# HG changeset patch
# User iuc
# Date 1664613802 0
# Node ID 7dd841a322453d35f08cf9b9f986a3360de48d56
# Parent  a1abfa420d9d096bb8fbe462dde0e24dd1a004c0
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/pygenometracks commit df07890f27c5d18e423ec889eadca82bd7958def

diff -r a1abfa420d9d -r 7dd841a32245 macros.xml
--- a/macros.xml	Sun Feb 13 22:43:45 2022 +0000
+++ b/macros.xml	Sat Oct 01 08:43:22 2022 +0000
@@ -1,6 +1,6 @@
 <macros>
-    <token name="@TOOL_VERSION@">3.6</token>
-    <token name="@VERSION_SUFFIX@">1</token>
+    <token name="@TOOL_VERSION@">3.7</token>
+    <token name="@VERSION_SUFFIX@">0</token>
     <xml name="requirements">
         <requirements>
             <requirement type="package" version="@TOOL_VERSION@">pygenometracks</requirement>
@@ -61,6 +61,27 @@
     <xml name="track_input_link_macro">
         <param name="track_input_link" type="data" format="bed,interval" label="Track file(s) for links" multiple="False"/>
     </xml>
+    <xml name="track_input_fasta_macro">
+        <conditional name="fasta_source">
+            <param name="fasta_source_selector" type="select" label="Choose the source for the fasta to display">
+                <option value="cached">Locally cached</option>
+                <option value="history">History</option>
+            </param>
+            <when value="cached">
+                <param name="fasta_cached" type="select" label="Fasta availables">
+                    <options from_data_table="fasta_indexes">
+                        <validator type="no_options" message="No cached fasta is available"/>
+                    </options>
+                </param>
+            </when>
+            <when value="history">
+                <param name="fasta_local" type="data" format="fasta" label="Fasta from history"/>
+            </when>
+        </conditional>
+    </xml>
+    <xml name="track_input_maf_macro">
+        <param name="track_input_maf" type="data" format="maf" label="Track file for maf" multiple="False"/>
+    </xml>
     <!-- Common to nearly all tracks: -->
     <xml name="plot_title">
         <param name="title" type="text" optional="true" label="Plot title" multiple="True"/>
@@ -166,6 +187,20 @@
             <when value="none" />
         </conditional>
     </xml>
+    <xml name="backbone_color_bed_macro">
+        <conditional name="backbone_color_bed">
+            <param name="backbone_color_bed_select" type="select" label="Define the color of the backbone:">
+                <option value="manually" selected="True">manually</option>
+                <option value="bed_rgb">From the 9th field</option>
+                <option value="none">No border</option>
+            </param>
+            <when value="manually">
+                <param name="color" type="color" value="#000000" label="Color of the backbone"/>
+            </when>
+            <when value="bed_rgb" />
+            <when value="none" />
+        </conditional>
+    </xml>
     <xml name="bed_advanced_macro">
         <param name="global_max_row" type="boolean" truevalue="true" falsevalue="false" checked="false"
                 label="Global max rows" />
@@ -175,8 +210,17 @@
         <section name ="gtf" title="When using gtf as input" expanded="False">
             <param name="prefered_name" type="text" value="transcript_name" label="attribute to use as label"
                 help="Usually transcript_name or gene_name"/>
-            <param name="merge_transcripts" type="boolean" truevalue="true" falsevalue="false" checked="false"
-                label="Merge all transcripts of each gene in a single entry" />
+            <conditional name="merge_transcripts">
+                <param name="merge_transcripts_select" type="select" label="Merge all transcripts of each gene in a single entry">
+                    <option value="false" selected="True">No</option>
+                    <option value="true">Yes</option>
+                </param>
+                <when value="true">
+                    <param name="merge_overlapping_exons" type="boolean" truevalue="true" falsevalue="false" checked="true"
+                        label="Merge overlapping exons" help="Usually it makes prettier plots" />
+                </when>
+                <when value="false" />
+            </conditional>
         </section>
     </xml>
     <xml name="utr_macro">
@@ -352,4 +396,21 @@
         <option value="magma_r">magma reversed</option>
         <option value="cividis_r">cividis reversed</option>
     </xml>
+    <xml name="links_arcs_triangles_options">
+        <param name="compact_arcs_level" type="select" label="Height of arcs and triangles:">
+            <option value="0" selected="True">default (proportional to distance)</option>
+            <option value="1">compacted (the height is proportional to the square root of the distance)</option>
+            <option value="2">highly compacted (the height is the same for all distances)</option>
+        </param>
+        <param name="use_middle" type="select" label="Coordinates to use" help="Not useful with loops">
+            <option value="false" selected="True">Extremities (start of first and end of second)</option>
+            <option value="true">Center (mean of start and end for each)</option>
+        </param>
+    </xml>
+    <xml name="region2_option">
+        <param name="region2" type="text" label="Region of the genome that should be plotted on the y axis" optional="true"
+            value="" help="The format is chr:start-end, for example chr10:10-500. By default this is the region on the x-axis. Top is start and bottom is end. Use 'Invert the track' if you want the contrary.">
+            <validator type="expression" message="Region should be like chr10:10-500">'^[a-zA-Z0-9_]:\d+-\d+$'</validator>
+        </param>
+    </xml>
 </macros>
diff -r a1abfa420d9d -r 7dd841a32245 pyGenomeTracks.xml
--- a/pyGenomeTracks.xml	Sun Feb 13 22:43:45 2022 +0000
+++ b/pyGenomeTracks.xml	Sat Oct 01 08:43:22 2022 +0000
@@ -7,14 +7,21 @@
     <expand macro="requirements" />
     <command detect_errors="exit_code">
 <![CDATA[
-        ## First symlink data of hic to have the good extension
+        ## First symlink data
+        ## of hic to have the good extension
+        ## of fasta to have the index written in the working directory
         #for $counter, $track in enumerate($tracks):
-            #if $track.track_file_style_conditional.track_file_style_selector == "hic_matrix_option":
+            #if $track.track_file_style_conditional.track_file_style_selector in ["hic_matrix_option", "hic_matrix_square_option"]:
                 #for $counter_matrix, $data_matrix in enumerate($track.track_file_style_conditional.matrix_h5_cooler_multiple):
                     #set ext = $data_matrix.extension
                     ln -s $data_matrix ${counter}_${counter_matrix}.$ext &&
                 #end for
             #end if
+            #if $track.track_file_style_conditional.track_file_style_selector == "fasta_option":
+                #if $track.track_file_style_conditional.fasta_source.fasta_source_selector == "history":
+                    ln -s $track.track_file_style_conditional.fasta_source.fasta_local fasta_${counter}.fa &&
+                #end if
+            #end if
         #end for
 
 
@@ -46,7 +53,7 @@
         <configfile name="tracks_config">
 ## Each track:
 #for $counter, $track in enumerate($tracks):
-  ## Hi-C Track
+  ## Hi-C Track triangle
   #if $track.track_file_style_conditional.track_file_style_selector == "hic_matrix_option":
     #for $counter_matrix, $data_matrix in enumerate($track.track_file_style_conditional.matrix_h5_cooler_multiple):
 [hic_section_${counter}_${counter_matrix}]
@@ -106,6 +113,67 @@
     #end for
   #end if
 
+  ## Hi-C Track square
+  #if $track.track_file_style_conditional.track_file_style_selector == "hic_matrix_square_option":
+    #for $counter_matrix, $data_matrix in enumerate($track.track_file_style_conditional.matrix_h5_cooler_multiple):
+[hic_section_${counter}_${counter_matrix}]
+      #set ext = $data_matrix.extension
+file = ${counter}_${counter_matrix}.$ext
+file_type = hic_matrix_square
+      #if $track.track_file_style_conditional.title:
+title = $track.track_file_style_conditional.title
+      #else:
+title = $data_matrix.element_identifier
+      #end if
+      #if $track.track_file_style_conditional.region2:
+region2 = $track.track_file_style_conditional.region2
+      #end if
+      #if $track.track_file_style_conditional.colormap:
+colormap = $track.track_file_style_conditional.colormap
+      #end if
+      #if $track.track_file_style_conditional.min_value != "":
+min_value = $track.track_file_style_conditional.min_value
+      #end if
+      #if $track.track_file_style_conditional.max_value != "":
+max_value = $track.track_file_style_conditional.max_value
+      #end if
