCCCCATAACTATACAATGCAGCAGCCCCTATAATTTC	0
+1	0	0
+>CACCACTAAACTTAAACACTACCCCCACTTCCTCACTCTTCAGAACATAT	0
+1	0	0
+>AGTCGTATTAGACACCCATACCTCAGGATACTGCTCAGTAGCCATAGCCG	0
+1	0	0
+>ATCAACCCCAAAAAGGACCCTCCAAAATTCATAATAATACCACAACCTAC	0
+1	0	0
+>AAGAAAACCCCACAAAACTAACAACAAAAATAACACTCAAAATAAACACA	0
+1	0	0
+>GAAAAATCATCGTTGTATTTCAACTATAAGAACACCAATGACAAACATCC	0
+1	0	0
+>CCAGCCCCCTCAAACATTTCATCATGATGAAACTTCGGCTCCCTCCTAGG	0
+1	0	0
+>ACACATCAGACACGACAACTGCCTTCTCATCCGTCACTCACATCTGCCGA	0
+1	0	0
+>AATATTTTTTATCTGCCTCTTCATTCACGTAGGACGCGGCCTCTACTACG	0
+1	0	0
+>ACAGTTATAGCTACAGCATTCATGGGCTATGTCCTACCATGAGGCCAAAT	0
+1	0	0
+>ACATCGGTACTACCCTCGTCGAGTGAATCTGAGGTGGATTCTCAGTAGAC	0
+1	0	0
+>CATCACAGCCCTGGTAGTCGTACATTTACTATTTCTTCACGAAACAGGAT	0
+1	0	0
+>CCATATTATACAATTAAAGACATCCTAGGACTCCTCCTCCTGATCTTGCT	0
+1	0	0
+>ACTACACCCCAGCTAACCCTCTCAGCACTCCCCCTCATATTAAACCAGAA	0
+1	0	0
+>AGGCGGCGTATTAGCCCTAATCCTCTCCATCCTGATCCTAGCACTCATCC	0
+1	0	0
+>CAATGCGTATTCTGACTCTTAGTGGCAGACTTACTGACACTAACATGAAT	0
+1	0	0
+>CAATCCTCTACTTCTCCCTAATTCTCATTTTTATACCACTCGCAAGCACC	0
+1	0	0
+>ACCCTGGTCTTGTAAACCAGAAAAGGGGGAAAACGTTTCCTCCCAAGGAC	0
+1	0	0
+>TACTTAAACTATTCCTTGATTTCTTCCCCTAAACGACAACAATTTACCCT	0
+1	0	0
+>CTGACATGCAATATCTTATGAATGGCCTATGTACGTCGTGCATTAAATTG	0
+1	0	0
+>GTACATTATATTATTGATCGTGCATACCCCATCCAAGTCAAATCATTTCC	0
+1	0	0
+>GCGGGAAATCAGCAACCCTCCCAACTACGTGTCCCAATCCTCGCTCCGGG	0
+1	0	0
+>TCTTTCTTCAGGGCCATTCCCACCCAACCTCGCCCATTCTTTCCCCTTAA	0
+1	0	0
+>CTGTGATTTCATGCATTTGGTATCTTTTTATATTTGGGGATGCTATGACT	0
+1	0	0
+>CTTAAATTGAACGTTATTCCTCCGCATCAGCAACCATAAGGTGTTATTCA	0
+1	0	0
+>ctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacct	0
+1	0	0
+>gcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgcacctgtgc	0
+1	0	0
+>ctgtgcacctACCCGCGCAGTAAGCAAGTAATATAGCTTTCTTAATCAAA	0
+1	0	0
+>GCCAAACCCCAAAAACAAGACTAAACAATGCACAATACTTCATGAAGCTT	0
+1	0	0
+>GAACTTTCCCCCCGCCATTAATACCAACATGCTACTTTAATCAATAAAAT	0
+1	0	0
+>TTCTTCCCCC	0
+1	0	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/out.cov	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,14 @@
+>gi|528476637:29857558-29915771	58214
+1	29093	0
+29094	29356	2
+29357	33376	0
+33377	41951	1
+41952	58214	0
+>gi|157734152:29655295-29712160	56866
+1	29214	0
+29215	29477	1
+29478	33498	0
+33499	42073	1
+42074	48471	0
+48472	56865	1
+56866	56866	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/out.wig	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,116 @@
+track type="wiggle_0" name="PB"
+fixedStep chrom=gi|528476637:29857558-29915771 start=1 step=1024 span=1024
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+1
+1
+1
+1
+1
+1
+1
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+variableStep chrom=gi|528476637:29857558-29915771 span=1894
+56321 0
+fixedStep chrom=gi|157734152:29655295-29712160 start=1 step=1024 span=1024
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+0
+1
+1
+1
+1
+1
+1
+1
+1
+0
+0
+0
+0
+0
+0
+0
+1
+1
+1
+1
+1
+1
+variableStep chrom=gi|157734152:29655295-29712160 span=1570
+55297 0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/purge_dups_out.bed	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,11 @@
+gi|568815454	1200216	1203631	JUNK
+gi|568815567	1196244	1200852	JUNK
+gi|568815551	1197321	1201446	JUNK
+gi|568815561	1196951	1200436	JUNK
+gi|568815569	1240288	1243708	JUNK
+gi|568815529	1421891	1425306	JUNK
+gi|568815564	1286641	1289973	JUNK
+gi|568815592	29942469	29945883	JUNK
+gi|342187237	5004	8419	JUNK
+gi|528476637	29857558	29915771	JUNK
+gi|157734152	29655295	29712160	JUNK
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/purged_out.fa	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,2 @@
+>Sequence:1-608_1
+gttcgatgcc taaaatacct tcttttgtcc ctacacagac cacagttttc ctaatggctttacaccgact agaaattctt gtgcaagcac taattgaaag cggttggcct agagtgttaccggtttgtat agctgagcgc gtctcttgcc ctgatcaaag gttcattttc tctactttggaagacgttgt ggaagaatac aacaagtacg agtctctccc ccctggtttg ctgattactggatacagttg taataccctt cgcaacaccg cgtaactatc tatatgaatt attttccctttattatatgt agtaggttcg tctttaatct tcctttagca agtcttttac tgttttcgacctcaatgttc atgttcttag gttgttttgg ataatatgcg gtcagtttaa tcttcgttgtttcttcttaa aatatttatt catggtttaa tttttggttt gtacttgttc aggggccagttcattattta ctctgtttgt atacagcagt tcttttattt ttagtatgat tttaatttaaaacaattcta atggtcaaaa a
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/split_out.fasta	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,2 @@
+>Sequence:1-608
+gttcgatgcc taaaatacct tcttttgtcc ctacacagac cacagttttc ctaatggctttacaccgact agaaattctt gtgcaagcac taattgaaag cggttggcct agagtgttaccggtttgtat agctgagcgc gtctcttgcc ctgatcaaag gttcattttc tctactttggaagacgttgt ggaagaatac aacaagtacg agtctctccc ccctggtttg ctgattactggatacagttg taataccctt cgcaacaccg cgtaactatc tatatgaatt attttccctttattatatgt agtaggttcg tctttaatct tcctttagca agtcttttac tgttttcgacctcaatgttc atgttcttag gttgttttgg ataatatgcg gtcagtttaa tcttcgttgtttcttcttaa aatatttatt catggtttaa tttttggttt gtacttgttc aggggccagttcattattta ctctgtttgt atacagcagt tcttttattt ttagtatgat tttaatttaaaacaattcta atggtcaaaa a
Binary file test-data/test.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.cov	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,13 @@
+>gi|528476637:29857558-29915771	58214
+1	29092	0
+29093	29357	2
+29358	33375	0
+33376	41952	1
+41953	58214	0
+>gi|157734152:29655295-29712160	56866
+1	29213	0
+29214	29478	1
+29479	33497	0
+33498	42074	1
+42075	48470	0
+48471	56866	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.fasta	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,11 @@
+>Sequence 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other;
+gttcgatgcc taaaatacct tcttttgtcc ctacacagac cacagttttc ctaatggctt
+tacaccgact agaaattctt gtgcaagcac taattgaaag cggttggcct agagtgttac
+cggtttgtat agctgagcgc gtctcttgcc ctgatcaaag gttcattttc tctactttgg
+aagacgttgt ggaagaatac aacaagtacg agtctctccc ccctggtttg ctgattactg
+gatacagttg taataccctt cgcaacaccg cgtaactatc tatatgaatt attttccctt
+tattatatgt agtaggttcg tctttaatct tcctttagca agtcttttac tgttttcgac
+ctcaatgttc atgttcttag gttgttttgg ataatatgcg gtcagtttaa tcttcgttgt
+ttcttcttaa aatatttatt catggtttaa tttttggttt gtacttgttc aggggccagt
+tcattattta ctctgtttgt atacagcagt tcttttattt ttagtatgat tttaatttaa
+aacaattcta atggtcaaaa a
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.paf	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,245 @@
+gi|568815454:1200216-1203631	3416	0	3416	+	gi|568815529:1421891-1425306	3416	0	3416	3416	3416	0	NM:i:0	ms:i:6832	AS:i:6832	nn:i:0	tp:A:S	cm:i:637	s1:i:3404	de:f:0	rl:i:0	cg:Z:3416M
+gi|568815454:1200216-1203631	3416	0	3416	+	gi|568815592:29942469-29945883	3415	0	3415	3371	3416	0	NM:i:45	ms:i:6560	AS:i:6560	nn:i:0	tp:A:S	cm:i:540	s1:i:3085	de:f:0.0132	rl:i:0	cg:Z:1212M1I2203M
+gi|568815454:1200216-1203631	3416	0	3411	+	gi|568815567:1196244-1200852	4609	1184	4609	3297	3432	0	NM:i:135	ms:i:6090	AS:i:6090	nn:i:0	tp:A:S	cm:i:381	s1:i:2452	de:f:0.0329	rl:i:0	cg:Z:1339M4D149M17D495M3I183M1I238M3I1000M
+gi|568815454:1200216-1203631	3416	0	3411	+	gi|568815551:1197321-1201446	4126	701	4126	3289	3432	0	NM:i:143	ms:i:6038	AS:i:6038	nn:i:0	tp:A:S	cm:i:385	s1:i:2485	de:f:0.0355	rl:i:0	cg:Z:1343M3D1M1D144M17D495M3I183M1I238M3I1000M
+gi|568815454:1200216-1203631	3416	0	3411	+	gi|568815561:1196951-1200436	3486	60	3486	3290	3434	0	NM:i:144	ms:i:6038	AS:i:6038	nn:i:0	tp:A:S	cm:i:371	s1:i:2447	de:f:0.0352	rl:i:0	cg:Z:175M1I1163M4D149M17D495M3I165M2D18M1I238M3I1000M
+gi|568815454:1200216-1203631	3416	5	3411	+	gi|568815569:1240288-1243708	3421	0	3421	3284	3429	0	NM:i:145	ms:i:6022	AS:i:6022	nn:i:0	tp:A:S	cm:i:383	s1:i:2483	de:f:0.0355	rl:i:0	cg:Z:170M1I1163M4D149M17D495M3I165M2D18M1I238M3I1000M
+gi|568815454:1200216-1203631	3416	92	3411	+	gi|568815564:1286641-1289973	3333	0	3333	3198	3340	0	NM:i:142	ms:i:5860	AS:i:5860	nn:i:0	tp:A:S	cm:i:372	s1:i:2412	de:f:0.0362	rl:i:0	cg:Z:1251M3D1M1D144M17D495M3I183M1I238M3I1000M
+gi|568815529:1421891-1425306	3416	0	3416	+	gi|568815592:29942469-29945883	3415	0	3415	3371	3416	0	NM:i:45	ms:i:6560	AS:i:6560	nn:i:0	tp:A:S	cm:i:540	s1:i:3085	de:f:0.0132	rl:i:0	cg:Z:1212M1I2203M
+gi|568815529:1421891-1425306	3416	0	3411	+	gi|568815567:1196244-1200852	4609	1184	4609	3297	3432	0	NM:i:135	ms:i:6090	AS:i:6090	nn:i:0	tp:A:S	cm:i:381	s1:i:2452	de:f:0.0329	rl:i:0	cg:Z:1339M4D149M17D495M3I183M1I238M3I1000M
+gi|568815529:1421891-1425306	3416	0	3411	+	gi|568815561:1196951-1200436	3486	60	3486	3290	3434	0	NM:i:144	ms:i:6038	AS:i:6038	nn:i:0	tp:A:S	cm:i:371	s1:i:2447	de:f:0.0352	rl:i:0	cg:Z:175M1I1163M4D149M17D495M3I165M2D18M1I238M3I1000M
+gi|568815529:1421891-1425306	3416	0	3411	+	gi|568815551:1197321-1201446	4126	701	4126	3289	3432	0	NM:i:143	ms:i:6038	AS:i:6038	nn:i:0	tp:A:S	cm:i:385	s1:i:2485	de:f:0.0355	rl:i:0	cg:Z:1343M3D1M1D144M17D495M3I183M1I238M3I1000M
+gi|568815529:1421891-1425306	3416	5	3411	+	gi|568815569:1240288-1243708	3421	0	3421	3284	3429	0	NM:i:145	ms:i:6022	AS:i:6022	nn:i:0	tp:A:S	cm:i:383	s1:i:2483	de:f:0.0355	rl:i:0	cg:Z:170M1I1163M4D149M17D495M3I165M2D18M1I238M3I1000M
+gi|568815529:1421891-1425306	3416	92	3411	+	gi|568815564:1286641-1289973	3333	0	3333	3198	3340	0	NM:i:142	ms:i:5860	AS:i:5860	nn:i:0	tp:A:S	cm:i:372	s1:i:2412	de:f:0.0362	rl:i:0	cg:Z:1251M3D1M1D144M17D495M3I183M1I238M3I1000M
+gi|568815551:1197321-1201446	4126	0	4126	+	gi|568815567:1196244-1200852	4609	483	4609	4061	4126	0	NM:i:65	ms:i:7862	AS:i:7862	nn:i:0	tp:A:S	cm:i:604	s1:i:3595	de:f:0.0158	rl:i:0	cg:Z:4126M
+gi|568815551:1197321-1201446	4126	793	4126	+	gi|568815564:1286641-1289973	3333	0	3333	3333	3333	0	NM:i:0	ms:i:6666	AS:i:6666	nn:i:0	tp:A:S	cm:i:615	s1:i:3324	de:f:0	rl:i:0	cg:Z:3333M
+gi|568815551:1197321-1201446	4126	641	4126	+	gi|568815561:1196951-1200436	3486	0	3486	3409	3487	0	NM:i:78	ms:i:6504	AS:i:6504	nn:i:0	tp:A:S	cm:i:456	s1:i:2855	de:f:0.0221	rl:i:0	cg:Z:235M1I1996M2D1253M
+gi|568815551:1197321-1201446	4126	706	4126	+	gi|568815569:1240288-1243708	3421	0	3421	3343	3422	0	NM:i:79	ms:i:6368	AS:i:6368	nn:i:0	tp:A:S	cm:i:455	s1:i:2819	de:f:0.0228	rl:i:0	cg:Z:170M1I1996M2D1253M
+gi|568815551:1197321-1201446	4126	701	4126	+	gi|568815592:29942469-29945883	3415	0	3410	3296	3432	0	NM:i:136	ms:i:6078	AS:i:6078	nn:i:0	tp:A:S	cm:i:381	s1:i:2471	de:f:0.0334	rl:i:0	cg:Z:1212M1I130M3I1M1I144M17I495M3D183M1D238M3D1000M