+transform = $track.track_file_style_conditional.transform
+      #if $track.track_file_style_conditional.height_matrix != "":
+height = $track.track_file_style_conditional.height_matrix
+      #end if
+      #if $track.track_file_style_conditional.show_masked_bins:
+show_masked_bins = $track.track_file_style_conditional.show_masked_bins
+      #end if
+      #if $track.track_file_style_conditional.invert_orientation:
+orientation = inverted
+      #end if
+      #if $track.track_file_style_conditional.scale_factor:
+scale_factor = $track.track_file_style_conditional.scale_factor
+      #end if
+rasterize = $track.track_file_style_conditional.rasterize
+      ## If a boundary file is given a new section needs to be written:
+      #if str($track.track_file_style_conditional.boundaries_file) != "None":
+        #if len($track.track_file_style_conditional.boundaries_file)>$counter_matrix:
+          #set boundary_file = $track.track_file_style_conditional.boundaries_file[$counter_matrix]
+        #else:
+          #set boundary_file = $track.track_file_style_conditional.boundaries_file[0]
+        #end if
+[tads_${counter}_${counter_matrix}]
+file = $boundary_file
+file_type = bed
+display = squares
+border_color = black
+color = none
+overlay_previous = share-y
+      #end if
+      ## If spacer is asked a new section is created:
+      #if $track.track_file_style_conditional.spacer_height != "":
+[spacer]
+height = $track.track_file_style_conditional.spacer_height
+      #end if
+    #end for
+  #end if
+
   ## Chrom_state track
   #if $track.track_file_style_conditional.track_file_style_selector == "chrom_states_option":
     #for $data_bed in $track.track_file_style_conditional.track_input_bed:
@@ -148,7 +216,10 @@
 file = $data_bed
       #if $ext == 'gtf':
 prefered_name = $track.track_file_style_conditional.bed_style.bed_advanced.gtf.prefered_name
-merge_transcripts = $track.track_file_style_conditional.bed_style.bed_advanced.gtf.merge_transcripts
+        #if $track.track_file_style_conditional.bed_style.bed_advanced.gtf.merge_transcripts.merge_transcripts_select == 'true':
+merge_transcripts = true
+merge_overlapping_exons = $track.track_file_style_conditional.bed_style.bed_advanced.gtf.merge_transcripts.merge_overlapping_exons
+        #end if
       #end if
       #if $track.track_file_style_conditional.title:
 title = $track.track_file_style_conditional.title
@@ -168,6 +239,11 @@
 style = $track.track_file_style_conditional.bed_style.bed_style_select
       #if $track.track_file_style_conditional.bed_style.bed_style_select == 'UCSC':
 arrow_interval = $track.track_file_style_conditional.bed_style.bed_advanced.arrow_interval
+        #if $track.track_file_style_conditional.bed_style.bed_advanced.backbone_color_bed.backbone_color_bed_select == 'manually':
+color_backbone = $track.track_file_style_conditional.bed_style.bed_advanced.backbone_color_bed.color
+        #else
+color_backbone = $track.track_file_style_conditional.bed_style.bed_advanced.backbone_color_bed.backbone_color_bed_select
+        #end if
       #else:
 height_utr = $track.track_file_style_conditional.bed_style.bed_advanced.height_utr
         #if $track.track_file_style_conditional.bed_style.bed_advanced.color_utr.color_utr_select == 'manually':
@@ -175,6 +251,7 @@
         #elif $track.track_file_style_conditional.bed_style.bed_advanced.color_utr.color_utr_select == 'bed_rgb':
 color_utr = bed_rgb
         #else:
+        ## This is 'like'
           #if $track.track_file_style_conditional.color_bed.color_bed_select == "bed_rgb":
 color_utr = bed_rgb
           #else:
@@ -186,6 +263,12 @@
         #end if
         #if $track.track_file_style_conditional.bed_style.bed_style_select == 'flybase':
 arrowhead_included = $track.track_file_style_conditional.bed_style.arrowhead_included
+arrowhead_fraction = $track.track_file_style_conditional.bed_style.arrowhead_fraction
+          #if $track.track_file_style_conditional.bed_style.bed_advanced.backbone_color_bed.backbone_color_bed_select == 'manually':
+color_backbone = $track.track_file_style_conditional.bed_style.bed_advanced.backbone_color_bed.color
+          #else
+color_backbone = $track.track_file_style_conditional.bed_style.bed_advanced.backbone_color_bed.backbone_color_bed_select
+          #end if
         #end if
       #end if
 display = $track.track_file_style_conditional.display
@@ -196,11 +279,12 @@
       #if $track.track_file_style_conditional.labels.plot_labels == 'true':
 all_labels_inside = $track.track_file_style_conditional.labels.all_labels_inside
 labels_in_margin = $track.track_file_style_conditional.labels.labels_in_margin
+fontstyle = $track.track_file_style_conditional.labels.fontstyle
+        #if $track.track_file_style_conditional.labels.fontsize:
+fontsize = $track.track_file_style_conditional.labels.fontsize
+        #end if
       #end if
 file_type = $ext
-      #if $track.track_file_style_conditional.fontsize:
-fontsize = $track.track_file_style_conditional.fontsize
-      #end if
       #if $track.track_file_style_conditional.bed_style.bed_advanced.gene_rows:
 gene_rows = $track.track_file_style_conditional.bed_style.bed_advanced.gene_rows
       #end if
@@ -241,12 +325,17 @@
 alpha = $track.track_file_style_conditional.alpha
 line_width = $track.track_file_style_conditional.line_width
 line_style = $track.track_file_style_conditional.line_style
-links_type = $track.track_file_style_conditional.links_type
-compact_arcs_level = $track.track_file_style_conditional.compact_arcs_level
-    #if $track.track_file_style_conditional.ylim != "":
-ylim = $track.track_file_style_conditional.ylim
+links_type = $track.track_file_style_conditional.display.links_type
+    #if $track.track_file_style_conditional.display.links_type in ['arcs', 'triangles']:
+compact_arcs_level = $track.track_file_style_conditional.display.compact_arcs_level
+use_middle = $track.track_file_style_conditional.display.use_middle
     #end if
-use_middle = $track.track_file_style_conditional.use_middle
+    #if $track.track_file_style_conditional.display.links_type != 'squares' and $track.track_file_style_conditional.display.ylim != "":
+ylim = $track.track_file_style_conditional.display.ylim
+    #end if
+    #if $track.track_file_style_conditional.display.links_type == 'squares' and $track.track_file_style_conditional.display.region2 != "":
+region2 = $track.track_file_style_conditional.display.region2
+    #end if
     #if $track.track_file_style_conditional.invert_orientation:
 orientation = inverted
     #end if
@@ -288,10 +377,12 @@
 height = $track.track_file_style_conditional.height_narrow_peak
       #end if
 line_width = $track.track_file_style_conditional.line_width
-show_labels = $track.track_file_style_conditional.show_labels
 file_type = narrow_peak
-      #if $track.track_file_style_conditional.fontsize:
-fontsize = $track.track_file_style_conditional.fontsize
+show_labels = $track.track_file_style_conditional.labels.show_labels
+      #if $track.track_file_style_conditional.labels.show_labels == 'true':
+        #if $track.track_file_style_conditional.labels.fontsize:
+fontsize = $track.track_file_style_conditional.labels.fontsize
+        #end if
       #end if
       #if $track.track_file_style_conditional.invert_orientation:
 orientation = inverted
@@ -469,6 +560,8 @@
 show_data_range = $track.track_file_style_conditional.type.show_data
 plot_horizontal_lines = $track.track_file_style_conditional.type.plot_horizontal_lines
 pos_score_in_bin = $track.track_file_style_conditional.type.pos_score_in_bin
+individual_color = $track.track_file_style_conditional.type.individual_color
+summary_color = $track.track_file_style_conditional.type.summary_color
       #else
 colormap = $track.track_file_style_conditional.type.colormap
       #end if
@@ -491,6 +584,15 @@
 type = vlines
   #end if
 
+  ## Vhighlight:
+  #if $track.track_file_style_conditional.track_file_style_selector == "vhighlight_track_option":
+[vhighlight_$counter]
+file = $track.track_file_style_conditional.track_input_bed_single
+color = $track.track_file_style_conditional.color
+alpha = $track.track_file_style_conditional.alpha
+type = vhighlight
+  #end if
+
   ## Hlines:
   #if $track.track_file_style_conditional.track_file_style_selector == "hlines_track_option":
 [hlines_$counter]
@@ -579,6 +681,9 @@
     #if $track.track_file_style_conditional.fontsize != "":
 fontsize = $track.track_file_style_conditional.fontsize
     #end if
+    #if $track.track_file_style_conditional.height != "":
+height = $track.track_file_style_conditional.height
+    #end if
 file_type = scalebar
     ## If spacer is asked a new section is created:
     #if $track.track_file_style_conditional.spacer_height != "":
@@ -586,12 +691,74 @@
 height = $track.track_file_style_conditional.spacer_height
     #end if
   #end if
+
+  ## Fasta:
+  #if $track.track_file_style_conditional.track_file_style_selector == "fasta_option":
+[Fasta_${counter}]
+    #if $track.track_file_style_conditional.fasta_source.fasta_source_selector == "history":
+file = fasta_${counter}.fa
+    #else:
+file = $track.track_file_style_conditional.fasta_source.fasta_cached.fields.path
+    #end if
+    #if $track.track_file_style_conditional.title:
+title = $track.track_file_style_conditional.title
+    #end if
+    #if $track.track_file_style_conditional.height != "":
+height = $track.track_file_style_conditional.height
+    #end if
+    #if $track.track_file_style_conditional.invert_orientation:
+orientation = inverted
+    #end if
+overlay_previous = $track.track_file_style_conditional.overlay_select
+file_type = fasta
+    ## If spacer is asked a new section is created:
+    #if $track.track_file_style_conditional.spacer_height != "":
+[spacer]
+height = $track.track_file_style_conditional.spacer_height
+    #end if
+  #end if
+
+  ## Maf:
+  #if $track.track_file_style_conditional.track_file_style_selector == "maf_option":
+[Maf_${counter}]
+file = $track.track_file_style_conditional.track_input_maf
+file_index = $track.track_file_style_conditional.track_input_maf.metadata.maf_index
+reference = $track.track_file_style_conditional.reference
+    #if $track.track_file_style_conditional.title:
+title = $track.track_file_style_conditional.title
+    #end if
+    #if $track.track_file_style_conditional.height != "":
+height = $track.track_file_style_conditional.height
+    #end if
+    #if $track.track_file_style_conditional.invert_orientation:
+orientation = inverted
+    #end if
+overlay_previous = $track.track_file_style_conditional.overlay_select
+line_width = $track.track_file_style_conditional.line_width
+color_identical = $track.track_file_style_conditional.color_identical
+color_mismatch = $track.track_file_style_conditional.color_mismatch
+color_gap = $track.track_file_style_conditional.color_gap
+    #if $track.track_file_style_conditional.species_order != "":
+species_order = $track.track_file_style_conditional.species_order
+      #if $track.track_file_style_conditional.species_labels != "":
+species_labels = $track.track_file_style_conditional.species_labels
+      #end if
+species_order_only = $track.track_file_style_conditional.species_order_only
+    #end if
+display_ref_seq = $track.track_file_style_conditional.display_ref_seq
+file_type = maf
+    ## If spacer is asked a new section is created:
+    #if $track.track_file_style_conditional.spacer_height != "":
+[spacer]
+height = $track.track_file_style_conditional.spacer_height
+    #end if
+  #end if
 #end for
 </configfile>
     </configfiles>
     <inputs>
         <!--Arguments for pgt-->
-        <param argument="--region" type="text" label="Region of the genome to limit the operation" optional="false"
+        <param argument="--region" type="text" label="Region of the genome to plot" optional="false"
             help="The format is chr:start-end, for example chr10:10-500">
             <validator type="expression" message="Region should be like chr10:10-500">'^[a-zA-Z0-9_]:\d+-\d+$'</validator>
         </param>
@@ -621,7 +788,8 @@
             The order you add them represent the order they will be plotted from top to bottom.">
             <conditional name="track_file_style_conditional">
                 <param name="track_file_style_selector" type="select" label="Choose style of the track">
-                    <option value="hic_matrix_option">TAD visualization</option>
+                    <option value="hic_matrix_option">TAD visualization (triangle)</option>
+                    <option value="hic_matrix_square_option">TAD visualization (square)</option>
                     <option value="chrom_states_option">Chromatine states</option>
                     <option value="gene_track_option">Gene track / Bed track</option>
                     <option value="link_track_option">Link track</option>
@@ -630,10 +798,13 @@
                     <option value="bedgraph_track_option">Bedgraph track </option>
                     <option value="bedgraph_matrix_track_option">Bedgraph matrix track/TAD score</option>
                     <option value="vlines_track_option">Vlines track</option>
+                    <option value="vhighlight_track_option">Vhighlight track</option>
                     <option value="hlines_track_option">Hlines track</option>
                     <option value="spacer_option">Spacer</option>
                     <option value="xaxis_option">X-axis</option>
                     <option value="scale_bar_option">Scale bar track</option>
+                    <option value="fasta_option">Fasta track</option>
+                    <option value="maf_option">Maf track</option>
                 </param>
                 <when value="hic_matrix_option">
                     <expand macro="plot_title" />
@@ -644,8 +815,8 @@
                         <option value="viridis">viridis</option>
                         <expand macro="colormap_macro_noRdYlBu_r_noViridis"/>
                     </param>
+                    <expand macro="minmax_macro" />
                     <param name="depth" type="integer" value="8000000" optional="True" label="Depth" />
-                    <expand macro="minmax_macro" />
                     <param name="transform" type="select" label="Plot the transformed value">
                         <option value="log1p" selected="True" >log1p</option>
                         <option value="log">log</option>
@@ -653,10 +824,40 @@
                         <option value="no">no transformation</option>
 
                     </param>
-                    <param name="height_matrix" type="float" value="" optional="True" label="height"/>
+                    <param name="height_matrix" type="float" value="" optional="True" label="height of the heatmap" help="If you leave it empty the height is calculated to have perfect squares rotated 45 degrees."/>
                     <param name="show_masked_bins" type="boolean" truevalue="true" falsevalue="false" checked="false"
-                            label="Show masked bins" />
-                    <param name="boundaries_file" type="data" optional="True" format="bed" label="Boundaries file" multiple="True"/>
+                            label="Show masked bins" help="If false, neighbour bins will be increase in size to hide the mask bins." />
+                    <param name="boundaries_file" type="data" optional="True" format="bed" label="Boundaries file" multiple="True" help="Will display triangles on top of the heatmap"/>
+                    <param name="scale_factor" type="float" value="1.0" optional="True" label="Scale factor" help="if the values in the matrix need to be scaled the following parameter can be used" />
+                    <param name="rasterize" type="boolean" truevalue="true" falsevalue="false" checked="true"
+                            label="Rasterize the heatmap" />
+                    <expand macro="inverted_macro" />
+                    <expand macro="spacer_macro" />
+
+                </when>
+
+                <when value="hic_matrix_square_option">
+                    <expand macro="plot_title" />
+                    <expand macro="matrix_h5_cooler_multiple_macro" />
+
+                    <param name="colormap" type="select" label="Color map to use for the heatmap" help="Available color map names can be found here: https://matplotlib.org/examples/color/colormaps_reference.html">
+                        <option value="RdYlBu_r">RdYlBu reversed</option>
+                        <option value="viridis">viridis</option>
+                        <expand macro="colormap_macro_noRdYlBu_r_noViridis"/>
+                    </param>
+                    <expand macro="minmax_macro" />
+                    <expand macro="region2_option" />
+                    <param name="transform" type="select" label="Plot the transformed value">
+                        <option value="log1p" selected="True" >log1p</option>
+                        <option value="log">log</option>
+                        <option value="-log">-log</option>
+                        <option value="no">no transformation</option>
+
+                    </param>
+                    <param name="height_matrix" type="float" value="" optional="True" label="height of the heatmap" help="If you leave it empty the height is calculated to have perfect squares."/>
+                    <param name="show_masked_bins" type="boolean" truevalue="true" falsevalue="false" checked="false"
+                        label="Show masked bins" help="If false, neighbour bins will be increase in size to hide the mask bins." />
+                    <param name="boundaries_file" type="data" optional="True" format="bed" label="Boundaries file" multiple="True" help="Will display squares on top of the heatmap"/>