+gi|568815561:1196951-1200436	3486	65	3486	+	gi|568815569:1240288-1243708	3421	0	3421	3398	3421	0	NM:i:23	ms:i:6704	AS:i:6704	nn:i:0	tp:A:S	cm:i:574	s1:i:3257	de:f:0.0067	rl:i:0	cg:Z:3421M
+gi|568815561:1196951-1200436	3486	0	3486	+	gi|568815567:1196244-1200852	4609	1124	4609	3435	3487	0	NM:i:52	ms:i:6660	AS:i:6660	nn:i:0	tp:A:S	cm:i:518	s1:i:3068	de:f:0.0146	rl:i:0	cg:Z:235M1D1996M2I1253M
+gi|568815561:1196951-1200436	3486	152	3486	+	gi|568815564:1286641-1289973	3333	0	3333	3257	3335	0	NM:i:78	ms:i:6200	AS:i:6200	nn:i:0	tp:A:S	cm:i:426	s1:i:2708	de:f:0.0231	rl:i:0	cg:Z:83M1D1996M2I1253M
+gi|568815561:1196951-1200436	3486	60	3486	+	gi|568815592:29942469-29945883	3415	0	3410	3298	3434	0	NM:i:136	ms:i:6084	AS:i:6084	nn:i:0	tp:A:S	cm:i:380	s1:i:2501	de:f:0.0328	rl:i:0	cg:Z:175M1D1036M1I126M4I149M17I495M3D165M2I18M1D238M3D1000M
+gi|568815564:1286641-1289973	3333	0	3333	+	gi|568815567:1196244-1200852	4609	1276	4609	3271	3333	0	NM:i:62	ms:i:6294	AS:i:6294	nn:i:0	tp:A:S	cm:i:459	s1:i:2836	de:f:0.0186	rl:i:0	cg:Z:3333M
+gi|568815564:1286641-1289973	3333	0	3333	+	gi|568815569:1240288-1243708	3421	87	3421	3256	3335	0	NM:i:79	ms:i:6194	AS:i:6194	nn:i:0	tp:A:S	cm:i:439	s1:i:2735	de:f:0.0234	rl:i:0	cg:Z:83M1I1996M2D1253M
+gi|568815564:1286641-1289973	3333	0	3333	+	gi|568815592:29942469-29945883	3415	92	3410	3206	3340	0	NM:i:134	ms:i:5906	AS:i:5906	nn:i:0	tp:A:S	cm:i:370	s1:i:2404	de:f:0.0338	rl:i:0	cg:Z:1120M1I130M3I1M1I144M17I495M3D183M1D238M3D1000M
+gi|568815567:1196244-1200852	4609	1189	4609	+	gi|568815569:1240288-1243708	3421	0	3421	3368	3422	0	NM:i:54	ms:i:6518	AS:i:6518	nn:i:0	tp:A:S	cm:i:514	s1:i:3034	de:f:0.0155	rl:i:0	cg:Z:170M1I1996M2D1253M
+gi|568815567:1196244-1200852	4609	1184	4609	+	gi|568815592:29942469-29945883	3415	0	3410	3293	3432	0	NM:i:139	ms:i:6064	AS:i:6064	nn:i:0	tp:A:S	cm:i:374	s1:i:2444	de:f:0.0340	rl:i:0	cg:Z:1212M1I126M4I149M17I495M3D183M1D238M3D1000M
+gi|568815569:1240288-1243708	3421	0	3421	+	gi|568815592:29942469-29945883	3415	5	3410	3289	3429	0	NM:i:140	ms:i:6050	AS:i:6050	nn:i:0	tp:A:S	cm:i:388	s1:i:2487	de:f:0.0341	rl:i:0	cg:Z:170M1D1036M1I126M4I149M17I495M3D165M2I18M1D238M3D1000M
+gi|342187237:5004-8419	3416	0	3416	+	gi|568815529:1421891-1425306	3416	0	3416	3416	3416	0	NM:i:0	ms:i:6832	AS:i:6832	nn:i:0	tp:A:S	cm:i:637	s1:i:3404	de:f:0	rl:i:0	cg:Z:3416M
+gi|342187237:5004-8419	3416	0	3416	+	gi|568815454:1200216-1203631	3416	0	3416	3416	3416	0	NM:i:0	ms:i:6832	AS:i:6832	nn:i:0	tp:A:S	cm:i:637	s1:i:3404	de:f:0	rl:i:0	cg:Z:3416M
+gi|342187237:5004-8419	3416	0	3416	+	gi|568815592:29942469-29945883	3415	0	3415	3371	3416	0	NM:i:45	ms:i:6560	AS:i:6560	nn:i:0	tp:A:S	cm:i:540	s1:i:3085	de:f:0.0132	rl:i:0	cg:Z:1212M1I2203M
+gi|342187237:5004-8419	3416	0	3411	+	gi|568815567:1196244-1200852	4609	1184	4609	3297	3432	0	NM:i:135	ms:i:6090	AS:i:6090	nn:i:0	tp:A:S	cm:i:381	s1:i:2452	de:f:0.0329	rl:i:0	cg:Z:1339M4D149M17D495M3I183M1I238M3I1000M
+gi|342187237:5004-8419	3416	0	3416	+	gi|528476637:29857558-29915771	58214	54784	58214	3296	3437	0	NM:i:141	ms:i:6060	AS:i:6060	nn:i:0	tp:A:S	cm:i:389	s1:i:2505	de:f:0.0348	rl:i:0	cg:Z:1343M3D1M1D144M17D495M3I183M1I238M3I1005M
+gi|342187237:5004-8419	3416	0	3411	+	gi|568815551:1197321-1201446	4126	701	4126	3289	3432	0	NM:i:143	ms:i:6038	AS:i:6038	nn:i:0	tp:A:S	cm:i:385	s1:i:2485	de:f:0.0355	rl:i:0	cg:Z:1343M3D1M1D144M17D495M3I183M1I238M3I1000M
+gi|342187237:5004-8419	3416	0	3411	+	gi|568815561:1196951-1200436	3486	60	3486	3290	3434	0	NM:i:144	ms:i:6038	AS:i:6038	nn:i:0	tp:A:S	cm:i:371	s1:i:2447	de:f:0.0352	rl:i:0	cg:Z:175M1I1163M4D149M17D495M3I165M2D18M1I238M3I1000M
+gi|342187237:5004-8419	3416	5	3411	+	gi|568815569:1240288-1243708	3421	0	3421	3284	3429	0	NM:i:145	ms:i:6022	AS:i:6022	nn:i:0	tp:A:S	cm:i:383	s1:i:2483	de:f:0.0355	rl:i:0	cg:Z:170M1I1163M4D149M17D495M3I165M2D18M1I238M3I1000M
+gi|342187237:5004-8419	3416	92	3411	+	gi|568815564:1286641-1289973	3333	0	3333	3198	3340	0	NM:i:142	ms:i:5860	AS:i:5860	nn:i:0	tp:A:S	cm:i:372	s1:i:2412	de:f:0.0362	rl:i:0	cg:Z:1251M3D1M1D144M17D495M3I183M1I238M3I1000M
+gi|342187237:5004-8419	3416	0	3416	+	gi|528476637:29857558-29915771	58214	0	3428	3142	3464	0	NM:i:322	ms:i:5064	AS:i:5064	nn:i:0	tp:A:S	cm:i:215	s1:i:1596	de:f:0.0772	rl:i:0	cg:Z:185M2I2M4I224M1D3M1I61M1I5M1D108M3D13M1I118M1I486M12I112M4D22M19D127M17D296M1I433M2I589M1I40M1D33M1I37M1I48M1I57M1D1M2I31M4I96M1D88M1I165M
+gi|342187237:5004-8419	3416	3	3416	+	gi|528476637:29857558-29915771	58214	38484	41952	3039	3493	0	NM:i:454	ms:i:4320	AS:i:4320	nn:i:0	tp:A:S	cm:i:107	s1:i:1001	de:f:0.1130	rl:i:0	cg:Z:34M1D52M1I123M2I1M1D255M1I4M1D11M1I21M1D12M4I3M1D2M1D4M2D59M3D33M3D38M1I3M2D60M1I25M1D277M1I327M1D132M16D164M5D6M2D207M2I74M7D52M20D363M1D41M3D90M1I103M6I96M1D6M1I117M1D2M1I208M1I132M2D26M4D60M1I165M
+gi|342187237:5004-8419	3416	1488	3158	+	gi|528476637:29857558-29915771	58214	8636	10269	1295	1729	0	NM:i:434	ms:i:964	AS:i:970	nn:i:0	tp:A:S	cm:i:10	s1:i:118	de:f:0.2026	rl:i:0	cg:Z:35M1I414M1D3M1I7M1I12M3D44M20D84M3I2M2I2M10I42M1D3M1I9M3I2M4I21M1D24M2I2M4I11M9D11M1D1M1D11M4I8M1D4M1D8M4I60M3I11M1D6M1D17M2I8M1D5M2D38M2D4M1D3M1I39M2I15M26I105M2D1M5D59M1I108M1I2M1D47M2I71M2I47M1D6M7I3M3I40M2I3M1D19M1D7M1D37M3I12M1I41M
+gi|342187237:5004-8419	3416	891	1307	+	gi|528476637:29857558-29915771	58214	44457	44873	392	416	0	NM:i:24	ms:i:688	AS:i:688	nn:i:0	tp:A:S	cm:i:36	s1:i:238	de:f:0.0577	rl:i:0	cg:Z:416M
+gi|528476637:29857558-29915771	58214	53600	58209	+	gi|568815567:1196244-1200852	4609	0	4609	4559	4609	0	NM:i:50	ms:i:8918	AS:i:8918	nn:i:0	tp:A:S	cm:i:729	s1:i:4180	de:f:0.0108	rl:i:25	cg:Z:4609M
+gi|528476637:29857558-29915771	58214	33375	41952	+	gi|528476637:29857558-29915771	58214	49822	58214	7180	8967	0	NM:i:1787	ms:i:8814	AS:i:9504	nn:i:0	tp:A:S	cm:i:225	s1:i:2063	de:f:0.1118	rl:i:25	cg:Z:24M4D11M3I103M2I43M2I32M3D51M1D139M5D1M1D573M3I3M2I49M1D3M1D13M2D5M1I189M1D36M17D448M1I3M1D215M3I35M4I263M8I23M1D91M1D279M1I137M310D48M4I225M6I3M1D3M350I6M2I46M1D379M1I54M1I85M2I21M1I6M90I167M1I74M1D1M2D236M1D10M4D48M19I109M4D346M1I52M1D125M1D271M1D21M1I12M4D3M1I2M1I4M2I57M2I3M1I32M3I40M1I62M1D25M1I277M1D311M3D2M1D14M1I148M1D170M7I207M2D66M2I5M6I2M1D39M3I10M20I173M1I189M1I41M3I8M3I79M1D103M6D96M1I6M1D328M1D132M2I26M4I60M1D165M
+gi|528476637:29857558-29915771	58214	49822	58214	+	gi|528476637:29857558-29915771	58214	33375	41952	7180	8967	0	NM:i:1787	ms:i:8814	AS:i:9504	nn:i:0	tp:A:S	cm:i:225	s1:i:2063	de:f:0.1118	rl:i:25	cg:Z:24M4I11M3D103M2D43M2D32M3I51M1I139M5I1M1I573M3D3M2D49M1I3M1I13M2I5M1D189M1I36M17I448M1D3M1I215M3D35M4D263M8D23M1I91M1I279M1D137M310I48M4D225M6D3M1I3M350D6M2D46M1I379M1D54M1D85M2D21M1D6M90D167M1D74M1I1M2I236M1I10M4I48M19D109M4I346M1D52M1I125M1I271M1I21M1D12M4I3M1D2M1D4M2D57M2D3M1D32M3D40M1D62M1I25M1D277M1I311M3I2M1I14M1D148M1I170M7D207M2I66M2D5M6D2M1I39M3D10M20D173M1D189M1D41M3D8M3D79M1I103M6I96M1D6M1I328M1I132M2D26M4D60M1I165M
+gi|528476637:29857558-29915771	58214	54083	58209	+	gi|568815551:1197321-1201446	4126	0	4126	4107	4126	0	NM:i:19	ms:i:8138	AS:i:8138	nn:i:0	tp:A:S	cm:i:726	s1:i:3964	de:f:0.0046	rl:i:25	cg:Z:4126M
+gi|528476637:29857558-29915771	58214	54876	58209	+	gi|568815564:1286641-1289973	3333	0	3333	3317	3333	0	NM:i:16	ms:i:6570	AS:i:6570	nn:i:0	tp:A:S	cm:i:578	s1:i:3203	de:f:0.0048	rl:i:25	cg:Z:3333M
+gi|528476637:29857558-29915771	58214	54724	58209	+	gi|568815561:1196951-1200436	3486	0	3486	3417	3487	0	NM:i:70	ms:i:6552	AS:i:6552	nn:i:0	tp:A:S	cm:i:469	s1:i:2920	de:f:0.0198	rl:i:25	cg:Z:235M1I1996M2D1253M
+gi|528476637:29857558-29915771	58214	54789	58209	+	gi|568815569:1240288-1243708	3421	0	3421	3347	3422	0	NM:i:75	ms:i:6392	AS:i:6392	nn:i:0	tp:A:S	cm:i:462	s1:i:2853	de:f:0.0216	rl:i:25	cg:Z:170M1I1996M2D1253M
+gi|528476637:29857558-29915771	58214	54784	58214	+	gi|568815592:29942469-29945883	3415	0	3415	3305	3437	0	NM:i:132	ms:i:6112	AS:i:6112	nn:i:0	tp:A:S	cm:i:393	s1:i:2554	de:f:0.0322	rl:i:25	cg:Z:1212M1I130M3I1M1I144M17I495M3D183M1D238M3D1005M
+gi|528476637:29857558-29915771	58214	54784	58214	+	gi|568815454:1200216-1203631	3416	0	3416	3296	3437	0	NM:i:141	ms:i:6060	AS:i:6060	nn:i:0	tp:A:S	cm:i:389	s1:i:2505	de:f:0.0348	rl:i:25	cg:Z:1343M3I1M1I144M17I495M3D183M1D238M3D1005M
+gi|528476637:29857558-29915771	58214	54784	58214	+	gi|568815529:1421891-1425306	3416	0	3416	3296	3437	0	NM:i:141	ms:i:6060	AS:i:6060	nn:i:0	tp:A:S	cm:i:389	s1:i:2505	de:f:0.0348	rl:i:25	cg:Z:1343M3I1M1I144M17I495M3D183M1D238M3D1005M
+gi|528476637:29857558-29915771	58214	37198	41947	+	gi|568815567:1196244-1200852	4609	4	4609	4086	4791	0	NM:i:705	ms:i:5600	AS:i:5670	nn:i:0	tp:A:S	cm:i:117	s1:i:1106	de:f:0.1146	rl:i:25	cg:Z:48M1I54M1I85M2I21M1I6M90I167M1I74M1D1M2D236M1D10M4D48M19I109M4D346M1I52M1D125M1D271M1D21M1I12M4D3M1I2M1I4M2I59M3I33M3I40M1I62M1D25M1I217M3D9M3I48M1D311M1D2M3D14M1I148M1D170M7I207M2D66M2I5M6I2M1D39M3I10M20I173M1I189M1I41M3I8M3I79M1D103M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|528476637:29857558-29915771	58214	37770	41947	+	gi|568815551:1197321-1201446	4126	0	4126	3656	4215	0	NM:i:559	ms:i:5146	AS:i:5146	nn:i:0	tp:A:S	cm:i:119	s1:i:1088	de:f:0.1156	rl:i:25	cg:Z:216M1D10M4D48M19I109M4D346M1I52M1D123M1I1M2D254M1D5M1I11M1D21M1I12M4D3M1I2M1I4M2I57M2I3M1I32M3I40M1I62M1D25M1I277M1D311M3D2M1D14M1I148M1D170M7I207M2D66M2I5M6I2M1D39M3I10M20I173M1I189M1I41M3I8M3I79M1D103M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|528476637:29857558-29915771	58214	0	3423	+	gi|568815567:1196244-1200852	4609	1184	4609	3154	3460	0	NM:i:306	ms:i:5116	AS:i:5116	nn:i:0	tp:A:S	cm:i:190	s1:i:1543	de:f:0.0767	rl:i:25	cg:Z:185M2D2M4D225M1I2M1D61M1D5M1I108M3I13M1D118M1D486M12D138M19I440M1D198M3I184M1I47M2D188M3I398M1D40M1I33M1D37M1D11M1D3M1I33M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|528476637:29857558-29915771	58214	0	3428	+	gi|528476637:29857558-29915771	58214	54784	58214	3155	3464	0	NM:i:309	ms:i:5110	AS:i:5110	nn:i:0	tp:A:S	cm:i:202	s1:i:1617	de:f:0.0775	rl:i:25	cg:Z:185M2D2M4D225M1I2M1D61M1D5M1I108M3I13M1D118M1D486M12D138M19I440M1D198M3I184M1I47M2D188M3I398M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|528476637:29857558-29915771	58214	54784	58214	+	gi|528476637:29857558-29915771	58214	0	3428	3155	3464	0	NM:i:309	ms:i:5110	AS:i:5110	nn:i:0	tp:A:S	cm:i:202	s1:i:1617	de:f:0.0775	rl:i:25	cg:Z:185M2I2M4I225M1D2M1I61M1I5M1D108M3D13M1I118M1I486M12I138M19D440M1I198M3D184M1D47M2I188M3D398M1I40M1D33M1I37M1I48M1I57M1D1M2I31M4I96M1D88M1I165M