                     <param name="scale_factor" type="float" value="1.0" optional="True" label="Scale factor" help="if the values in the matrix need to be scaled the following parameter can be used" />
                     <param name="rasterize" type="boolean" truevalue="true" falsevalue="false" checked="true"
                             label="Rasterize the heatmap" />
@@ -729,6 +930,12 @@
                             <param name="labels_in_margin" type="boolean" truevalue="true" falsevalue="false" checked="false"
                                 label="Allow to put labels in the right margin"
                                 help="Put labels in the margin if the region ends after the plotted region."/>
+                            <param name="fontsize" type="integer" value="" optional="True" label="Fontsize" />
+                            <param name="fontstyle" type="select" label="Fontstyle">
+                                <option value="normal" selected="True">normal</option>
+                                <option value="italic">italic</option>
+                                <option value="oblique">oblique</option>
+                            </param>
                         </when>
                         <when value="false"/>
                     </conditional>
@@ -737,8 +944,8 @@
                         <option value="interleaved">interleaved (everything on 2 lines)</option>
                         <option value="collapsed">collapsed (everything on 1 line)</option>
                         <option value="triangles">triangles (plot triangles between start and end)</option>
+                        <option value="squares">squares (plot squares on the diagonal)</option>
                     </param>
-                    <param name="fontsize" type="integer" value="" optional="True" label="Fontsize" />
                     <conditional name="bed_style">
                         <param name="bed_style_select" type="select" label="Bed style">
                             <option value="flybase" selected="True">flybase (blocks with arrow at extremities)</option>
@@ -749,15 +956,20 @@
                             <param name="arrowhead_included" type="boolean" truevalue="true" falsevalue="false" checked="false"
                                 label="Include the arrowhead in the bed interval:"
                                 help="When set to False, the arrow indicating the orientation of the interval is plotted outside of the interval."/>
+                            <param name="arrowhead_fraction" type="float" value="0.004" min="0" max="1"
+                                label="Size of arrowhead relative to the plotted region"
+                                help="This size is also used to put space between the bed regions and their labels."/>
                             <section name="bed_advanced" title="Configure other bed parameters" expanded="False">
                                 <expand macro="utr_macro" />
                                 <expand macro="bed_advanced_macro" />
+                                <expand macro="backbone_color_bed_macro" />
                             </section>
                         </when>
                         <when value="UCSC">
                             <section name="bed_advanced" title="Configure other bed parameters" expanded="False">
                                 <param name="arrow_interval" type="integer" value="2" min="0" label="interval between 2 arrows on introns in UCSC style"/>
                                 <expand macro="bed_advanced_macro" />
+                                <expand macro="backbone_color_bed_macro" />
                             </section>
                         </when>
                         <when value="tssarrow">
@@ -793,21 +1005,28 @@
                         </when>
                     </conditional>
                     <expand macro="lines_macro" />
-                    <param name="links_type" type="select" label="Representation of the link:">
-                        <option value="arcs" selected="True">arcs (a line between the centers of the 2 regions)</option>
-                        <option value="triangles">triangles</option>
-                        <option value="loops">loops (a rectangle highlighting the intersection)</option>
-                    </param>
-                    <param name="compact_arcs_level" type="select" label="Height of arcs and triangles:">
-                        <option value="0" selected="True">default (proportional to distance)</option>
-                        <option value="1">compacted (the height is proportional to the square root of the distance)</option>
-                        <option value="2">highly compacted (the height is the same for all distances)</option>
-                    </param>
-                    <param name="ylim" type="float" optional="True" label="ylim" help="To be able to see small arcs when big arcs exists, you can set the upper y limit. The unit is bp. This corresponds to the longest arc you will see not truncated."/>
-                    <param name="use_middle" type="select" label="Coordinates to use" help="Not useful with loops">
-                        <option value="false" selected="True">Extremities (start of first and end of second)</option>
-                        <option value="true">Center (mean of start and end for each)</option>
-                    </param>
+                    <conditional name="display">
+                        <param name="links_type" type="select" label="Representation of the link:">
+                            <option value="arcs" selected="True">arcs (a line between the centers of the 2 regions)</option>
+                            <option value="triangles">triangles</option>
+                            <option value="loops">loops (a diamond highlighting the intersection)</option>
+                            <option value="squares">squares (a square highlighting the intersection symetrically to the diagonal)</option>
+                        </param>
+                        <when value="arcs">
+                            <expand macro="links_arcs_triangles_options" />
+                            <param name="ylim" type="float" optional="True" label="ylim" help="To be able to see small arcs when big arcs exists, you can set the upper y limit. The unit is bp. This corresponds to the longest arc you will see not truncated."/>
+                        </when>
+                        <when value="triangles">
+                            <expand macro="links_arcs_triangles_options" />
+                            <param name="ylim" type="float" optional="True" label="ylim" help="To be able to see small arcs when big arcs exists, you can set the upper y limit. The unit is bp. This corresponds to the longest arc you will see not truncated."/>
+                        </when>
+                        <when value="loops">
+                            <param name="ylim" type="float" optional="True" label="ylim" help="To be able to see small arcs when big arcs exists, you can set the upper y limit. The unit is bp. This corresponds to the longest arc you will see not truncated."/>
+                        </when>
+                        <when value="squares">
+                            <expand macro="region2_option" />
+                        </when>
+                    </conditional>
                     <param name="height" type="float" value="1.5" optional="True" label="height"/>
                     <expand macro="minmax_macro" />
                     <expand macro="overlay_macro" />
@@ -839,9 +1058,16 @@
                         </when>
                     </conditional>
                     <param name="line_width" type="float" value="1" label="width of lines" />
-                    <param name="show_labels" type="boolean" truevalue="true" falsevalue="false" checked="true"
-                            label="Plot labels (name, p-val, q-val)" />
-                    <param name="fontsize" type="integer" value="" optional="True" label="Fontsize" />
+                    <conditional name="labels">
+                        <param name="show_labels" type="select" label="Plot labels (name, p-val, q-val)">
+                            <option value="true" selected="True">yes</option>
+                            <option value="false">no</option>
+                        </param>
+                        <when value="true">
+                            <param name="fontsize" type="integer" value="" optional="True" label="Fontsize" />
+                        </when>
+                        <when value="false"/>
+                    </conditional>
                     <expand macro="overlay_macro" />
                     <expand macro="inverted_macro" />