+gi|528476637:29857558-29915771	58214	5	3423	+	gi|568815569:1240288-1243708	3421	0	3421	3148	3458	0	NM:i:310	ms:i:5086	AS:i:5086	nn:i:0	tp:A:S	cm:i:191	s1:i:1564	de:f:0.0774	rl:i:25	cg:Z:167M1D2M2I9M2D2M4D225M1I2M1D61M1D5M1I108M3I13M1D118M1D486M12D138M19I440M1D198M3I168M2D16M1I47M2D188M3I398M1D40M1I33M1D37M1D11M1D3M1I33M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|528476637:29857558-29915771	58214	0	3428	+	gi|568815529:1421891-1425306	3416	0	3416	3142	3464	0	NM:i:322	ms:i:5064	AS:i:5064	nn:i:0	tp:A:S	cm:i:215	s1:i:1596	de:f:0.0772	rl:i:25	cg:Z:185M2D2M4D224M1I3M1D61M1D5M1I108M3I13M1D118M1D486M12D112M4I22M19I127M17I296M1D433M2D589M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|528476637:29857558-29915771	58214	0	3428	+	gi|568815454:1200216-1203631	3416	0	3416	3142	3464	0	NM:i:322	ms:i:5064	AS:i:5064	nn:i:0	tp:A:S	cm:i:215	s1:i:1596	de:f:0.0772	rl:i:25	cg:Z:185M2D2M4D224M1I3M1D61M1D5M1I108M3I13M1D118M1D486M12D112M4I22M19I127M17I296M1D433M2D589M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|528476637:29857558-29915771	58214	0	3423	+	gi|568815561:1196951-1200436	3486	60	3486	3144	3463	0	NM:i:319	ms:i:5042	AS:i:5042	nn:i:0	tp:A:S	cm:i:188	s1:i:1556	de:f:0.0799	rl:i:25	cg:Z:172M1D2M2I9M2D2M4D225M1I2M1D61M1D5M1I108M3I13M1D118M1D486M12D138M19I440M1D198M3I168M2D16M1I47M2D188M3I398M1D40M1I33M1D37M1D11M1D3M1I33M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|528476637:29857558-29915771	58214	0	3423	+	gi|568815551:1197321-1201446	4126	701	4126	3137	3459	0	NM:i:322	ms:i:5022	AS:i:5022	nn:i:0	tp:A:S	cm:i:196	s1:i:1569	de:f:0.0814	rl:i:25	cg:Z:185M2D2M4D225M1I2M1D61M1D5M1I108M3I13M1D118M1D486M12D138M19I440M1D198M3I184M1I47M2D188M3I398M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|528476637:29857558-29915771	58214	0	3428	+	gi|568815592:29942469-29945883	3415	0	3415	3134	3463	0	NM:i:329	ms:i:5014	AS:i:5014	nn:i:0	tp:A:S	cm:i:206	s1:i:1582	de:f:0.0799	rl:i:25	cg:Z:185M2D2M4D225M1I2M1D61M1D5M1I108M3I13M1D118M1D485M10D1M1D112M4I22M19I127M17I296M1D433M2D589M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|528476637:29857558-29915771	58214	92	3423	+	gi|568815564:1286641-1289973	3333	0	3333	3053	3367	0	NM:i:314	ms:i:4886	AS:i:4886	nn:i:0	tp:A:S	cm:i:191	s1:i:1531	de:f:0.0813	rl:i:25	cg:Z:93M2D2M4D225M1I2M1D61M1D5M1I108M3I13M1D118M1D486M12D138M19I440M1D198M3I184M1I47M2D188M3I398M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|528476637:29857558-29915771	58214	38484	42085	+	gi|528476637:29857558-29915771	58214	3	3561	3171	3642	0	NM:i:471	ms:i:4520	AS:i:4520	nn:i:0	tp:A:S	cm:i:135	s1:i:1107	de:f:0.1103	rl:i:25	cg:Z:34M1I52M1D95M2I2M4I22M1D202M1D2M1I67M1D19M1I104M1I9M3I47M1I87M1I277M1D106M1D7M2I2M1D68M12I114M1D2M3D20M17D1M1D142M1D164M5I6M2I120M1I86M2D74M7I58M14I6M5I1M1I209M2I139M1I42M2I1M1I88M1D103M6D96M1I6M1D106M1I40M1D33M1I37M1I52M1I84M4I101M1I26M4I358M
+gi|528476637:29857558-29915771	58214	3	3561	+	gi|528476637:29857558-29915771	58214	38484	42085	3171	3642	0	NM:i:471	ms:i:4520	AS:i:4520	nn:i:0	tp:A:S	cm:i:135	s1:i:1107	de:f:0.1103	rl:i:25	cg:Z:34M1D52M1I95M2D2M4D22M1I202M1I2M1D67M1I19M1D104M1D9M3D47M1D87M1D277M1I106M1I7M2D2M1I68M12D114M1I2M3I20M17I1M1I142M1I164M5D6M2D120M1D86M2I74M7D58M14D6M5D1M1D209M2D139M1D42M2D1M1D88M1I103M6I96M1D6M1I106M1D40M1I33M1D37M1D52M1D84M4D101M1D26M4D358M
+gi|528476637:29857558-29915771	58214	38421	41947	+	gi|568815561:1196951-1200436	3486	0	3486	3090	3555	0	NM:i:465	ms:i:4352	AS:i:4352	nn:i:0	tp:A:S	cm:i:95	s1:i:919	de:f:0.1166	rl:i:25	cg:Z:97M1I52M1D81M1I43M1D255M1D4M1I11M1D21M1I12M4D3M1I2M1I4M2I57M2I3M1I32M3I40M1I62M1D25M1I277M1D311M1D2M3D14M1I148M1D170M7I207M2D74M7I39M3I10M20I158M2D15M1I189M1I41M3I8M3I79M1D103M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|528476637:29857558-29915771	58214	38484	41952	+	gi|568815592:29942469-29945883	3415	3	3415	3041	3495	0	NM:i:454	ms:i:4326	AS:i:4326	nn:i:0	tp:A:S	cm:i:110	s1:i:990	de:f:0.1121	rl:i:25	cg:Z:34M1I52M1D123M1I1M2D255M1D4M1I11M1D21M1I12M4D3M1I2M1I4M2I59M3I33M3I40M1I62M1D25M1I222M3D4M3I48M1D180M1I146M1I132M16I164M5I6M2I207M2D74M7I52M20I363M1I41M3I90M1D103M6D96M1I6M1D117M1I2M1D208M1D132M2I26M4I60M1D165M
+gi|528476637:29857558-29915771	58214	38484	41952	+	gi|568815454:1200216-1203631	3416	3	3416	3039	3493	0	NM:i:454	ms:i:4320	AS:i:4320	nn:i:0	tp:A:S	cm:i:107	s1:i:1001	de:f:0.1130	rl:i:25	cg:Z:34M1I52M1D123M1I1M2D255M1D4M1I11M1D21M1I12M4D3M1I2M1I4M2I59M3I33M3I38M1D3M2I60M1D25M1I277M1D327M1I132M16I164M5I6M2I207M2D74M7I52M20I363M1I41M3I90M1D103M6D96M1I6M1D117M1I2M1D208M1D132M2I26M4I60M1D165M
+gi|528476637:29857558-29915771	58214	38484	41952	+	gi|568815529:1421891-1425306	3416	3	3416	3039	3493	0	NM:i:454	ms:i:4320	AS:i:4320	nn:i:0	tp:A:S	cm:i:107	s1:i:1001	de:f:0.1130	rl:i:25	cg:Z:34M1I52M1D123M1I1M2D255M1D4M1I11M1D21M1I12M4D3M1I2M1I4M2I59M3I33M3I38M1D3M2I60M1D25M1I277M1D327M1I132M16I164M5I6M2I207M2D74M7I52M20I363M1I41M3I90M1D103M6D96M1I6M1D117M1I2M1D208M1D132M2I26M4I60M1D165M
+gi|528476637:29857558-29915771	58214	38486	41947	+	gi|568815569:1240288-1243708	3421	0	3421	3037	3486	0	NM:i:449	ms:i:4310	AS:i:4310	nn:i:0	tp:A:S	cm:i:97	s1:i:949	de:f:0.1154	rl:i:25	cg:Z:32M1I52M1D81M1I43M1D255M1D4M1I11M1D21M1I82M2I3M1I32M3I40M1I62M1D25M1I277M1D311M1D2M3D14M1I148M1D170M7I207M2D74M7I39M3I10M20I158M2D15M1I189M1I41M3I8M3I79M1D103M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|528476637:29857558-29915771	58214	38573	41947	+	gi|568815564:1286641-1289973	3333	0	3333	2962	3402	0	NM:i:440	ms:i:4198	AS:i:4198	nn:i:0	tp:A:S	cm:i:100	s1:i:935	de:f:0.1145	rl:i:25	cg:Z:121M1I1M2D254M1D5M1I11M1D21M1I12M4D3M1I2M1I4M2I57M2I3M1I32M3I40M1I62M1D25M1I277M1D311M3D2M1D14M1I148M1D170M7I207M2D66M2I5M6I2M1D39M3I10M20I173M1I189M1I41M3I8M3I79M1D103M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|528476637:29857558-29915771	58214	3555	4654	+	gi|528476637:29857558-29915771	58214	43020	44118	982	1103	0	NM:i:121	ms:i:1478	AS:i:1478	nn:i:0	tp:A:S	cm:i:30	s1:i:230	de:f:0.1065	rl:i:25	cg:Z:156M1I416M3D62M3I27M1I156M1D277M
+gi|528476637:29857558-29915771	58214	43020	44118	+	gi|528476637:29857558-29915771	58214	3555	4654	982	1103	0	NM:i:121	ms:i:1478	AS:i:1478	nn:i:0	tp:A:S	cm:i:30	s1:i:230	de:f:0.1065	rl:i:25	cg:Z:156M1D416M3I62M3D27M1D156M1I277M
+gi|528476637:29857558-29915771	58214	48998	49823	+	gi|528476637:29857558-29915771	58214	31581	32408	735	834	0	NM:i:99	ms:i:1062	AS:i:1062	nn:i:0	tp:A:S	cm:i:17	s1:i:194	de:f:0.1134	rl:i:25	cg:Z:9M2D100M1I166M1I2M1D93M1D142M1D28M2D3M2D113M1I3M3I4M1I155M
+gi|528476637:29857558-29915771	58214	31581	32408	+	gi|528476637:29857558-29915771	58214	48998	49823	735	834	0	NM:i:99	ms:i:1062	AS:i:1062	nn:i:0	tp:A:S	cm:i:17	s1:i:194	de:f:0.1134	rl:i:25	cg:Z:9M2I100M1D166M1D2M1I93M1I142M1I28M2I3M2I113M1D3M3D4M1D155M
+gi|528476637:29857558-29915771	58214	1488	3170	+	gi|528476637:29857558-29915771	58214	8615	10269	1320	1753	0	NM:i:433	ms:i:1012	AS:i:1018	nn:i:0	tp:A:S	cm:i:12	s1:i:120	de:f:0.1961	rl:i:25	cg:Z:11M2I45M1I260M1D153M1D3M1I7M1I12M3D41M14D4M6D78M3I6M5I3M7I55M5I2M2I21M1D26M2D2M6D11M1I6M2I5M2D11M4I8M1D4M1D8M4I59M3I12M1D6M1D17M2I8M1D5M2D38M2D47M2I15M26I22M1I7M1D75M2D1M5D22M1I5M1I6M1I3M3D20M1I115M1D44M5I3M1D1M1D17M1D41M1D2M2I7M1I3M1D36M2D6M7I3M3I63M1D3M5D37M3I2M2I9M1D41M
+gi|528476637:29857558-29915771	58214	8615	10269	+	gi|528476637:29857558-29915771	58214	1488	3170	1320	1753	0	NM:i:433	ms:i:1012	AS:i:1018	nn:i:0	tp:A:S	cm:i:12	s1:i:120	de:f:0.1961	rl:i:25	cg:Z:11M2D45M1D260M1I153M1I3M1D7M1D12M3I41M14I4M6I78M3D6M5D3M7D55M5D2M2D21M1I26M2I2M6I11M1D6M2D5M2I11M4D8M1I4M1I8M4D59M3D12M1I6M1I17M2D8M1I5M2I38M2I47M2D15M26D22M1D7M1I75M2I1M5I22M1D5M1D6M1D3M3I20M1D115M1I44M5D3M1I1M1I17M1I41M1I2M2D7M1D3M1I36M2I6M7D3M3D63M1I3M5I37M3D2M2D9M1I41M
+gi|528476637:29857558-29915771	58214	39969	41686	+	gi|528476637:29857558-29915771	58214	8615	10266	1323	1759	0	NM:i:436	ms:i:974	AS:i:981	nn:i:0	tp:A:S	cm:i:11	s1:i:113	de:f:0.2059	rl:i:25	cg:Z:11M2I12M1D32M1I131M1I1M5I6M1I202M2D69M4I9M1I2M3I15M3D162M15I32M1I5M6I31M1D26M2D1M4D14M1I6M2I5M2D11M4I8M1D4M1D8M4I55M3I23M1D17M2I54M2D4M1D3M1I43M1I23M27I1M1D51M5D1M1D33M2D1M2D6M3D55M2I6M1D38M1I4M1D24M1I5M1D74M1I6M1D2M1I1M1I61M2I49M1I7M5I3M3I63M1D3M1D41M3I2M2I9M1D38M
+gi|528476637:29857558-29915771	58214	8615	10266	+	gi|528476637:29857558-29915771	58214	39969	41686	1323	1759	0	NM:i:436	ms:i:974	AS:i:981	nn:i:0	tp:A:S	cm:i:11	s1:i:113	de:f:0.2059	rl:i:25	cg:Z:11M2D12M1I32M1D131M1D1M5D6M1D202M2I69M4D9M1D2M3D15M3I162M15D32M1D5M6D31M1I26M2I1M4I14M1D6M2D5M2I11M4D8M1I4M1I8M4D55M3D23M1I17M2D54M2I4M1I3M1D43M1D23M27D1M1I51M5I1M1I33M2I1M2I6M3I55M2D6M1I39M1I3M1D24M1D5M1I74M1D6M1I2M1D1M1D61M2D49M1D7M5D3M3D63M1I3M1I41M3D2M2D9M1I38M
+gi|528476637:29857558-29915771	58214	8636	10269	+	gi|568815454:1200216-1203631	3416	1488	3158	1295	1726	0	NM:i:431	ms:i:964	AS:i:970	nn:i:0	tp:A:S	cm:i:10	s1:i:118	de:f:0.2041	rl:i:25	cg:Z:35M1D414M1I3M1D7M1D12M3I44M20I84M3D2M2D2M10D42M1I3M1D9M3D2M4D21M1I30M6I7M1D3M2D11M1I1M1I11M4D8M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I38M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D71M2D47M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|528476637:29857558-29915771	58214	8636	10269	+	gi|568815529:1421891-1425306	3416	1488	3158	1295	1726	0	NM:i:431	ms:i:964	AS:i:970	nn:i:0	tp:A:S	cm:i:10	s1:i:118	de:f:0.2041	rl:i:25	cg:Z:35M1D414M1I3M1D7M1D12M3I44M20I84M3D2M2D2M10D42M1I3M1D9M3D2M4D21M1I30M6I7M1D3M2D11M1I1M1I11M4D8M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I38M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D71M2D47M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|528476637:29857558-29915771	58214	8636	10269	+	gi|568815592:29942469-29945883	3415	1487	3157	1291	1726	0	NM:i:435	ms:i:944	AS:i:950	nn:i:0	tp:A:S	cm:i:9	s1:i:103	de:f:0.2060	rl:i:25	cg:Z:35M1D414M1I3M1D7M1D12M3I44M20I84M3D2M2D2M10D42M1I3M1D9M3D2M4D21M1I30M6I7M1D3M2D11M2I12M4D8M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I38M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D71M2D47M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|528476637:29857558-29915771	58214	30702	31515	+	gi|528476637:29857558-29915771	58214	45466	46301	718	857	0	NM:i:139	ms:i:940	AS:i:952	nn:i:0	tp:A:S	cm:i:50	s1:i:326	de:f:0.1125	rl:i:25	cg:Z:36M2D6M1I4M3I8M3D14M2I4M1I10M2I15M1I27M1I80M1I63M1I128M32D197M7I1M2I3M1D15M2D1M1D138M3D41M
+gi|528476637:29857558-29915771	58214	45466	46301	+	gi|528476637:29857558-29915771	58214	30702	31515	718	857	0	NM:i:139	ms:i:940	AS:i:952	nn:i:0	tp:A:S	cm:i:50	s1:i:326	de:f:0.1125	rl:i:25	cg:Z:36M2I6M1D4M3D8M3I14M2D4M1D10M2D15M1D27M1D80M1D63M1D128M32I197M7D1M2D3M1I15M2I1M1I138M3I41M
+gi|528476637:29857558-29915771	58214	8629	10269	+	gi|568815564:1286641-1289973	3333	1410	3080	1286	1731	0	NM:i:445	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2115	rl:i:25	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D2M6D1M2D58M3D2M3D21M1I30M6I11M1D6M1I4M3I13M3D10M1D2M2D7M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|528476637:29857558-29915771	58214	8629	10269	+	gi|568815551:1197321-1201446	4126	2203	3873	1286	1731	0	NM:i:445	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2115	rl:i:25	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D2M6D1M2D58M3D2M3D21M1I30M6I11M1D6M1I4M3I13M3D10M1D2M2D7M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|528476637:29857558-29915771	58214	8629	10269	+	gi|528476637:29857558-29915771	58214	56286	57956	1286	1731	0	NM:i:445	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2115	rl:i:25	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D2M6D1M2D58M3D2M3D21M1I30M6I11M1D6M1I4M3I13M3D10M1D2M2D7M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|528476637:29857558-29915771	58214	56286	57956	+	gi|528476637:29857558-29915771	58214	8629	10269	1286	1732	0	NM:i:446	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2110	rl:i:25	cg:Z:42M1I414M1D3M1I7M1I12M3D21M1D2M2D18M20D78M12I3M2I1M2I2M1D58M3I2M3I21M1D30M6D11M1I6M1D4M3D13M3I10M1I2M2I7M4I60M3I11M1D6M1D17M2I8M1D5M2D8M2D2M1D25M2D4M1D3M1I39M2I15M26I105M2D1M5D59M1I108M1I2M1D47M2I69M2I49M1D6M7I3M3I40M2I3M1D19M1D7M1D37M3I12M1I41M
+gi|528476637:29857558-29915771	58214	8629	10269	+	gi|568815561:1196951-1200436	3486	1561	3233	1285	1737	0	NM:i:452	ms:i:874	AS:i:880	nn:i:0	tp:A:S	cm:i:10	s1:i:116	de:f:0.2107	rl:i:25	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I78M14D4M2D2M1I48M2D10M3D2M3D21M1I30M6I11M1D6M2D7M4I4M1I3M7D7M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|528476637:29857558-29915771	58214	8629	10269	+	gi|568815567:1196244-1200852	4609	2686	4356	1284	1732	0	NM:i:448	ms:i:868	AS:i:874	nn:i:0	tp:A:S	cm:i:9	s1:i:100	de:f:0.2132	rl:i:25	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D2M3D1M5D58M3D2M3D21M1I30M6I11M1D6M2D7M4I4M1I3M1D1M1D11M1D2M2D7M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|528476637:29857558-29915771	58214	8629	10269	+	gi|568815569:1240288-1243708	3421	1496	3168	1284	1736	0	NM:i:452	ms:i:868	AS:i:874	nn:i:0	tp:A:S	cm:i:10	s1:i:116	de:f:0.2118	rl:i:25	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D3M8D48M2D10M3D2M3D21M1I30M6I11M1D6M2D7M4I4M1I3M7D7M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|528476637:29857558-29915771	58214	27052	28249	+	gi|528476637:29857558-29915771	58214	4739	5908	925	1206	0	NM:i:281	ms:i:726	AS:i:726	nn:i:0	tp:A:S	cm:i:8	s1:i:95	de:f:0.2181	rl:i:25	cg:Z:100M1D5M1I139M7I13M1I133M7I80M1D58M1I6M1D70M1I31M2D5M1I15M1I3M1I16M1I3M1D168M9I2M1I48M2I113M2D73M1I5M1D15M1I23M1I36M
+gi|528476637:29857558-29915771	58214	4739	5908	+	gi|528476637:29857558-29915771	58214	27052	28249	925	1207	0	NM:i:282	ms:i:726	AS:i:726	nn:i:0	tp:A:S	cm:i:8	s1:i:95	de:f:0.2174	rl:i:25	cg:Z:100M1I5M1D139M7D13M1D133M7D80M1I58M1D6M1I70M1D31M2I5M1D15M1D3M1D17M1I2M1D168M9D2M1D48M2D113M2I73M2I4M2D15M1D23M1D36M
+gi|528476637:29857558-29915771	58214	44457	44873	+	gi|568815569:1240288-1243708	3421	885	1301	398	416	0	NM:i:18	ms:i:724	AS:i:724	nn:i:0	tp:A:S	cm:i:39	s1:i:284	de:f:0.0433	rl:i:25	cg:Z:416M
+gi|528476637:29857558-29915771	58214	44457	44873	+	gi|568815567:1196244-1200852	4609	2075	2491	398	416	0	NM:i:18	ms:i:724	AS:i:724	nn:i:0	tp:A:S	cm:i:39	s1:i:295	de:f:0.0433	rl:i:25	cg:Z:416M
+gi|528476637:29857558-29915771	58214	44457	44873	+	gi|568815592:29942469-29945883	3415	891	1306	398	416	0	NM:i:18	ms:i:722	AS:i:722	nn:i:0	tp:A:S	cm:i:42	s1:i:282	de:f:0.0433	rl:i:25	cg:Z:321M1I94M
+gi|528476637:29857558-29915771	58214	44457	44873	+	gi|568815561:1196951-1200436	3486	950	1366	397	416	0	NM:i:19	ms:i:718	AS:i:718	nn:i:0	tp:A:S	cm:i:36	s1:i:274	de:f:0.0457	rl:i:25	cg:Z:416M
+gi|528476637:29857558-29915771	58214	55675	56091	+	gi|528476637:29857558-29915771	58214	44457	44873	396	416	0	NM:i:20	ms:i:712	AS:i:712	nn:i:0	tp:A:S	cm:i:37	s1:i:254	de:f:0.0481	rl:i:25	cg:Z:416M
+gi|528476637:29857558-29915771	58214	44457	44873	+	gi|568815551:1197321-1201446	4126	1592	2008	396	416	0	NM:i:20	ms:i:712	AS:i:712	nn:i:0	tp:A:S	cm:i:37	s1:i:254	de:f:0.0481	rl:i:25	cg:Z:416M
+gi|528476637:29857558-29915771	58214	44457	44873	+	gi|568815564:1286641-1289973	3333	799	1215	396	416	0	NM:i:20	ms:i:712	AS:i:712	nn:i:0	tp:A:S	cm:i:37	s1:i:254	de:f:0.0481	rl:i:25	cg:Z:416M
+gi|528476637:29857558-29915771	58214	44457	44873	+	gi|528476637:29857558-29915771	58214	55675	56091	396	416	0	NM:i:20	ms:i:712	AS:i:712	nn:i:0	tp:A:S	cm:i:37	s1:i:254	de:f:0.0481	rl:i:25	cg:Z:416M
+gi|528476637:29857558-29915771	58214	44457	44873	+	gi|568815454:1200216-1203631	3416	891	1307	392	416	0	NM:i:24	ms:i:688	AS:i:688	nn:i:0	tp:A:S	cm:i:36	s1:i:238	de:f:0.0577	rl:i:25	cg:Z:416M
+gi|528476637:29857558-29915771	58214	44457	44873	+	gi|568815529:1421891-1425306	3416	891	1307	392	416	0	NM:i:24	ms:i:688	AS:i:688	nn:i:0	tp:A:S	cm:i:36	s1:i:238	de:f:0.0577	rl:i:25	cg:Z:416M
+gi|528476637:29857558-29915771	58214	886	1289	+	gi|528476637:29857558-29915771	58214	44457	44872	368	415	0	NM:i:47	ms:i:568	AS:i:568	nn:i:0	tp:A:S	cm:i:17	s1:i:133	de:f:0.0891	rl:i:25	cg:Z:324M12D79M
+gi|528476637:29857558-29915771	58214	44457	44872	+	gi|528476637:29857558-29915771	58214	886	1289	368	415	0	NM:i:47	ms:i:568	AS:i:568	nn:i:0	tp:A:S	cm:i:17	s1:i:133	de:f:0.0891	rl:i:25	cg:Z:324M12I79M
+gi|528476637:29857558-29915771	58214	44457	44872	+	gi|528476637:29857558-29915771	58214	39378	39792	361	418	0	NM:i:57	ms:i:496	AS:i:496	nn:i:0	tp:A:S	cm:i:7	s1:i:93	de:f:0.1280	rl:i:25	cg:Z:85M3I4M3D48M1I274M
+gi|528476637:29857558-29915771	58214	39378	39792	+	gi|528476637:29857558-29915771	58214	44457	44872	361	418	0	NM:i:57	ms:i:496	AS:i:496	nn:i:0	tp:A:S	cm:i:7	s1:i:93	de:f:0.1280	rl:i:25	cg:Z:85M3D4M3I48M1D274M
+gi|528476637:29857558-29915771	58214	49208	49824	+	gi|528476637:29857558-29915771	58214	7043	7661	489	643	0	NM:i:154	ms:i:370	AS:i:370	nn:i:0	tp:A:S	cm:i:5	s1:i:47	de:f:0.2049	rl:i:25	cg:Z:26M4I20M1D64M2I7M1D1M1D39M9D5M2D5M4D75M2I8M1D4M2I25M1I11M1D5M1D2M2I4M1D4M1D7M5I7M1I133M1I49M1I29M4I5M3D3M1D53M
+gi|528476637:29857558-29915771	58214	7043	7661	+	gi|528476637:29857558-29915771	58214	49208	49824	489	643	0	NM:i:154	ms:i:370	AS:i:370	nn:i:0	tp:A:S	cm:i:5	s1:i:47	de:f:0.2049	rl:i:25	cg:Z:26M4D20M1I64M2D7M1I1M1I39M9I5M2I5M4I75M2D8M1I4M2D25M1D11M1I5M1I2M2D4M1I4M1I7M5D7M1D133M1D49M1D29M4D5M3I3M1I53M
+gi|528476637:29857558-29915771	58214	29092	29357	-	gi|528476637:29857558-29915771	58214	28378	28643	236	265	0	NM:i:29	ms:i:356	AS:i:356	nn:i:0	tp:A:S	cm:i:4	s1:i:46	de:f:0.1094	zd:i:1	rl:i:25	cg:Z:265M
+gi|528476637:29857558-29915771	58214	28378	28643	-	gi|528476637:29857558-29915771	58214	29092	29357	236	265	31	NM:i:29	ms:i:356	AS:i:356	nn:i:0	tp:A:P	cm:i:4	s1:i:46	s2:i:0	de:f:0.1094	zd:i:2	rl:i:25	cg:Z:265M
+gi|528476637:29857558-29915771	58214	45137	45465	-	gi|528476637:29857558-29915771	58214	14421	14731	269	329	0	NM:i:60	ms:i:318	AS:i:318	nn:i:0	tp:A:S	cm:i:3	s1:i:42	de:f:0.1433	rl:i:25	cg:Z:35M1D115M1I2M14I113M1I28M3I16M
+gi|528476637:29857558-29915771	58214	14421	14731	-	gi|528476637:29857558-29915771	58214	45137	45465	269	329	0	NM:i:60	ms:i:318	AS:i:318	nn:i:0	tp:A:S	cm:i:3	s1:i:42	de:f:0.1433	rl:i:25	cg:Z:14M3D30M1D113M14D2M1D114M1I36M
+gi|528476637:29857558-29915771	58214	6307	7004	-	gi|528476637:29857558-29915771	58214	6307	7004	528	727	0	NM:i:199	ms:i:272	AS:i:272	nn:i:0	tp:A:S	cm:i:4	s1:i:44	de:f:0.2392	rl:i:25	cg:Z:11M1D155M1I43M2D64M2I1M1I6M3I5M2I1M2I6M1D9M2I3M3D6M8I5M1I8M1I5M1I10M1D5M1D5M1D8M8D5M3I4M2D3M2D13M2D7M5D70M2I43M1D154M1I12M
+gi|528476637:29857558-29915771	58214	8056	8300	+	gi|528476637:29857558-29915771	58214	8056	8376	225	321	0	NM:i:96	ms:i:258	AS:i:271	nn:i:0	tp:A:S	cm:i:7	s1:i:51	de:f:0.0816	rl:i:25	cg:Z:129M77D89M1I25M
+gi|528476637:29857558-29915771	58214	8056	8376	+	gi|528476637:29857558-29915771	58214	8056	8300	225	321	0	NM:i:96	ms:i:258	AS:i:271	nn:i:0	tp:A:S	cm:i:7	s1:i:51	de:f:0.0816	rl:i:25	cg:Z:129M77I89M1D25M
+gi|528476637:29857558-29915771	58214	17754	17858	+	gi|528476637:29857558-29915771	58214	17845	17947	98	104	0	NM:i:6	ms:i:172	AS:i:172	nn:i:0	tp:A:S	cm:i:8	s1:i:52	de:f:0.0485	rl:i:25	cg:Z:13M2I89M
+gi|528476637:29857558-29915771	58214	17845	17947	+	gi|528476637:29857558-29915771	58214	17754	17858	98	104	0	NM:i:6	ms:i:172	AS:i:172	nn:i:0	tp:A:S	cm:i:8	s1:i:52	de:f:0.0485	rl:i:25	cg:Z:13M2D89M
+gi|157734152:29655295-29712160	56866	0	46508	+	gi|528476637:29857558-29915771	58214	0	46366	45990	46508	0	NM:i:603	ms:i:90335	AS:i:90495	nn:i:85	tp:A:S	cm:i:7995	s1:i:44368	de:f:0.0051	rl:i:96	cg:Z:412M1D2M1I907M4D23M18D6334M7I858M94I3086M37D2996M9D806M2D2326M89I5050M1D4412M2I3477M4D393M1D344M2I610M4I1397M1D4480M1I2166M2D10M2D209M2I678M2I1528M1D21M2I2527M2D17M1I7M2I1114M18I91M
+gi|157734152:29655295-29712160	56866	12900	22956	+	gi|528476637:29857558-29915771	58214	12858	22836	9939	10067	0	NM:i:128	ms:i:19554	AS:i:19623	nn:i:0	tp:A:S	cm:i:5	s1:i:51	de:f:0.0031	rl:i:96	cg:Z:1820M9D806M2D2415M89I4926M
+gi|157734152:29655295-29712160	56866	47082	56866	+	gi|528476637:29857558-29915771	58214	48429	58214	9630	9801	0	NM:i:171	ms:i:18606	AS:i:18606	nn:i:0	tp:A:S	cm:i:1505	s1:i:8643	de:f:0.0150	rl:i:96	cg:Z:179M2D335M1D587M2D3229M2I161M13I113M1I180M8D563M1D518M3D3903M
+gi|157734152:29655295-29712160	56866	48470	56866	+	gi|528476637:29857558-29915771	58214	33375	41952	7179	8982	60	NM:i:1803	ms:i:8784	AS:i:9498	nn:i:0	tp:A:P	cm:i:223	s1:i:1956	s2:i:0	de:f:0.1112	zd:i:2	rl:i:96	cg:Z:24M4I11M3D103M2D43M2D32M3I51M1I139M5I1M1I573M3D3M2D49M1I3M1I13M2I5M1D189M1I36M17I448M1D3M1I215M3D35M4D263M8D23M1I91M1I279M1D133M325I52M4D50M1I175M6D3M359D48M1I379M1D54M1D84M3D21M1D6M90D168M1D72M2I2M1I236M1I10M1I48M19D109M4I346M1D52M1I123M2I1M1D254M1I5M1D11M1I21M1D12M4I3M1D2M1D4M2D57M2D3M1D32M3D40M1D62M1I25M1D277M1I311M3I2M1I14M1D148M1I170M7D207M2I66M2D5M6D2M1I39M3D10M20D173M1D189M1D41M3D8M3D79M1I103M6I96M1D6M1I117M1D2M1I208M1I132M2D26M4D60M1I165M