                     <expand macro="spacer_macro" />
@@ -939,6 +1165,8 @@
                                 <option value="center" selected="True">Center</option>
                                 <option value="block">Block (draw a horizontal line between start and end)</option>
                             </param>
+                            <param name="individual_color" type="color" value="grey" label="Color of the individual lines" />
+                            <param name="summary_color" type="color" value="#1f77b4" label="Color of the summary line" />
                         </when>
                         <when value="matrix">
                             <param name="colormap" type="select" label="colormap">
@@ -958,12 +1186,17 @@
                     <expand macro="track_input_bed_single_macro" />
                     <param name="line_width" type="float" value="0.5" label="width of lines"/>
                 </when>
+                <when value="vhighlight_track_option">
+                    <expand macro="track_input_bed_single_macro" />
+                    <param name="color" type="color" value="yellow" label="color of the highlight"/>
+                    <param name="alpha" type="float" value="0.5" min="0" max="1" label="transparency (alpha) of the highlight"/>
+                </when>
                 <when value="hlines_track_option">
                     <expand macro="plot_title" />
                     <param name="y_values" type="text" value="10, 200" label="Values where horizontal lines should be plotted separated by comma"/>
                     <param name="color" type="color" value="#000000" label="Color of line(s)" optional="True" />
                     <expand macro="lines_macro" />
-                    <param name="height" type="float" value="1.5" optional="True" label="height"/>
+                    <param name="height" type="float" value="1.5" optional="True" label="height of the Hlines track"/>
                     <expand macro="minmax_macro" />
                     <param name="show_data" type="boolean" truevalue="true" falsevalue="false" checked="false" label="Show visualization of data range"/>
                     <expand macro="inverted_macro" />
@@ -1006,6 +1239,39 @@
                     </param>
                     <param name="fontsize" type="float" optional="True"
                         label="Fontsize of the size of the scale bar."/>
+                    <param name="height" type="float" value="0.5" optional="True" label="height of the Scale bar track"/>
+                    <expand macro="spacer_macro" />
+                </when>
+                <when value="fasta_option">
+                    <expand macro="track_input_fasta_macro" />
+                    <expand macro="plot_title" />
+                    <param name="height" type="float" value="0.5" optional="True" label="height of the Fasta track"/>
+                    <expand macro="inverted_macro" />
+                    <expand macro="overlay_macro" />
+                    <expand macro="spacer_macro" />
+                </when>
+                <when value="maf_option">
+                    <expand macro="track_input_maf_macro" />
+                    <expand macro="plot_title" />
+                    <param name="height" type="float" value="0.5" optional="True" label="height of the Fasta track"/>
+                    <param name="reference" type="select" label="Reference">
+                        <options>
+                            <filter type="data_meta" ref="track_input_maf" key="species" />
+                        </options>
+                    </param>
+                    <param name="line_width" type="float" value="0.5" label="width of lines"/>
+                    <param name="color_identical" type="color" label="Color when bases are identical" value="black" />
+                    <param name="color_mismatch" type="color" label="Color when bases are different" value="grey" />
+                    <param name="color_gap" type="color" label="Color when bases corresponds to gap" value="lightgrey" />
+                    <param name="species_order" type="text" value="" label="[Optional] The order you want your species (space separated)"
+                        help="checkout the choices for reference to see available species"/>
+                    <param name="species_labels" type="text" value="" label="[Optional] The label you want for the above species (space separated)"/>
+                    <param name="species_order_only" type="boolean" truevalue="true" falsevalue="false" checked="false"
+                        label="Display only the species specified above"/>
+                    <param name="display_ref_seq" type="boolean" truevalue="true" falsevalue="false" checked="false"
+                        label="Display the sequence of the reference"/>
+                    <expand macro="inverted_macro" />
+                    <expand macro="overlay_macro" />
                     <expand macro="spacer_macro" />
                 </when>
             </conditional>
@@ -1154,7 +1420,9 @@
                     <param name="track_input_bed" value="dm3_genes.bed.gz" ftype="bed" />
                     <param name="title" value="genes" />
                     <param name="height_bed" value="5" />
-                    <param name="fontsize" value="10" />
+                    <conditional name="labels">
+                        <param name="fontsize" value="10" />
+                    </conditional>
                 </conditional>
             </repeat>
             <repeat name="tracks">
@@ -1169,7 +1437,9 @@
                     <param name="track_input_bed" value="dm3_genes.bed.gz" ftype="bed" />
                     <param name="title" value="max num rows 3" />
                     <param name="height_bed" value="3" />
-                    <param name="fontsize" value="8" />
+                    <conditional name="labels">
+                        <param name="fontsize" value="8" />
+                    </conditional>
                     <conditional name="bed_style">
                         <section name="bed_advanced">
                             <param name="gene_rows" value="3" />
@@ -1189,7 +1459,9 @@
                     <param name="track_input_bed" value="dm3_genes.bed6.gz" ftype="bed" />
                     <param name="title" value="bed6 global max row" />
                     <param name="height_bed" value="20" />
-                    <param name="fontsize" value="10" />
+                    <conditional name="labels">
+                        <param name="fontsize" value="10" />
+                    </conditional>
                     <conditional name="bed_style">
                         <section name="bed_advanced">
                             <param name="global_max_row" value="true" />
@@ -1416,7 +1688,9 @@
                     <param name="track_input_bed" value="dm3_genes.bed.gz" ftype="bed" />
                     <param name="title" value="genes in ucsc" />
                     <param name="height_bed" value="5" />
-                    <param name="fontsize" value="10" />
+                    <conditional name="labels">
+                        <param name="fontsize" value="10" />
+                    </conditional>
                     <conditional name="bed_style">
                         <param name="bed_style_select" value="UCSC"/>
                     </conditional>
@@ -1428,7 +1702,9 @@
                     <param name="track_input_bed" value="dm3_genes.bed6.gz" ftype="bed" />
                     <param name="title" value="bed6 global max row color from score" />
                     <param name="height_bed" value="20" />
-                    <param name="fontsize" value="10" />
+                    <conditional name="labels">
+                        <param name="fontsize" value="10" />
+                    </conditional>
                     <conditional name="bed_style">
                         <section name="bed_advanced">
                             <param name="global_max_row" value="true" />
@@ -1446,7 +1722,6 @@
                     <param name="track_input_bed" value="domains.bed" ftype="bed" />
                     <param name="title" value="domains.bed using the 9th field for colors interleaved border=red" />
                     <param name="height_bed" value="2" />
-                    <param name="fontsize" value="10" />
                     <conditional name="color_bed">
                         <param name="color_bed_select" value="bed_rgb" />
                     </conditional>
@@ -1466,7 +1741,6 @@
                     <param name="track_input_bed" value="domains.bed" ftype="bed" />
                     <param name="title" value="domains.bed using the 9th field for colors interleaved border=bed_rgb" />
                     <param name="height_bed" value="2" />