+gi|157734152:29655295-29712160	56866	33497	42074	+	gi|528476637:29857558-29915771	58214	49822	58214	7174	8964	0	NM:i:1790	ms:i:8766	AS:i:9456	nn:i:0	tp:A:S	cm:i:227	s1:i:2051	de:f:0.1132	rl:i:96	cg:Z:24M4D11M3I103M1I43M2I32M3D51M1D139M5D1M1D573M3I3M2I49M1D3M1D13M2D5M1I189M1D36M17D448M1I3M1D215M3I35M4I263M8I23M1D91M1D279M1I137M310D48M4I225M6I3M1D3M350I6M2I46M1D379M1I54M1I85M2I21M1I6M90I167M1I74M1D1M2D247M4D48M19I109M4D346M1I52M1D125M1D271M1D21M1I12M4D3M1I2M1I4M2I57M2I3M1I32M3I40M1I62M1D25M1I277M1D307M4D20M1I148M1D172M2I2M1I271M1I3M1I2M1I2M4I40M3I10M20I173M1I189M1I41M3I8M3I79M1D17M1D3M1I9M1I1M1I72M6D96M1I6M1D328M1D132M2I26M4I60M1D165M
+gi|157734152:29655295-29712160	56866	33497	42074	+	gi|157734152:29655295-29712160	56866	48470	56866	7171	8978	60	NM:i:1807	ms:i:8732	AS:i:9446	nn:i:0	tp:A:P	cm:i:226	s1:i:1962	s2:i:0	de:f:0.1127	zd:i:2	rl:i:96	cg:Z:24M4D11M3I103M1I43M2I32M3D51M1D139M5D1M1D573M3I3M2I49M1D3M1D13M2D5M1I189M1D36M17D448M1I3M1D215M3I35M4I263M8I23M1D91M1D279M1I133M325D52M4I50M1D175M6I3M359I48M1D379M1I54M1I84M3I21M1I6M90I168M1I72M2D2M1D236M1D59M19I109M4D346M1I52M1D123M1I1M2D254M1D5M1I11M1D21M1I12M4D3M1I2M1I4M2I57M2I3M1I32M3I40M1I62M1D25M1I277M1D307M4D20M1I148M1D172M2I2M1I271M1I3M1I2M1I2M4I40M3I10M20I173M1I189M1I41M3I8M3I79M1D30M1I1M1I72M6D96M1I6M1D116M1I3M1D208M1D132M2I26M4I60M1D165M
+gi|157734152:29655295-29712160	56866	48470	56866	+	gi|157734152:29655295-29712160	56866	33497	42074	7171	8978	60	NM:i:1807	ms:i:8732	AS:i:9446	nn:i:0	tp:A:P	cm:i:226	s1:i:1962	s2:i:0	de:f:0.1127	zd:i:2	rl:i:96	cg:Z:24M4I11M3D103M1D43M2D32M3I51M1I139M5I1M1I573M3D3M2D49M1I3M1I13M2I5M1D189M1I36M17I448M1D3M1I215M3D35M4D263M8D23M1I91M1I279M1D133M325I52M4D50M1I175M6D3M359D48M1I379M1D54M1D84M3D21M1D6M90D168M1D72M2I2M1I236M1I59M19D109M4I346M1D52M1I123M2I1M1D254M1I5M1D11M1I21M1D12M4I3M1D2M1D4M2D57M2D3M1D32M3D40M1D62M1I25M1D277M1I307M4I20M1D148M1I172M2D2M1D271M1D3M1D2M1D2M4D40M3D10M20D173M1D189M1D41M3D8M3D79M1I30M1D1M1D72M6I96M1D6M1I116M1D3M1I208M1I132M2D26M4D60M1I165M
+gi|157734152:29655295-29712160	56866	52256	56861	+	gi|568815567:1196244-1200852	4609	0	4609	4503	4609	0	NM:i:106	ms:i:8582	AS:i:8582	nn:i:0	tp:A:S	cm:i:628	s1:i:3840	de:f:0.0226	rl:i:96	cg:Z:189M1D518M3D3898M
+gi|157734152:29655295-29712160	56866	52738	56861	+	gi|568815551:1197321-1201446	4126	0	4126	4100	4126	0	NM:i:26	ms:i:8098	AS:i:8098	nn:i:0	tp:A:S	cm:i:722	s1:i:3930	de:f:0.0058	rl:i:96	cg:Z:225M3D3898M
+gi|157734152:29655295-29712160	56866	53528	56861	+	gi|568815564:1286641-1289973	3333	0	3333	3317	3333	0	NM:i:16	ms:i:6570	AS:i:6570	nn:i:0	tp:A:S	cm:i:585	s1:i:3212	de:f:0.0048	rl:i:96	cg:Z:3333M
+gi|157734152:29655295-29712160	56866	53376	56861	+	gi|568815561:1196951-1200436	3486	0	3486	3397	3487	0	NM:i:90	ms:i:6432	AS:i:6432	nn:i:0	tp:A:S	cm:i:442	s1:i:2777	de:f:0.0255	rl:i:96	cg:Z:235M1I1996M2D1253M
+gi|157734152:29655295-29712160	56866	53441	56861	+	gi|568815569:1240288-1243708	3421	0	3421	3331	3422	0	NM:i:91	ms:i:6296	AS:i:6296	nn:i:0	tp:A:S	cm:i:441	s1:i:2741	de:f:0.0263	rl:i:96	cg:Z:170M1I1996M2D1253M
+gi|157734152:29655295-29712160	56866	53436	56866	+	gi|342187237:5004-8419	3416	0	3416	3310	3437	0	NM:i:127	ms:i:6144	AS:i:6144	nn:i:0	tp:A:S	cm:i:427	s1:i:2612	de:f:0.0307	rl:i:96	cg:Z:1343M3I1M1I144M17I495M3D183M1D238M3D1005M
+gi|157734152:29655295-29712160	56866	53436	56866	+	gi|568815454:1200216-1203631	3416	0	3416	3310	3437	0	NM:i:127	ms:i:6144	AS:i:6144	nn:i:0	tp:A:S	cm:i:427	s1:i:2612	de:f:0.0307	rl:i:96	cg:Z:1343M3I1M1I144M17I495M3D183M1D238M3D1005M
+gi|157734152:29655295-29712160	56866	53436	56866	+	gi|568815529:1421891-1425306	3416	0	3416	3310	3437	0	NM:i:127	ms:i:6144	AS:i:6144	nn:i:0	tp:A:S	cm:i:427	s1:i:2612	de:f:0.0307	rl:i:96	cg:Z:1343M3I1M1I144M17I495M3D183M1D238M3D1005M
+gi|157734152:29655295-29712160	56866	53436	56866	+	gi|568815592:29942469-29945883	3415	0	3415	3305	3437	0	NM:i:132	ms:i:6112	AS:i:6112	nn:i:0	tp:A:S	cm:i:396	s1:i:2527	de:f:0.0322	rl:i:96	cg:Z:1212M1I130M3I1M1I144M17I495M3D183M1D238M3D1005M
+gi|157734152:29655295-29712160	56866	37319	42069	+	gi|568815567:1196244-1200852	4609	4	4609	4082	4789	0	NM:i:707	ms:i:5566	AS:i:5636	nn:i:0	tp:A:S	cm:i:119	s1:i:1112	de:f:0.1165	rl:i:96	cg:Z:48M1I54M1I85M2I21M1I6M90I167M1I74M1D1M2D247M4D48M19I109M4D346M1I52M1D125M1D271M1D21M1I12M4D3M1I2M1I4M2I59M3I33M3I40M1I62M1D25M1I217M3D9M3I48M1D307M4D20M1I148M1D169M3I276M1I3M1I2M1I2M4I40M3I10M20I173M1I189M1I41M3I8M3I79M1D17M1D3M1I9M1I1M1I72M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|157734152:29655295-29712160	56866	43615	46576	+	gi|157734152:29655295-29712160	56866	43615	46614	2915	3042	0	NM:i:127	ms:i:5546	AS:i:5600	nn:i:0	tp:A:S	cm:i:16	s1:i:120	de:f:0.0031	rl:i:96	cg:Z:1340M41D41I1438M32D17M6D6M2D100M2I17M
+gi|157734152:29655295-29712160	56866	43615	46614	+	gi|157734152:29655295-29712160	56866	43615	46576	2915	3042	0	NM:i:127	ms:i:5546	AS:i:5600	nn:i:0	tp:A:S	cm:i:16	s1:i:120	de:f:0.0031	rl:i:96	cg:Z:1340M41I41D1438M32I17M6I6M2I100M2D17M
+gi|157734152:29655295-29712160	56866	0	3406	+	gi|528476637:29857558-29915771	58214	54784	58214	3161	3445	0	NM:i:284	ms:i:5194	AS:i:5194	nn:i:0	tp:A:S	cm:i:208	s1:i:1674	de:f:0.0746	rl:i:96	cg:Z:185M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D112M4D20M1I442M1D198M3I184M1I47M2D188M3I398M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|157734152:29655295-29712160	56866	0	3401	+	gi|568815567:1196244-1200852	4609	1184	4609	3157	3441	0	NM:i:284	ms:i:5182	AS:i:5182	nn:i:0	tp:A:S	cm:i:194	s1:i:1592	de:f:0.0747	rl:i:96	cg:Z:185M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D112M4D20M1I442M1D198M3I184M1I47M2D188M3I398M1D40M1I33M1D37M1D11M1D3M1I33M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|157734152:29655295-29712160	56866	5	3401	+	gi|568815569:1240288-1243708	3421	0	3421	3152	3439	0	NM:i:287	ms:i:5158	AS:i:5158	nn:i:0	tp:A:S	cm:i:196	s1:i:1628	de:f:0.0751	rl:i:96	cg:Z:167M1D2M2I9M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D112M4D20M1I442M1D198M3I168M2D16M1I47M2D188M3I398M1D40M1I33M1D37M1D11M1D3M1I33M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|157734152:29655295-29712160	56866	0	3406	+	gi|568815529:1421891-1425306	3416	0	3416	3143	3441	0	NM:i:298	ms:i:5126	AS:i:5126	nn:i:0	tp:A:S	cm:i:206	s1:i:1579	de:f:0.0764	rl:i:96	cg:Z:185M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D132M1I129M17I296M1D433M2D589M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|157734152:29655295-29712160	56866	0	3406	+	gi|342187237:5004-8419	3416	0	3416	3143	3441	0	NM:i:298	ms:i:5126	AS:i:5126	nn:i:0	tp:A:S	cm:i:206	s1:i:1579	de:f:0.0764	rl:i:96	cg:Z:185M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D132M1I129M17I296M1D433M2D589M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|157734152:29655295-29712160	56866	0	3406	+	gi|568815454:1200216-1203631	3416	0	3416	3143	3441	0	NM:i:298	ms:i:5126	AS:i:5126	nn:i:0	tp:A:S	cm:i:206	s1:i:1579	de:f:0.0764	rl:i:96	cg:Z:185M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D132M1I129M17I296M1D433M2D589M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|157734152:29655295-29712160	56866	37891	42069	+	gi|568815551:1197321-1201446	4126	0	4126	3654	4213	0	NM:i:559	ms:i:5120	AS:i:5120	nn:i:0	tp:A:S	cm:i:117	s1:i:1076	de:f:0.1174	rl:i:96	cg:Z:227M4D48M19I109M4D346M1I52M1D123M1I1M2D254M1D5M1I11M1D21M1I12M4D3M1I2M1I4M2I57M2I3M1I32M3I40M1I62M1D25M1I277M1D307M4D20M1I148M1D172M2I2M1I271M1I3M1I2M1I2M4I40M3I10M20I173M1I189M1I41M3I8M3I79M1D17M1D3M1I9M1I1M1I72M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|157734152:29655295-29712160	56866	0	3401	+	gi|568815561:1196951-1200436	3486	60	3486	3149	3444	0	NM:i:295	ms:i:5120	AS:i:5120	nn:i:0	tp:A:S	cm:i:189	s1:i:1603	de:f:0.0774	rl:i:96	cg:Z:172M1D2M2I9M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D112M4D20M1I442M1D198M3I168M2D16M1I47M2D188M3I398M1D40M1I33M1D37M1D11M1D3M1I33M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|157734152:29655295-29712160	56866	0	3406	+	gi|568815592:29942469-29945883	3415	0	3415	3142	3440	0	NM:i:298	ms:i:5118	AS:i:5118	nn:i:0	tp:A:S	cm:i:207	s1:i:1610	de:f:0.0770	rl:i:96	cg:Z:185M2D2M4D289M1D5M1I108M3I13M1D118M1D485M10D1M1D132M1I129M17I296M1D433M2D589M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|157734152:29655295-29712160	56866	0	3401	+	gi|568815551:1197321-1201446	4126	701	4126	3142	3440	0	NM:i:298	ms:i:5100	AS:i:5100	nn:i:0	tp:A:S	cm:i:198	s1:i:1597	de:f:0.0789	rl:i:96	cg:Z:185M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D112M4D20M1I442M1D198M3I184M1I47M2D188M3I398M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|157734152:29655295-29712160	56866	53436	56866	+	gi|157734152:29655295-29712160	56866	0	3406	3142	3445	0	NM:i:303	ms:i:5080	AS:i:5080	nn:i:0	tp:A:S	cm:i:193	s1:i:1577	de:f:0.0802	rl:i:96	cg:Z:185M2I2M4I289M1I5M1D108M3D13M1I118M1I486M12I112M4I20M1D442M1I198M3D184M1D47M2I188M3D398M1I40M1D33M1I37M1I48M1I57M1D1M2I31M4I96M1D88M1I165M
+gi|157734152:29655295-29712160	56866	0	3406	+	gi|157734152:29655295-29712160	56866	53436	56866	3142	3445	0	NM:i:303	ms:i:5080	AS:i:5080	nn:i:0	tp:A:S	cm:i:193	s1:i:1577	de:f:0.0802	rl:i:96	cg:Z:185M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D112M4D20M1I442M1D198M3I184M1I47M2D188M3I398M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D165M
+gi|157734152:29655295-29712160	56866	53436	56866	+	gi|528476637:29857558-29915771	58214	0	3428	3137	3464	0	NM:i:327	ms:i:5002	AS:i:5002	nn:i:0	tp:A:S	cm:i:191	s1:i:1549	de:f:0.0827	rl:i:96	cg:Z:185M2I2M4I225M1D2M1I61M1I5M1D108M3D13M1I118M1I486M12I138M19D440M1I198M3D184M1D47M2I188M3D398M1I40M1D33M1I37M1I48M1I57M1D1M2I31M4I96M1D88M1I165M
+gi|157734152:29655295-29712160	56866	92	3401	+	gi|568815564:1286641-1289973	3333	0	3333	3058	3348	0	NM:i:290	ms:i:4964	AS:i:4964	nn:i:0	tp:A:S	cm:i:193	s1:i:1559	de:f:0.0786	rl:i:96	cg:Z:93M2D2M4D289M1D5M1I108M3I13M1D118M1D486M12D112M4D20M1I442M1D198M3I184M1I47M2D188M3I398M1D40M1I33M1D37M1D48M1D57M1I1M2D31M4D96M1I88M1D160M
+gi|157734152:29655295-29712160	56866	3	3539	+	gi|528476637:29857558-29915771	58214	38484	42085	3172	3624	0	NM:i:452	ms:i:4586	AS:i:4586	nn:i:0	tp:A:S	cm:i:136	s1:i:1127	de:f:0.1080	rl:i:96	cg:Z:34M1D52M1I95M2D2M4D22M1I272M1I19M1D104M1D9M3D47M1D87M1D222M5I3M5D47M1I106M1I7M2D2M1I68M12D279M1I164M5D6M2D120M1D86M2I74M7D58M14D6M5D1M1D209M2D139M1D42M2D1M1D88M1I103M6I96M1D6M1I106M1D40M1I33M1D37M1D52M1D84M4D101M1D26M4D358M