-                    <param name="fontsize" value="10" />
                     <conditional name="color_bed">
                         <param name="color_bed_select" value="bed_rgb" />
                     </conditional>
@@ -1485,7 +1759,6 @@
                     <param name="track_input_bed" value="domains.bed" ftype="bed" />
                     <param name="title" value="domains.bed using the 9th field for colors interleaved border=none" />
                     <param name="height_bed" value="2" />
-                    <param name="fontsize" value="10" />
                     <conditional name="color_bed">
                         <param name="color_bed_select" value="bed_rgb" />
                     </conditional>
@@ -1591,7 +1864,6 @@
                         <param name="display_selector" value="box" />
                         <param name="use_summit" value="true" />
                     </conditional>
-                    <param name="show_labels" value="true" />
                 </conditional>
             </repeat>
             <repeat name="tracks">
@@ -1606,7 +1878,6 @@
                         <param name="display_selector" value="box" />
                         <param name="use_summit" value="true" />
                     </conditional>
-                    <param name="show_labels" value="true" />
                 </conditional>
             </repeat>
             <repeat name="tracks">
@@ -1623,7 +1894,9 @@
                         <param name="width_adjust" value="3" />
                         <param name="max_value" value="50" />
                     </conditional>
-                    <param name="show_labels" value="false" />
+                    <conditional name="labels">
+                        <param name="show_labels" value="false" />
+                    </conditional>
                     <param name="spacer_height" value="0.5"/>
                 </conditional>
             </repeat>
@@ -1639,7 +1912,6 @@
                         <param name="use_summit" value="false" />
                         <param name="show_data" value="false" />
                     </conditional>
-                    <param name="show_labels" value="true" />
                 </conditional>
             </repeat>
             <repeat name="tracks">
@@ -1663,8 +1935,8 @@
             <repeat name="tracks">
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="gene_track_option" />
-                    <param name="track_input_bed" value="dm3_genes.bed.gz" ftype="bed" />
-                    <param name="title" value="genes" />
+                    <param name="track_input_bed" value="dm3_subset_BDGP5.78.gtf.gz" ftype="gtf" />
+                    <param name="title" value="gtf default" />
                     <param name="height_bed" value="10" />
                 </conditional>
             </repeat>
@@ -1672,7 +1944,7 @@
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="gene_track_option" />
                     <param name="track_input_bed" value="dm3_subset_BDGP5.78.gtf.gz" ftype="gtf" />
-                    <param name="title" value="gtf" />
+                    <param name="title" value="gtf merge transcripts, use gene_name, red 0.75 UTR" />
                     <param name="height_bed" value="10" />
                     <conditional name="bed_style">
                         <section name="bed_advanced">
@@ -1683,7 +1955,34 @@
                             </conditional>
                             <section name ="gtf">
                                 <param name="prefered_name" value="gene_name"/>
-                                <param name="merge_transcripts" value="true"/>
+                                <conditional name="merge_transcripts">
+                                    <param name="merge_transcripts_select" value="true"/>
+                                    <param name="merge_overlapping_exons" value="false"/>
+                                </conditional>
+                            </section>
+                        </section>
+                    </conditional>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="gene_track_option" />
+                    <param name="track_input_bed" value="dm3_subset_BDGP5.78.gtf.gz" ftype="gtf" />
+                    <param name="title" value="same but merge overlapping exons" />
+                    <param name="height_bed" value="10" />
+                    <conditional name="bed_style">
+                        <section name="bed_advanced">
+                            <param name="height_utr" value="0.75"/>
+                            <conditional name="color_utr">
+                                <param name="color_utr_select" value="manually"/>
+                                <param name="color" value="#ff0000"/>
+                            </conditional>
+                            <section name ="gtf">
+                                <param name="prefered_name" value="gene_name"/>
+                                <conditional name="merge_transcripts">
+                                    <param name="merge_transcripts_select" value="true"/>
+                                    <param name="merge_overlapping_exons" value="true"/>
+                                </conditional>
                             </section>
                         </section>
                     </conditional>
@@ -1811,16 +2110,34 @@
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="gene_track_option" />
                     <param name="track_input_bed" value="dm3_subset_BDGP5.78.gtf.gz" ftype="gtf" />
-                    <param name="title" value="test" />
+                    <param name="title" value="defaut arrowhead fontstyle italic" />
                     <param name="height_bed" value="10" />
                     <param name="spacer_height" value="1"/>
+                    <conditional name="labels">
+                        <param name="fontstyle" value="italic"/>
+                    </conditional>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="gene_track_option" />
+                    <param name="track_input_bed" value="dm3_subset_BDGP5.78.gtf.gz" ftype="gtf" />
+                    <param name="title" value="arrowhead_fraction 0.1 fontstyle oblique" />
+                    <param name="height_bed" value="10" />
+                    <param name="spacer_height" value="1"/>
+                    <conditional name="labels">
+                        <param name="fontstyle" value="oblique"/>
+                    </conditional>
+                    <conditional name="bed_style">
+                        <param name="arrowhead_fraction" value="0.1"/>
+                    </conditional>
                 </conditional>
             </repeat>
             <repeat name="tracks">
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="gene_track_option" />
                     <param name="track_input_bed" value="dm3_subset_BDGP5.78_asbed4.bed.gz" ftype="bed" />
-                    <param name="title" value="test" />
+                    <param name="title" value="genes without orientation" />
                     <param name="height_bed" value="10" />
                     <conditional name="color_bed">
                         <param name="color_bed_select" value="manually" />
@@ -1836,7 +2153,7 @@
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="gene_track_option" />
                     <param name="track_input_bed" value="dm3_subset_BDGP5.78.gtf.gz" ftype="gtf" />
-                    <param name="title" value="test" />
+                    <param name="title" value="arrowhead included" />
                     <param name="height_bed" value="10" />
                     <conditional name="color_bed">
                         <param name="color_bed_select" value="manually" />
@@ -1938,7 +2255,7 @@
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="bedgraph_matrix_track_option" />
                     <param name="track_input_bedgraph_matrix" value="tad_score.gz" ftype="bedgraph" />
-                    <param name="title" value="TAD separation score (Ramirez et al.)" />
+                    <param name="title" value="TAD separation score (Ramirez et al.) as block with horizontal lines and data range" />
                     <param name="height_bedgraph" value="10" />
                     <conditional name="type">
                         <param name="type_selector" value="lines" />
@@ -1952,12 +2269,14 @@
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="bedgraph_matrix_track_option" />
                     <param name="track_input_bedgraph_matrix" value="tad_score.gz" ftype="bedgraph" />
-                    <param name="title" value="TAD separation score (Ramirez et al.)" />
+                    <param name="title" value="TAD separation score (Ramirez et al.) as center without horizontal lines, summary in red and individual in blue" />