+gi|157734152:29655295-29712160	56866	38606	42207	+	gi|157734152:29655295-29712160	56866	3	3539	3166	3622	0	NM:i:456	ms:i:4550	AS:i:4550	nn:i:0	tp:A:S	cm:i:135	s1:i:1116	de:f:0.1102	rl:i:96	cg:Z:34M1I52M1D95M2I2M4I22M1D272M1D19M1I104M1I9M3I47M1I87M1I222M5D3M5I47M1D106M1D7M2I2M1D68M12I279M1D169M3I121M1I162M7I58M14I6M5I1M1I209M2I139M1I42M2I1M1I88M1D30M1I1M1I72M6D96M1I6M1D106M1I40M1D33M1I37M1I52M1I85M4I100M1I26M4I358M
+gi|157734152:29655295-29712160	56866	3	3539	+	gi|157734152:29655295-29712160	56866	38606	42207	3166	3622	0	NM:i:456	ms:i:4550	AS:i:4550	nn:i:0	tp:A:S	cm:i:135	s1:i:1116	de:f:0.1102	rl:i:96	cg:Z:34M1D52M1I95M2D2M4D22M1I272M1I19M1D104M1D9M3D47M1D87M1D222M5I3M5D47M1I106M1I7M2D2M1I68M12D279M1I169M3D121M1D162M7D58M14D6M5D1M1D209M2D139M1D42M2D1M1D88M1I30M1D1M1D72M6I96M1D6M1I106M1D40M1I33M1D37M1D52M1D85M4D100M1D26M4D358M
+gi|157734152:29655295-29712160	56866	38606	42207	+	gi|528476637:29857558-29915771	58214	3	3561	3162	3640	0	NM:i:478	ms:i:4470	AS:i:4470	nn:i:0	tp:A:S	cm:i:132	s1:i:1092	de:f:0.1130	rl:i:96	cg:Z:34M1I52M1D95M2I2M4I22M1D202M1D2M1I67M1D19M1I104M1I9M3I47M1I87M1I277M1D106M1D7M2I2M1D68M12I110M4D26M17D1M1D142M1D169M3I121M1I162M7I58M14I6M5I1M1I209M2I139M1I42M2I1M1I88M1D30M1I1M1I72M6D96M1I6M1D106M1I40M1D33M1I37M1I52M1I85M4I100M1I26M4I358M
+gi|157734152:29655295-29712160	56866	38543	42069	+	gi|568815561:1196951-1200436	3486	0	3486	3089	3554	0	NM:i:465	ms:i:4338	AS:i:4338	nn:i:0	tp:A:S	cm:i:95	s1:i:925	de:f:0.1177	rl:i:96	cg:Z:97M1I52M1D81M1I43M1D255M1D4M1I11M1D21M1I12M4D3M1I2M1I4M2I57M2I3M1I32M3I40M1I62M1D25M1I277M1D307M4D20M1I148M1D169M3I284M7I39M3I10M20I158M2D15M1I189M1I41M3I8M3I79M1D17M1D3M1I9M1I1M1I72M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|157734152:29655295-29712160	56866	38606	42074	+	gi|568815592:29942469-29945883	3415	3	3415	3036	3493	0	NM:i:457	ms:i:4300	AS:i:4300	nn:i:0	tp:A:S	cm:i:112	s1:i:1008	de:f:0.1138	rl:i:96	cg:Z:34M1I52M1D123M1I1M2D255M1D4M1I11M1D21M1I12M4D3M1I2M1I4M2I59M3I33M3I40M1I62M1D25M1I222M3D4M3I48M1D180M1I146M1I132M16I169M3I284M7I52M20I363M1I41M3I90M1D29M2I74M6D96M1I6M1D116M1I3M1D208M1D132M2I26M4I60M1D165M
+gi|157734152:29655295-29712160	56866	38606	42074	+	gi|342187237:5004-8419	3416	3	3416	3034	3491	0	NM:i:457	ms:i:4294	AS:i:4294	nn:i:0	tp:A:S	cm:i:108	s1:i:1013	de:f:0.1147	rl:i:96	cg:Z:34M1I52M1D123M1I1M2D255M1D4M1I11M1D21M1I12M4D3M1I2M1I4M2I59M3I33M3I38M1D3M2I60M1D25M1I277M1D327M1I132M16I169M3I284M7I52M20I363M1I41M3I90M1D29M2I74M6D96M1I6M1D116M1I3M1D208M1D132M2I26M4I60M1D165M
+gi|157734152:29655295-29712160	56866	38606	42074	+	gi|568815454:1200216-1203631	3416	3	3416	3034	3491	0	NM:i:457	ms:i:4294	AS:i:4294	nn:i:0	tp:A:S	cm:i:108	s1:i:1013	de:f:0.1147	rl:i:96	cg:Z:34M1I52M1D123M1I1M2D255M1D4M1I11M1D21M1I12M4D3M1I2M1I4M2I59M3I33M3I38M1D3M2I60M1D25M1I277M1D327M1I132M16I169M3I284M7I52M20I363M1I41M3I90M1D29M2I74M6D96M1I6M1D116M1I3M1D208M1D132M2I26M4I60M1D165M
+gi|157734152:29655295-29712160	56866	38606	42074	+	gi|568815529:1421891-1425306	3416	3	3416	3034	3491	0	NM:i:457	ms:i:4294	AS:i:4294	nn:i:0	tp:A:S	cm:i:108	s1:i:1013	de:f:0.1147	rl:i:96	cg:Z:34M1I52M1D123M1I1M2D255M1D4M1I11M1D21M1I12M4D3M1I2M1I4M2I59M3I33M3I38M1D3M2I60M1D25M1I277M1D327M1I132M16I169M3I284M7I52M20I363M1I41M3I90M1D29M2I74M6D96M1I6M1D116M1I3M1D208M1D132M2I26M4I60M1D165M
+gi|157734152:29655295-29712160	56866	38608	42069	+	gi|568815569:1240288-1243708	3421	0	3421	3034	3485	0	NM:i:451	ms:i:4284	AS:i:4284	nn:i:0	tp:A:S	cm:i:97	s1:i:955	de:f:0.1170	rl:i:96	cg:Z:32M1I52M1D81M1I43M1D255M1D4M1I11M1D21M1I82M2I3M1I32M3I40M1I62M1D25M1I277M1D307M4D20M1I148M1D169M3I284M7I39M3I10M20I158M2D15M1I189M1I41M3I8M3I79M1D17M1D3M1I9M1I1M1I72M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|157734152:29655295-29712160	56866	38697	42069	+	gi|568815564:1286641-1289973	3333	2	3333	2959	3398	0	NM:i:439	ms:i:4172	AS:i:4172	nn:i:0	tp:A:S	cm:i:98	s1:i:923	de:f:0.1165	rl:i:96	cg:Z:119M1I1M2D254M1D5M1I11M1D21M1I12M4D3M1I2M1I4M2I57M2I3M1I32M3I40M1I62M1D25M1I277M1D307M4D20M1I148M1D172M2I2M1I271M1I3M1I2M1I2M4I40M3I10M20I173M1I189M1I41M3I8M3I79M1D17M1D3M1I9M1I1M1I72M6D96M1I6M1D328M1D132M2I26M4I60M1D160M
+gi|157734152:29655295-29712160	56866	3533	4632	+	gi|528476637:29857558-29915771	58214	43020	44118	979	1103	0	NM:i:124	ms:i:1460	AS:i:1460	nn:i:0	tp:A:S	cm:i:27	s1:i:217	de:f:0.1092	rl:i:96	cg:Z:156M1I416M3D62M3I27M1I156M1D277M
+gi|157734152:29655295-29712160	56866	43143	44241	+	gi|528476637:29857558-29915771	58214	3555	4654	977	1103	0	NM:i:126	ms:i:1448	AS:i:1448	nn:i:0	tp:A:S	cm:i:31	s1:i:245	de:f:0.1110	rl:i:96	cg:Z:156M1D416M3I62M3D27M1D156M1I277M
+gi|157734152:29655295-29712160	56866	43143	44241	+	gi|157734152:29655295-29712160	56866	3533	4632	975	1103	0	NM:i:128	ms:i:1436	AS:i:1436	nn:i:0	tp:A:S	cm:i:28	s1:i:232	de:f:0.1128	rl:i:96	cg:Z:156M1D416M3I62M3D27M1D156M1I277M
+gi|157734152:29655295-29712160	56866	3533	4632	+	gi|157734152:29655295-29712160	56866	43143	44241	975	1103	0	NM:i:128	ms:i:1436	AS:i:1436	nn:i:0	tp:A:S	cm:i:28	s1:i:232	de:f:0.1128	rl:i:96	cg:Z:156M1I416M3D62M3I27M1I156M1D277M
+gi|157734152:29655295-29712160	56866	47648	48471	+	gi|528476637:29857558-29915771	58214	31581	32408	734	834	0	NM:i:100	ms:i:1064	AS:i:1064	nn:i:0	tp:A:S	cm:i:19	s1:i:213	de:f:0.1114	rl:i:96	cg:Z:9M2D100M1I166M1I2M1D93M1D142M1D29M6D113M2I3M2I4M1I155M
+gi|157734152:29655295-29712160	56866	31699	32530	+	gi|528476637:29857558-29915771	58214	48998	49823	733	838	0	NM:i:105	ms:i:1046	AS:i:1046	nn:i:0	tp:A:S	cm:i:17	s1:i:193	de:f:0.1147	rl:i:96	cg:Z:9M2I100M1D166M1D2M1I93M1I142M1I31M8I113M1D3M3D4M1D155M
+gi|157734152:29655295-29712160	56866	47648	48471	+	gi|157734152:29655295-29712160	56866	31699	32530	732	838	0	NM:i:106	ms:i:1044	AS:i:1044	nn:i:0	tp:A:S	cm:i:19	s1:i:213	de:f:0.1138	rl:i:96	cg:Z:9M2D100M1I166M1I2M1D93M1D142M1D29M10D113M2I3M2I4M1I155M
+gi|157734152:29655295-29712160	56866	31699	32530	+	gi|157734152:29655295-29712160	56866	47648	48471	732	838	0	NM:i:106	ms:i:1044	AS:i:1044	nn:i:0	tp:A:S	cm:i:19	s1:i:213	de:f:0.1138	rl:i:96	cg:Z:9M2I100M1D166M1D2M1I93M1I142M1I29M10I113M2D3M2D4M1D155M
+gi|157734152:29655295-29712160	56866	8694	10348	+	gi|528476637:29857558-29915771	58214	1488	3170	1320	1753	0	NM:i:433	ms:i:1012	AS:i:1018	nn:i:0	tp:A:S	cm:i:12	s1:i:120	de:f:0.1961	rl:i:96	cg:Z:11M2D45M1D260M1I153M1I3M1D7M1D12M3I41M14I4M6I78M3D6M5D3M7D55M5D2M2D21M1I26M2I2M6I11M1D6M2D5M2I11M4D8M1I4M1I8M4D59M3D12M1I6M1I17M2D8M1I5M2I38M2I47M2D15M26D22M1D7M1I75M2I1M5I22M1D5M1D6M1D3M3I20M1D115M1I44M5D3M1I1M1I17M1I41M1I2M2D7M1D3M1I36M2I6M7D3M3D63M1I3M5I37M3D2M2D9M1I41M
+gi|157734152:29655295-29712160	56866	8694	10348	+	gi|157734152:29655295-29712160	56866	1466	3148	1318	1753	0	NM:i:435	ms:i:1000	AS:i:1006	nn:i:0	tp:A:S	cm:i:12	s1:i:120	de:f:0.1973	rl:i:96	cg:Z:11M2D45M1D260M1I153M1I3M1D7M1D12M3I41M14I4M6I78M3D6M5D3M7D55M5D2M2D21M1I26M2I2M6I11M1D6M2D5M2I11M4D8M1I4M1I8M4D59M3D12M1I6M1I17M2D8M1I5M2I38M2I47M2D15M26D22M1D7M1I75M2I1M5I22M1D5M1D6M1D3M3I20M1D115M1I44M5D3M1I1M1I17M1I41M1I2M2D7M1D3M1I36M2I6M7D3M3D63M1I3M5I37M3D2M2D9M1I41M
+gi|157734152:29655295-29712160	56866	1466	3148	+	gi|528476637:29857558-29915771	58214	8615	10269	1318	1753	0	NM:i:435	ms:i:1000	AS:i:1006	nn:i:0	tp:A:S	cm:i:12	s1:i:120	de:f:0.1973	rl:i:96	cg:Z:11M2I45M1I260M1D153M1D3M1I7M1I12M3D41M14D4M6D78M3I6M5I3M7I55M5I2M2I21M1D26M2D2M6D11M1I6M2I5M2D11M4I8M1D4M1D8M4I59M3I12M1D6M1D17M2I8M1D5M2D38M2D47M2I15M26I22M1I7M1D75M2D1M5D22M1I5M1I6M1I3M3D20M1I115M1D44M5I3M1D1M1D17M1D41M1D2M2I7M1I3M1D36M2D6M7I3M3I63M1D3M5D37M3I2M2I9M1D41M
+gi|157734152:29655295-29712160	56866	1466	3148	+	gi|157734152:29655295-29712160	56866	8694	10348	1318	1753	0	NM:i:435	ms:i:1000	AS:i:1006	nn:i:0	tp:A:S	cm:i:12	s1:i:120	de:f:0.1973	rl:i:96	cg:Z:11M2I45M1I260M1D153M1D3M1I7M1I12M3D41M14D4M6D78M3I6M5I3M7I55M5I2M2I21M1D26M2D2M6D11M1I6M2I5M2D11M4I8M1D4M1D8M4I59M3I12M1D6M1D17M2I8M1D5M2D38M2D47M2I15M26I22M1I7M1D75M2D1M5D22M1I5M1I6M1I3M3D20M1I115M1D44M5I3M1D1M1D17M1D41M1D2M2I7M1I3M1D36M2D6M7I3M3I63M1D3M5D37M3I2M2I9M1D41M
+gi|157734152:29655295-29712160	56866	40091	41811	+	gi|528476637:29857558-29915771	58214	8615	10269	1326	1760	0	NM:i:434	ms:i:984	AS:i:993	nn:i:0	tp:A:S	cm:i:7	s1:i:86	de:f:0.2060	rl:i:96	cg:Z:11M2I12M1D32M1I131M2I6M1I268M1I4M3I11M1I2M3I15M3D162M15I32M1I5M6I31M1D26M2D1M4D14M1I6M2I5M2D11M4I8M1D4M1D8M4I55M3I23M1D17M2I54M2D4M1D3M1I43M1I23M29I1M1D51M5D1M1D33M2D1M2D6M3D55M2I6M1D38M1I4M1D24M1I5M1D74M1I6M1D2M1I1M1I61M2I49M1I7M5I3M3I63M1D3M1D41M3I2M2I9M1D41M
+gi|157734152:29655295-29712160	56866	40091	41811	+	gi|157734152:29655295-29712160	56866	8694	10348	1326	1760	0	NM:i:434	ms:i:984	AS:i:993	nn:i:0	tp:A:S	cm:i:7	s1:i:86	de:f:0.2060	rl:i:96	cg:Z:11M2I12M1D32M1I131M2I6M1I268M1I4M3I11M1I2M3I15M3D162M15I32M1I5M6I31M1D26M2D1M4D14M1I6M2I5M2D11M4I8M1D4M1D8M4I55M3I23M1D17M2I54M2D4M1D3M1I43M1I23M29I1M1D51M5D1M1D33M2D1M2D6M3D55M2I6M1D38M1I4M1D24M1I5M1D74M1I6M1D2M1I1M1I61M2I49M1I7M5I3M3I63M1D3M1D41M3I2M2I9M1D41M
+gi|157734152:29655295-29712160	56866	8694	10348	+	gi|157734152:29655295-29712160	56866	40091	41811	1326	1760	0	NM:i:434	ms:i:984	AS:i:993	nn:i:0	tp:A:S	cm:i:7	s1:i:86	de:f:0.2060	rl:i:96	cg:Z:11M2D12M1I32M1D131M2D6M1D268M1D4M3D11M1D2M3D15M3I162M15D32M1D5M6D31M1I26M2I1M4I14M1D6M2D5M2I11M4D8M1I4M1I8M4D55M3D23M1I17M2D54M2I4M1I3M1D43M1D23M29D1M1I51M5I1M1I33M2I1M2I6M3I55M2D6M1I39M1I3M1D24M1D5M1I74M1D6M1I2M1D1M1D61M2D49M1D7M5D3M3D63M1I3M1I41M3D2M2D9M1I41M
+gi|157734152:29655295-29712160	56866	8694	10345	+	gi|528476637:29857558-29915771	58214	39969	41686	1323	1759	0	NM:i:436	ms:i:974	AS:i:981	nn:i:0	tp:A:S	cm:i:11	s1:i:113	de:f:0.2059	rl:i:96	cg:Z:11M2D12M1I32M1D131M1D1M5D6M1D202M2I69M4D9M1D2M3D15M3I162M15D32M1D5M6D31M1I26M2I1M4I14M1D6M2D5M2I11M4D8M1I4M1I8M4D55M3D23M1I17M2D54M2I4M1I3M1D43M1D23M27D1M1I51M5I1M1I33M2I1M2I6M3I55M2D6M1I39M1I3M1D24M1D5M1I74M1D6M1I2M1D1M1D61M2D49M1D7M5D3M3D63M1I3M1I41M3D2M2D9M1I38M
+gi|157734152:29655295-29712160	56866	8715	10348	+	gi|342187237:5004-8419	3416	1488	3158	1295	1726	0	NM:i:431	ms:i:964	AS:i:970	nn:i:0	tp:A:S	cm:i:10	s1:i:118	de:f:0.2041	rl:i:96	cg:Z:35M1D414M1I3M1D7M1D12M3I44M20I84M3D2M2D2M10D42M1I3M1D9M3D2M4D21M1I30M6I7M1D3M2D11M1I1M1I11M4D8M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I38M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D71M2D47M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	8715	10348	+	gi|568815529:1421891-1425306	3416	1488	3158	1295	1726	0	NM:i:431	ms:i:964	AS:i:970	nn:i:0	tp:A:S	cm:i:10	s1:i:118	de:f:0.2041	rl:i:96	cg:Z:35M1D414M1I3M1D7M1D12M3I44M20I84M3D2M2D2M10D42M1I3M1D9M3D2M4D21M1I30M6I7M1D3M2D11M1I1M1I11M4D8M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I38M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D71M2D47M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	8715	10348	+	gi|568815454:1200216-1203631	3416	1488	3158	1295	1726	0	NM:i:431	ms:i:964	AS:i:970	nn:i:0	tp:A:S	cm:i:10	s1:i:118	de:f:0.2041	rl:i:96	cg:Z:35M1D414M1I3M1D7M1D12M3I44M20I84M3D2M2D2M10D42M1I3M1D9M3D2M4D21M1I30M6I7M1D3M2D11M1I1M1I11M4D8M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I38M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D71M2D47M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	45590	46424	+	gi|528476637:29857558-29915771	58214	30702	31514	718	856	0	NM:i:138	ms:i:944	AS:i:956	nn:i:0	tp:A:S	cm:i:50	s1:i:439	de:f:0.1114	zd:i:1	rl:i:96	cg:Z:36M2I6M1D4M3D8M3I14M2D4M1D10M2D15M1D27M1D80M1D63M1D128M32I197M7D1M2D3M1I15M2I1M1I138M3I40M
+gi|157734152:29655295-29712160	56866	8715	10348	+	gi|568815592:29942469-29945883	3415	1487	3157	1291	1726	0	NM:i:435	ms:i:944	AS:i:950	nn:i:0	tp:A:S	cm:i:9	s1:i:103	de:f:0.2060	rl:i:96	cg:Z:35M1D414M1I3M1D7M1D12M3I44M20I84M3D2M2D2M10D42M1I3M1D9M3D2M4D21M1I30M6I7M1D3M2D11M2I12M4D8M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I38M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D71M2D47M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	30823	31632	+	gi|157734152:29655295-29712160	56866	45590	46426	716	858	0	NM:i:142	ms:i:934	AS:i:946	nn:i:0	tp:A:S	cm:i:47	s1:i:408	de:f:0.1106	zd:i:1	rl:i:96	cg:Z:36M2D5M7D20M4I3M2I4M1I10M2I15M1I27M1I80M1I63M1I128M32D48M1D148M7I1M2I3M1D15M2D1M1D138M3D42M
+gi|157734152:29655295-29712160	56866	45590	46426	+	gi|157734152:29655295-29712160	56866	30823	31632	716	858	0	NM:i:142	ms:i:934	AS:i:946	nn:i:0	tp:A:S	cm:i:47	s1:i:408	de:f:0.1106	zd:i:1	rl:i:96	cg:Z:36M2I5M7I20M4D3M2D4M1D10M2D15M1D27M1D80M1D63M1D128M32I48M1I148M7D1M2D3M1I15M2I1M1I138M3I42M
+gi|157734152:29655295-29712160	56866	30823	31630	+	gi|528476637:29857558-29915771	58214	45466	46300	713	856	0	NM:i:143	ms:i:924	AS:i:936	nn:i:0	tp:A:S	cm:i:47	s1:i:312	de:f:0.1121	rl:i:96	cg:Z:36M2D5M7D20M4I3M2I4M1I10M2I15M1I27M1I80M1I63M1I128M32D48M1D148M7I1M2I3M1D15M2D1M1D138M3D40M
+gi|157734152:29655295-29712160	56866	8708	10348	+	gi|568815551:1197321-1201446	4126	2203	3873	1286	1731	0	NM:i:445	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2115	rl:i:96	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D2M6D1M2D58M3D2M3D21M1I30M6I11M1D6M1I4M3I13M3D10M1D2M2D7M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	8708	10348	+	gi|157734152:29655295-29712160	56866	54938	56608	1286	1731	0	NM:i:445	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2115	rl:i:96	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D2M6D1M2D58M3D2M3D21M1I30M6I11M1D6M1I4M3I13M3D10M1D2M2D7M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D71M2D47M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	8708	10348	+	gi|568815564:1286641-1289973	3333	1410	3080	1286	1731	0	NM:i:445	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2115	rl:i:96	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D2M6D1M2D58M3D2M3D21M1I30M6I11M1D6M1I4M3I13M3D10M1D2M2D7M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	54938	56608	+	gi|157734152:29655295-29712160	56866	8708	10348	1286	1732	0	NM:i:446	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2110	rl:i:96	cg:Z:42M1I414M1D3M1I7M1I12M3D21M1D2M2D18M20D78M12I3M2I1M2I2M1D58M3I2M3I21M1D30M6D11M1I6M1D4M3D13M3I10M1I2M2I7M4I60M3I11M1D6M1D17M2I8M1D5M2D8M2D2M1D25M2D4M1D3M1I39M2I15M26I105M2D1M5D59M1I108M1I2M1D47M2I71M2I47M1D6M7I3M3I40M2I3M1D19M1D7M1D37M3I12M1I41M
+gi|157734152:29655295-29712160	56866	8708	10348	+	gi|528476637:29857558-29915771	58214	56286	57956	1286	1731	0	NM:i:445	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2115	rl:i:96	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D2M6D1M2D58M3D2M3D21M1I30M6I11M1D6M1I4M3I13M3D10M1D2M2D7M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	54938	56608	+	gi|528476637:29857558-29915771	58214	8629	10269	1286	1732	0	NM:i:446	ms:i:888	AS:i:894	nn:i:0	tp:A:S	cm:i:12	s1:i:132	de:f:0.2110	rl:i:96	cg:Z:42M1I414M1D3M1I7M1I12M3D21M1D2M2D18M20D78M12I3M2I1M2I2M1D58M3I2M3I21M1D30M6D11M1I6M1D4M3D13M3I10M1I2M2I7M4I60M3I11M1D6M1D17M2I8M1D5M2D8M2D2M1D25M2D4M1D3M1I39M2I15M26I105M2D1M5D59M1I108M1I2M1D47M2I71M2I47M1D6M7I3M3I40M2I3M1D19M1D7M1D37M3I12M1I41M
+gi|157734152:29655295-29712160	56866	8708	10348	+	gi|568815561:1196951-1200436	3486	1561	3233	1285	1737	0	NM:i:452	ms:i:874	AS:i:880	nn:i:0	tp:A:S	cm:i:10	s1:i:116	de:f:0.2107	rl:i:96	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I78M14D4M2D2M1I48M2D10M3D2M3D21M1I30M6I11M1D6M2D7M4I4M1I3M7D7M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	8708	10348	+	gi|568815567:1196244-1200852	4609	2686	4356	1284	1732	0	NM:i:448	ms:i:868	AS:i:874	nn:i:0	tp:A:S	cm:i:9	s1:i:100	de:f:0.2132	rl:i:96	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D2M3D1M5D58M3D2M3D21M1I30M6I11M1D6M2D7M4I4M1I3M1D1M1D11M1D2M2D7M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	8708	10348	+	gi|568815569:1240288-1243708	3421	1496	3168	1284	1736	0	NM:i:452	ms:i:868	AS:i:874	nn:i:0	tp:A:S	cm:i:10	s1:i:116	de:f:0.2118	rl:i:96	cg:Z:42M1D414M1I3M1D7M1D12M3I21M1I2M2I18M20I79M3D3M4D3M8D48M2D10M3D2M3D21M1I30M6I11M1D6M2D7M4I4M1I3M7D7M1I4M1I8M4D60M3D11M1I6M1I17M2D8M1I5M2I8M2I2M1I25M2I4M1I3M1D39M2D15M26D105M2I1M5I59M1D108M1D2M1I47M2D69M2D49M1I6M7D3M3D40M2D3M1I19M1I7M1I37M3D12M1D41M
+gi|157734152:29655295-29712160	56866	46634	47076	+	gi|157734152:29655295-29712160	56866	46006	46443	427	443	0	NM:i:16	ms:i:796	AS:i:796	nn:i:0	tp:A:S	cm:i:59	s1:i:350	de:f:0.0251	rl:i:96	cg:Z:405M6I20M1D11M
+gi|157734152:29655295-29712160	56866	46006	46443	+	gi|157734152:29655295-29712160	56866	46634	47076	427	442	0	NM:i:15	ms:i:796	AS:i:796	nn:i:0	tp:A:S	cm:i:59	s1:i:350	de:f:0.0273	rl:i:96	cg:Z:405M4D21M1D11M
+gi|157734152:29655295-29712160	56866	46634	47073	+	gi|528476637:29857558-29915771	58214	45882	46332	428	450	0	NM:i:22	ms:i:782	AS:i:782	nn:i:0	tp:A:S	cm:i:56	s1:i:327	de:f:0.0295	rl:i:96	cg:Z:393M10D38M1D8M
+gi|157734152:29655295-29712160	56866	4717	5886	+	gi|528476637:29857558-29915771	58214	27052	28249	926	1207	0	NM:i:281	ms:i:732	AS:i:732	nn:i:0	tp:A:S	cm:i:8	s1:i:95	de:f:0.2166	rl:i:96	cg:Z:100M1I5M1D139M7D13M1D133M7D80M1I58M1D6M1I70M1D31M2I5M1D15M1D3M1D17M1I2M1D168M9D2M1D48M2D113M2I73M2I4M2D15M1D23M1D36M
+gi|157734152:29655295-29712160	56866	27171	28370	+	gi|157734152:29655295-29712160	56866	4717	5886	925	1208	0	NM:i:283	ms:i:722	AS:i:722	nn:i:0	tp:A:S	cm:i:8	s1:i:95	de:f:0.2181	rl:i:96	cg:Z:100M1D5M1I139M9I13M1I133M7I80M1D58M1I6M1D70M1I31M2D5M1I15M1I3M1I16M1I3M1D168M9I2M1I48M2I113M2D73M1I5M1D15M1I23M1I36M
+gi|157734152:29655295-29712160	56866	4717	5886	+	gi|157734152:29655295-29712160	56866	27171	28370	925	1209	0	NM:i:284	ms:i:722	AS:i:722	nn:i:0	tp:A:S	cm:i:8	s1:i:95	de:f:0.2174	rl:i:96	cg:Z:100M1I5M1D139M9D13M1D133M7D80M1I58M1D6M1I70M1D31M2I5M1D15M1D3M1D17M1I2M1D168M9D2M1D48M2D113M2I73M2I4M2D15M1D23M1D36M
+gi|157734152:29655295-29712160	56866	27171	28370	+	gi|528476637:29857558-29915771	58214	4739	5908	924	1208	0	NM:i:284	ms:i:716	AS:i:716	nn:i:0	tp:A:S	cm:i:8	s1:i:95	de:f:0.2189	rl:i:96	cg:Z:100M1D5M1I139M9I13M1I133M7I80M1D58M1I6M1D70M1I31M2D5M1I15M1I3M1I16M1I3M1D168M9I2M1I48M2I113M2D73M1I5M1D15M1I23M1I36M
+gi|157734152:29655295-29712160	56866	54327	54743	+	gi|528476637:29857558-29915771	58214	44457	44873	396	416	0	NM:i:20	ms:i:712	AS:i:712	nn:i:0	tp:A:S	cm:i:37	s1:i:254	de:f:0.0481	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|568815569:1240288-1243708	3421	885	1301	396	416	0	NM:i:20	ms:i:712	AS:i:712	nn:i:0	tp:A:S	cm:i:32	s1:i:246	de:f:0.0481	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|568815567:1196244-1200852	4609	2075	2491	396	416	0	NM:i:20	ms:i:712	AS:i:712	nn:i:0	tp:A:S	cm:i:32	s1:i:257	de:f:0.0481	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|568815592:29942469-29945883	3415	891	1306	396	416	0	NM:i:20	ms:i:710	AS:i:710	nn:i:0	tp:A:S	cm:i:35	s1:i:244	de:f:0.0481	rl:i:96	cg:Z:321M1I94M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|568815561:1196951-1200436	3486	950	1366	395	416	0	NM:i:21	ms:i:706	AS:i:706	nn:i:0	tp:A:S	cm:i:29	s1:i:236	de:f:0.0505	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|528476637:29857558-29915771	58214	55675	56091	393	416	0	NM:i:23	ms:i:694	AS:i:694	nn:i:0	tp:A:S	cm:i:30	s1:i:216	de:f:0.0553	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|568815551:1197321-1201446	4126	1592	2008	393	416	0	NM:i:23	ms:i:694	AS:i:694	nn:i:0	tp:A:S	cm:i:30	s1:i:216	de:f:0.0553	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|568815564:1286641-1289973	3333	799	1215	393	416	0	NM:i:23	ms:i:694	AS:i:694	nn:i:0	tp:A:S	cm:i:30	s1:i:216	de:f:0.0553	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|157734152:29655295-29712160	56866	54327	54743	393	416	0	NM:i:23	ms:i:694	AS:i:694	nn:i:0	tp:A:S	cm:i:30	s1:i:216	de:f:0.0553	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	54327	54743	+	gi|157734152:29655295-29712160	56866	44580	44996	393	416	0	NM:i:23	ms:i:694	AS:i:694	nn:i:0	tp:A:S	cm:i:30	s1:i:216	de:f:0.0553	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|568815529:1421891-1425306	3416	891	1307	390	416	0	NM:i:26	ms:i:676	AS:i:676	nn:i:0	tp:A:S	cm:i:29	s1:i:188	de:f:0.0625	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|568815454:1200216-1203631	3416	891	1307	390	416	0	NM:i:26	ms:i:676	AS:i:676	nn:i:0	tp:A:S	cm:i:29	s1:i:188	de:f:0.0625	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	44580	44996	+	gi|342187237:5004-8419	3416	891	1307	390	416	0	NM:i:26	ms:i:676	AS:i:676	nn:i:0	tp:A:S	cm:i:29	s1:i:188	de:f:0.0625	rl:i:96	cg:Z:416M
+gi|157734152:29655295-29712160	56866	886	1289	+	gi|528476637:29857558-29915771	58214	44457	44872	370	415	0	NM:i:45	ms:i:580	AS:i:580	nn:i:0	tp:A:S	cm:i:16	s1:i:142	de:f:0.0842	rl:i:96	cg:Z:324M12D79M