                     <param name="height_bedgraph" value="10" />
                     <conditional name="type">
                         <param name="type_selector" value="lines" />
                         <param name="pos_score_in_bin" value="center" />
                         <param name="plot_horizontal_lines" value="false" />
+                        <param name="individual_color" value="blue"/>
+                        <param name="summary_color" value="red"/>
                     </conditional>
                 </conditional>
             </repeat>
@@ -1989,7 +2308,9 @@
                     <param name="track_input_link" value="test.arcs" ftype="bed" />
                     <param name="title" value="" />
                     <param name="line_width" value="10" />
-                    <param name="links_type" value="loops" />
+                    <conditional name="display">
+                        <param name="links_type" value="loops" />
+                    </conditional>
                     <conditional name="color_link">
                         <param name="color_link_select" value="manually" />
                         <param name="color" value="red" />
@@ -2037,7 +2358,9 @@
                         <param name="color_link_select" value="manually" />
                         <param name="color" value="#000000" />
                     </conditional>
-                    <param name="ylim" value="20000" />
+                    <conditional name="display">
+                        <param name="ylim" value="20000" />
+                    </conditional>
                 </conditional>
             </repeat>
             <repeat name="tracks">
@@ -2049,7 +2372,9 @@
                         <param name="color_link_select" value="manually" />
                         <param name="color" value="#000000" />
                     </conditional>
-                    <param name="compact_arcs_level" value="1" />
+                    <conditional name="display">
+                        <param name="compact_arcs_level" value="1" />
+                    </conditional>
                 </conditional>
             </repeat>
             <repeat name="tracks">
@@ -2061,7 +2386,9 @@
                         <param name="color_link_select" value="manually" />
                         <param name="color" value="#000000" />
                     </conditional>
-                    <param name="compact_arcs_level" value="2" />
+                    <conditional name="display">
+                        <param name="compact_arcs_level" value="2" />
+                    </conditional>
                 </conditional>
             </repeat>
             <param name="image_file_format" value="png" />
@@ -2120,20 +2447,33 @@
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="gene_track_option" />
                     <param name="track_input_bed" value="dm3_genes.bed.gz" ftype="bed" />
-                    <param name="title" value="flybase" />
+                    <param name="title" value="flybase backbone blue" />
                     <param name="height_bed" value="10" />
+                    <conditional name="bed_style">
+                        <param name="bed_style_select" value="flybase"/>
+                        <section name="bed_advanced">
+                            <conditional name="backbone_color_bed">
+                                <param name="backbone_color_bed_select" value="manually" />
+                                <param name="color" value="blue" />
+                            </conditional>
+                        </section>
+                    </conditional>
                 </conditional>
             </repeat>
             <repeat name="tracks">
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="gene_track_option" />
                     <param name="track_input_bed" value="dm3_genes.bed.gz" ftype="bed" />
-                    <param name="title" value="UCSC" />
+                    <param name="title" value="UCSC backbone blue" />
                     <param name="height_bed" value="10" />
                     <conditional name="bed_style">
                         <param name="bed_style_select" value="UCSC"/>
                         <section name="bed_advanced">
                             <param name="arrow_interval" value="10"/>
+                            <conditional name="backbone_color_bed">
+                                <param name="backbone_color_bed_select" value="manually" />
+                                <param name="color" value="blue" />
+                            </conditional>
                         </section>
                     </conditional>
                 </conditional>
@@ -2573,7 +2913,9 @@
                         <param name="color" value="red" />
                     </conditional>
                     <param name="line_width" value="5" />
-                    <param name="links_type" value="loops" />
+                    <conditional name="display">
+                        <param name="links_type" value="loops" />
+                    </conditional>
                     <param name="overlay_select" value="share-y" />
                 </conditional>
             </repeat>
@@ -2615,7 +2957,9 @@
                         <param name="color" value="red" />
                     </conditional>
                     <param name="line_width" value="5" />
-                    <param name="links_type" value="loops" />
+                    <conditional name="display">
+                        <param name="links_type" value="loops" />
+                    </conditional>
                     <param name="overlay_select" value="share-y" />
                 </conditional>
             </repeat>
@@ -2628,7 +2972,9 @@
                     </conditional>
                     <param name="line_width" value="3" />
                     <param name="invert_orientation" value="true" />
-                    <param name="use_middle" value="true" />
+                    <conditional name="display">
+                        <param name="use_middle" value="true" />
+                    </conditional>
                     <param name="title" value="links line_width = 3 color RdYlGn use_middle = true" />
                     <param name="height" value="3" />
                 </conditional>
@@ -2655,7 +3001,7 @@
                 <conditional name="track_file_style_conditional">
                     <param name="track_file_style_selector" value="scale_bar_option" />
                     <param name="title" value="scalebar where = right" />
-                    <param name="where" value="right" />
+                    <param name="sb_where" value="right"/>
                     <param name="spacer_height" value="0.5"/>
                 </conditional>
             </repeat>
@@ -2675,7 +3021,7 @@
                     <param name="title" value="scalebar scalebar_start_position = 3200000 scalebar_end_position = 3250000" />
                     <section name="scalebar_pos">
                         <param name="scalebar_start_position" value="3200000"/>
-                        <param name="scalebar_start_position" value="3250000"/>
+                        <param name="scalebar_end_position" value="3250000"/>
                     </section>
                     <param name="spacer_height" value="0.5"/>
                 </conditional>
@@ -2710,7 +3056,6 @@
                         <param name="scalebar_end_position" value="3200000"/>
                         <param name="size" value="50000"/>
                     </section>
-                    <param name="spacer_height" value="0.5"/>
                 </conditional>
             </repeat>
             <repeat name="tracks">
@@ -2722,6 +3067,223 @@
             <param name="image_file_format" value="png" />
             <output name="outFileName" file="master_scale_bar_startend.png" ftype="png" compare="sim_size" delta="100" />
         </test>
+        <!--test 22-->
+        <test>
+            <param name="region" value="chrM:10-30"/>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="scale_bar_option" />
+                    <param name="title" value="scalebar height = 5" />
+                    <param name="sb_where" value="right"/>
+                    <param name="height" value="5"/>
+                    <param name="spacer_height" value="0.5"/>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="fasta_option" />
+                    <param name="title" value="fasta from cached" />
+                    <conditional name="fasta_source">
+                        <param name="fasta_source_selector" value="cached"/>
+                        <param name="fasta_cached" value="chrM"/>
+                    </conditional>
+                    <param name="spacer_height" value="0.5"/>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="fasta_option" />