+gi|157734152:29655295-29712160	56866	46651	47139	+	gi|528476637:29857558-29915771	58214	31111	31578	418	497	0	NM:i:79	ms:i:570	AS:i:573	nn:i:0	tp:A:S	cm:i:18	s1:i:159	de:f:0.1011	rl:i:96	cg:Z:196M7D1M2D3M1I15M2I1M1I138M3I30M23I74M
+gi|157734152:29655295-29712160	56866	44580	44995	+	gi|157734152:29655295-29712160	56866	886	1289	368	415	0	NM:i:47	ms:i:568	AS:i:568	nn:i:0	tp:A:S	cm:i:11	s1:i:116	de:f:0.0891	rl:i:96	cg:Z:324M12I79M
+gi|157734152:29655295-29712160	56866	886	1289	+	gi|157734152:29655295-29712160	56866	44580	44995	368	415	0	NM:i:47	ms:i:568	AS:i:568	nn:i:0	tp:A:S	cm:i:11	s1:i:116	de:f:0.0891	rl:i:96	cg:Z:324M12D79M
+gi|157734152:29655295-29712160	56866	31228	31696	+	gi|157734152:29655295-29712160	56866	46651	47139	418	497	0	NM:i:79	ms:i:560	AS:i:560	nn:i:0	tp:A:S	cm:i:16	s1:i:161	de:f:0.1068	rl:i:96	cg:Z:47M1D148M7I1M2I3M1D15M2D1M1D138M3D25M8D7M13D74M
+gi|157734152:29655295-29712160	56866	46651	47139	+	gi|157734152:29655295-29712160	56866	31228	31696	418	497	0	NM:i:79	ms:i:560	AS:i:560	nn:i:0	tp:A:S	cm:i:16	s1:i:161	de:f:0.1068	rl:i:96	cg:Z:47M1I148M7D1M2D3M1I15M2I1M1I138M3I25M8I7M13I74M
+gi|157734152:29655295-29712160	56866	44580	44995	+	gi|528476637:29857558-29915771	58214	886	1289	366	415	0	NM:i:49	ms:i:556	AS:i:556	nn:i:0	tp:A:S	cm:i:12	s1:i:107	de:f:0.0941	rl:i:96	cg:Z:324M12I79M
+gi|157734152:29655295-29712160	56866	44580	44995	+	gi|528476637:29857558-29915771	58214	39378	39792	363	418	0	NM:i:55	ms:i:508	AS:i:508	nn:i:0	tp:A:S	cm:i:7	s1:i:93	de:f:0.1232	rl:i:96	cg:Z:85M3I4M3D48M1I274M
+gi|157734152:29655295-29712160	56866	44580	44995	+	gi|157734152:29655295-29712160	56866	39500	39914	362	418	0	NM:i:56	ms:i:502	AS:i:502	nn:i:0	tp:A:S	cm:i:6	s1:i:78	de:f:0.1256	rl:i:96	cg:Z:85M3I4M3D48M1I274M
+gi|157734152:29655295-29712160	56866	39500	39914	+	gi|157734152:29655295-29712160	56866	44580	44995	362	418	0	NM:i:56	ms:i:502	AS:i:502	nn:i:0	tp:A:S	cm:i:6	s1:i:78	de:f:0.1256	rl:i:96	cg:Z:85M3D4M3I48M1D274M
+gi|157734152:29655295-29712160	56866	39500	39914	+	gi|528476637:29857558-29915771	58214	44457	44872	360	418	0	NM:i:58	ms:i:490	AS:i:490	nn:i:0	tp:A:S	cm:i:6	s1:i:78	de:f:0.1304	rl:i:96	cg:Z:85M3D4M3I48M1D274M
+gi|157734152:29655295-29712160	56866	7021	7639	+	gi|528476637:29857558-29915771	58214	49208	49824	489	643	0	NM:i:154	ms:i:370	AS:i:370	nn:i:0	tp:A:S	cm:i:5	s1:i:47	de:f:0.2049	rl:i:96	cg:Z:26M4D20M1I64M2D7M1I1M1I39M9I5M2I5M4I75M2D8M1I4M2D25M1D11M1I5M1I2M2D4M1I4M1I7M5D7M1D133M1D49M1D29M4D5M3I3M1I53M
+gi|157734152:29655295-29712160	56866	7021	7639	+	gi|157734152:29655295-29712160	56866	47858	48472	488	641	0	NM:i:153	ms:i:364	AS:i:364	nn:i:0	tp:A:S	cm:i:5	s1:i:48	de:f:0.2078	rl:i:96	cg:Z:26M4D20M1I64M2D7M1I1M1I39M9I5M2I5M4I75M2D9M1I3M2D25M1D11M1I5M1I3M1D8M1I7M3D7M1D90M1I5M1D37M1D49M1D30M4D4M3I3M1I53M
+gi|157734152:29655295-29712160	56866	47858	48472	+	gi|528476637:29857558-29915771	58214	7043	7661	488	641	0	NM:i:153	ms:i:364	AS:i:364	nn:i:0	tp:A:S	cm:i:5	s1:i:48	de:f:0.2078	rl:i:96	cg:Z:26M4I20M1D64M2I7M1D1M1D39M9D5M2D5M4D75M2I9M1D3M2I25M1I11M1D5M1D3M1I8M1D7M3I7M1I90M1D5M1I37M1I49M1I30M4I4M3D3M1D53M
+gi|157734152:29655295-29712160	56866	47858	48472	+	gi|157734152:29655295-29712160	56866	7021	7639	488	641	0	NM:i:153	ms:i:364	AS:i:364	nn:i:0	tp:A:S	cm:i:5	s1:i:48	de:f:0.2078	rl:i:96	cg:Z:26M4I20M1D64M2I7M1D1M1D39M9D5M2D5M4D75M2I9M1D3M2I25M1I11M1D5M1D3M1I8M1D7M3I7M1I90M1D5M1I37M1I49M1I30M4I4M3D3M1D53M
+gi|157734152:29655295-29712160	56866	28499	28764	-	gi|528476637:29857558-29915771	58214	29092	29357	235	265	41	NM:i:30	ms:i:350	AS:i:350	nn:i:0	tp:A:P	cm:i:4	s1:i:46	s2:i:0	de:f:0.1132	zd:i:2	rl:i:96	cg:Z:265M
+gi|157734152:29655295-29712160	56866	14465	14764	-	gi|528476637:29857558-29915771	58214	45149	45463	266	316	0	NM:i:50	ms:i:350	AS:i:350	nn:i:0	tp:A:S	cm:i:3	s1:i:40	de:f:0.1192	rl:i:96	cg:Z:5M1I26M2D116M14D2M1D114M1I34M
+gi|157734152:29655295-29712160	56866	29213	29478	-	gi|528476637:29857558-29915771	58214	28378	28643	234	265	0	NM:i:31	ms:i:344	AS:i:344	nn:i:0	tp:A:S	cm:i:4	s1:i:46	de:f:0.1170	zd:i:1	rl:i:96	cg:Z:265M
+gi|157734152:29655295-29712160	56866	28499	28764	-	gi|157734152:29655295-29712160	56866	29213	29478	233	265	40	NM:i:32	ms:i:338	AS:i:338	nn:i:0	tp:A:P	cm:i:4	s1:i:46	s2:i:0	de:f:0.1208	zd:i:2	rl:i:96	cg:Z:265M
+gi|157734152:29655295-29712160	56866	29213	29478	-	gi|157734152:29655295-29712160	56866	28499	28764	233	265	0	NM:i:32	ms:i:338	AS:i:338	nn:i:0	tp:A:S	cm:i:4	s1:i:46	de:f:0.1208	zd:i:1	rl:i:96	cg:Z:265M
+gi|157734152:29655295-29712160	56866	17792	17978	+	gi|157734152:29655295-29712160	56866	17883	18067	176	186	0	NM:i:10	ms:i:312	AS:i:312	nn:i:0	tp:A:S	cm:i:11	s1:i:86	de:f:0.0486	rl:i:96	cg:Z:6M2I178M
+gi|157734152:29655295-29712160	56866	17883	18067	+	gi|157734152:29655295-29712160	56866	17792	17978	176	186	0	NM:i:10	ms:i:312	AS:i:312	nn:i:0	tp:A:S	cm:i:11	s1:i:86	de:f:0.0486	rl:i:96	cg:Z:6M2D178M
+gi|157734152:29655295-29712160	56866	6285	6982	-	gi|528476637:29857558-29915771	58214	6307	7004	528	727	0	NM:i:199	ms:i:272	AS:i:272	nn:i:0	tp:A:S	cm:i:4	s1:i:44	de:f:0.2392	rl:i:96	cg:Z:11M1D155M1I43M2D64M2I1M1I6M3I5M2I1M2I6M1D9M2I3M3D6M8I5M1I8M1I5M1I9M1D6M1D5M1D8M8D5M3I4M2D3M2D13M2D7M5D70M2I43M1D154M1I12M
+gi|157734152:29655295-29712160	56866	6285	6982	-	gi|157734152:29655295-29712160	56866	6285	6982	528	723	0	NM:i:195	ms:i:272	AS:i:272	nn:i:0	tp:A:S	cm:i:4	s1:i:44	de:f:0.2436	rl:i:96	cg:Z:11M1D155M1I43M2D64M2I1M1I6M3I5M2I1M2I6M1D9M2I3M3D6M1I7M2D2M2I3M2D26M2I3M2D2M2I7M1D5M3I4M2D3M2D13M2D7M5D70M2I43M1D154M1I12M
+gi|157734152:29655295-29712160	56866	8039	8361	+	gi|157734152:29655295-29712160	56866	8039	8285	228	323	0	NM:i:95	ms:i:262	AS:i:281	nn:i:0	tp:A:S	cm:i:8	s1:i:53	de:f:0.0769	rl:i:96	cg:Z:131M77I89M1D25M
+gi|157734152:29655295-29712160	56866	8039	8285	+	gi|157734152:29655295-29712160	56866	8039	8361	228	323	0	NM:i:95	ms:i:262	AS:i:281	nn:i:0	tp:A:S	cm:i:8	s1:i:53	de:f:0.0769	rl:i:96	cg:Z:131M77D89M1I25M
+gi|157734152:29655295-29712160	56866	46497	46603	-	gi|157734152:29655295-29712160	56866	46497	46603	92	106	0	NM:i:14	ms:i:128	AS:i:128	nn:i:0	tp:A:S	cm:i:4	s1:i:54	de:f:0.1321	rl:i:96	cg:Z:106M
+gi|157734152:29655295-29712160	56866	8206	8392	+	gi|157734152:29655295-29712160	56866	8003	8199	154	201	0	NM:i:47	ms:i:116	AS:i:116	nn:i:0	tp:A:S	cm:i:5	s1:i:41	de:f:0.1979	rl:i:96	cg:Z:14M3D43M2I1M1I28M1D2M2D3M1D14M1D11M2D3M2D5M2I5M3D52M
+gi|157734152:29655295-29712160	56866	8003	8199	+	gi|157734152:29655295-29712160	56866	8206	8392	154	201	0	NM:i:47	ms:i:116	AS:i:116	nn:i:0	tp:A:S	cm:i:5	s1:i:41	de:f:0.1979	rl:i:96	cg:Z:14M3I43M2D1M1D28M1I2M2I3M1I14M1I11M2I3M2I5M2D5M3I52M
+gi|157734152:29655295-29712160	56866	46537	46603	-	gi|157734152:29655295-29712160	56866	46537	46603	60	66	0	NM:i:6	ms:i:96	AS:i:96	nn:i:0	tp:A:S	cm:i:4	s1:i:48	de:f:0.0909	rl:i:96	cg:Z:66M
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test.stat	Fri Feb 05 17:52:51 2021 +0000
@@ -0,0 +1,501 @@
+0	89000
+1	25815
+2	265
+3	100
+4	25
+5	3
+6	2
+7	1
+8	1
+9	1
+10	1
+11	0
+12	0
+13	0
+14	0
+15	0
+16	0
+17	0
+18	0
+19	0
+20	0
+21	0
+22	0
+23	0
+24	0
+25	0
+26	0
+27	0
+28	0
+29	0
+30	0
+31	0
+32	0
+33	0
+34	0
+35	0
+36	0
+37	0
+38	0
+39	0
+40	0
+41	0
+42	0
+43	0
+44	0
+45	0
+46	0
+47	0
+48	0
+49	0
+50	0
+51	0
+52	0
+53	0
+54	0
+55	0
+56	0
+57	0
+58	0
+59	0
+60	0
+61	0
+62	0
+63	0
+64	0
+65	0
+66	0
+67	0
+68	0
+69	0
+70	0
+71	0
+72	0
+73	0
+74	0
+75	0
+76	0
+77	0
+78	0
+79	0
+80	0
+81	0
+82	0
+83	0
+84	0
+85	0
+86	0
+87	0
+88	0
+89	0
+90	0
+91	0
+92	0
+93	0
+94	0
+95	0
+96	0
+97	0
+98	0
+99	0
+100	0
+101	0
+102	0
+103	0
+104	0
+105	0
+106	0
+107	0
+108	0
+109	0
+110	0
+111	0
+112	0
+113	0
+114	0
+115	0
+116	0
+117	0
+118	0
+119	0
+120	0
+121	0
+122	0
+123	0
+124	0
+125	0
+126	0
+127	0
+128	0
+129	0
+130	0
+131	0
+132	0
+133	0
+134	0
+135	0
+136	0
+137	0
+138	0
+139	0
+140	0
+141	0
+142	0
+143	0
+144	0
+145	0
+146	0
+147	0
+148	0
+149	0
+150	0
+151	0
+152	0
+153	0
+154	0
+155	0
+156	0
+157	0
+158	0
+159	0
+160	0
+161	0
+162	0
+163	0
+164	0
+165	0
+166	0
+167	0
+168	0
+169	0
+170	0
+171	0
+172	0
+173	0
+174	0
+175	0
+176	0
+177	0
+178	0
+179	0
+180	0
+181	0
+182	0
+183	0
+184	0
+185	0
+186	0
+187	0
+188	0
+189	0
+190	0
+191	0
+192	0
+193	0
+194	0
+195	0
+196	0
+197	0
+198	0
+199	0
+200	0
+201	0
+202	0
+203	0
+204	0
+205	0
+206	0
+207	0
+208	0
+209	0
+210	0
+211	0
+212	0
+213	0
+214	0
+215	0
+216	0
+217	0
+218	0
+219	0
+220	0
+221	0
+222	0
+223	0
+224	0
+225	0
+226	0
+227	0
+228	0
+229	0
+230	0
+231	0
+232	0
+233	0
+234	0
+235	0
+236	0
+237	0
+238	0
+239	0
+240	0
+241	0
+242	0
+243	0
+244	0
+245	0
+246	0
+247	0
+248	0
+249	0
+250	0
+251	0
+252	0
+253	0
+254	0
+255	0
+256	0
+257	0
+258	0
+259	0
+260	0
+261	0
+262	0
+263	0
+264	0
+265	0
+266	0
+267	0
+268	0
+269	0
+270	0
+271	0
+272	0
+273	0
+274	0
+275	0
+276	0
+277	0
+278	0
+279	0
+280	0
+281	0
+282	0
+283	0
+284	0
+285	0
+286	0
+287	0
+288	0
+289	0
+290	0
+291	0
+292	0
+293	0
+294	0
+295	0
+296	0
+297	0
+298	0
+299	0
+300	0
+301	0
+302	0
+303	0
+304	0
+305	0
+306	0
+307	0
+308	0
+309	0
+310	0
+311	0
+312	0
+313	0
+314	0
+315	0
+316	0
+317	0
+318	0
+319	0
+320	0
+321	0
+322	0
+323	0
+324	0
+325	0
+326	0
+327	0
+328	0
+329	0
+330	0
+331	0
+332	0
+333	0
+334	0
+335	0
+336	0
+337	0
+338	0
+339	0
+340	0
+341	0
+342	0
+343	0
+344	0
+345	0
+346	0
+347	0
+348	0
+349	0
+350	0
+351	0
+352	0
+353	0
+354	0
+355	0
+356	0
+357	0
+358	0
+359	0
+360	0
+361	0
+362	0
+363	0
+364	0
+365	0
+366	0
+367	0
+368	0
+369	0
+370	0
+371	0
+372	0
+373	0
+374	0
+375	0
+376	0
+377	0
+378	0
+379	0
+380	0
+381	0
+382	0
+383	0
+384	0
+385	0
+386	0
+387	0
+388	0
+389	0
+390	0
+391	0
+392	0
+393	0
+394	0
+395	0
+396	0
+397	0
+398	0
+399	0
+400	0
+401	0
+402	0
+403	0
+404	0
+405	0
+406	0
+407	0
+408	0
+409	0
+410	0
+411	0
+412	0
+413	0
+414	0
+415	0
+416	0
+417	0
+418	0
+419	0
+420	0
+421	0
+422	0
+423	0
+424	0
+425	0
+426	0
+427	0
+428	0
+429	0
+430	0
+431	0
+432	0
+433	0
+434	0
+435	0
+436	0
+437	0
+438	0
+439	0
+440	0
+441	0
+442	0
+443	0
+444	0
+445	0
+446	0
+447	0
+448	0
+449	0
+450	0
+451	0
+452	0
+453	0
+454	0
+455	0
+456	0
+457	0
+458	0
+459	0
+460	0
+461	0
+462	0
+463	0
+464	0
+465	0
+466	0
+467	0
+468	0
+469	0
+470	0
+471	0
+472	0
+473	0
+474	0
+475	0
+476	0
+477	0
+478	0
+479	0
+480	0
+481	0
+482	0
+483	0
+484	0
+485	0
+486	0
+487	0
+488	0
+489	0
+490	0
+491	0
+492	0
+493	0
+494	0
+495	0
+496	0
+497	0
+498	0
+499	0
+500	0