+                    <param name="title" value="fasta from history height = 5" />
+                    <conditional name="fasta_source">
+                        <param name="fasta_source_selector" value="history"/>
+                        <param name="fasta_local" value="chrM.fa" ftype="fasta" />
+                    </conditional>
+                    <param name="height" value="5"/>
+                </conditional>
+            </repeat>
+            <param name="image_file_format" value="png" />
+            <output name="outFileName" file="master_fasta.png" ftype="png" compare="sim_size" delta="100" />
+        </test>
+        <!--test 23-->
+        <test>
+            <param name="region" value="chrX:3000000-3300000"/>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="xaxis_option" />
+                    <param name="xaxis_where" value="top" />
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="spacer_option" />
+                    <param name="spacer_height" value="0.05" />
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="hic_matrix_option" />
+                    <param name="matrix_h5_cooler_multiple" value="Li_et_al_2015.h5"/>
+                    <param name="title" value="classical depth=300000 with arcs" />
+                    <param name="depth" value="300000" />
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="link_track_option" />
+                    <param name="track_input_link" value="test_wide.arcs" ftype="bed" />
+                    <conditional name="color_link">
+                        <param name="color" value="red" />
+                    </conditional>
+                    <param name="line_width" value="5" />
+                    <conditional name="display">
+                        <param name="links_type" value="loops" />
+                    </conditional>
+                    <param name="overlay_select" value="share-y" />
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="hic_matrix_square_option" />
+                    <param name="matrix_h5_cooler_multiple" value="Li_et_al_2015.h5"/>
+                    <param name="title" value="square with arcs" />
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="link_track_option" />
+                    <param name="track_input_link" value="test_wide.arcs" ftype="bed" />
+                    <conditional name="color_link">
+                        <param name="color" value="red" />
+                    </conditional>
+                    <param name="line_width" value="5" />
+                    <conditional name="display">
+                        <param name="links_type" value="squares" />
+                    </conditional>
+                    <param name="overlay_select" value="share-y" />
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="hic_matrix_square_option" />
+                    <param name="matrix_h5_cooler_multiple" value="Li_et_al_2015.h5"/>
+                    <param name="title" value="square with arcs region2=chrX:3000000-3100000" />
+                    <param name="region2" value="chrX:3000000-3100000"/>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="link_track_option" />
+                    <param name="track_input_link" value="test_wide.arcs" ftype="bed" />
+                    <conditional name="color_link">
+                        <param name="color" value="red" />
+                    </conditional>
+                    <param name="line_width" value="5" />
+                    <conditional name="display">
+                        <param name="links_type" value="squares" />
+                    </conditional>
+                    <param name="overlay_select" value="share-y" />
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="hic_matrix_square_option" />
+                    <param name="matrix_h5_cooler_multiple" value="Li_et_al_2015.h5"/>
+                    <param name="title" value="square with domains, colormap = Blues, tranform = no, region2=chrX:3000000-3100000" />
+                    <param name="region2" value="chrX:3000000-3100000"/>
+                    <param name="colormap" value="Blues"/>
+                    <param name="transform" value="no" />
+                    <param name="boundaries_file" value="tad_classification.bed" />
+                </conditional>
+            </repeat>
+            <param name="image_file_format" value="png" />
+            <output name="outFileName" file="test_matrix_square.png" ftype="png" compare="sim_size" delta="1200" />
+        </test>
+        <!--test 24-->
+        <test>
+            <param name="region" value="2:34704975-34705208"/>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="maf_option" />
+                    <param name="track_input_maf" value="first.maf" ftype="maf"/>
+                    <param name="reference" value="mm10"/>
+                    <param name="title" value="default" />
+                    <param name="spacer_height" value="1"/>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="maf_option" />
+                    <param name="track_input_maf" value="first.maf" ftype="maf"/>
+                    <param name="reference" value="mm10"/>
+                    <param name="title" value="height = 3 show sequence" />
+                    <param name="height" value="3"/>
+                    <param name="display_ref_seq" value="true"/>
+                    <param name="spacer_height" value="1"/>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="maf_option" />
+                    <param name="track_input_maf" value="first.maf" ftype="maf"/>
+                    <param name="reference" value="mm10"/>
+                    <param name="title" value="species_order = hg19 rn5, species_labels = Human Rat" />
+                    <param name="height" value="3"/>
+                    <param name="species_order" value="hg19 rn5"/>
+                    <param name="species_labels" value="Human Rat"/>
+                    <param name="spacer_height" value="1"/>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="maf_option" />
+                    <param name="track_input_maf" value="first.maf" ftype="maf"/>
+                    <param name="reference" value="mm10"/>
+                    <param name="title" value="species_order = hg19, species_labels = Human, species_order_only = true" />
+                    <param name="height" value="3"/>
+                    <param name="species_order" value="hg19"/>
+                    <param name="species_labels" value="Human"/>
+                    <param name="species_order_only" value="true"/>
+                    <param name="spacer_height" value="1"/>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="xaxis_option" />
+                    <param name="xaxis_where" value="bottom" />
+                </conditional>
+            </repeat>
+            <param name="image_file_format" value="png" />
+            <output name="outFileName" file="test_maf.png" ftype="png" compare="sim_size" delta="1200" />
+        </test>
+        <!--test 25-->
+        <test>
+            <param name="region" value="chr2:73,800,000-75,744,000"/>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="bedgraph_track_option" />
+                    <param name="track_input_bedgraph" value="GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz" ftype="bedgraph" />
+                    <param name="title" value="bedgraph color = blue" />
+                    <param name="height_bedgraph" value="5" />
+                    <param name="color" value="blue" />
+                    <param name="show_data" value="true" />
+                    <param name="max_value" value="5" />
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="vhighlight_track_option" />
+                    <param name="track_input_bed_single" value="islands.bed" ftype="bed"/>
+                </conditional>
+            </repeat>
+            <repeat name="tracks">
+                <conditional name="track_file_style_conditional">
+                    <param name="track_file_style_selector" value="xaxis_option" />
+                    <param name="xaxis_where" value="bottom" />
+                </conditional>
+            </repeat>
+            <param name="image_file_format" value="png" />
+            <output name="outFileName" file="test_vhighlight.png" ftype="png" compare="sim_size" delta="1200" />
+        </test>
     </tests>
     <help><![CDATA[
 
@@ -2738,6 +3300,8 @@
     - narrow peaks
     - links
     - Hi-C matrices (cool or HiCExplorer h5)
+    - Fasta
+    - MAF (multiple alignment format)
 
 _________________
 
@@ -2757,10 +3321,13 @@
     - **Bedgraph track:** generic bedgraph track plotting.
     - **Bedgraph matrix track** is used to specifically plot bm files computed by HiCExplorer's ``hicFindTADs`` (TAD seperation scores).
     - **Vlines:** vertical lines drawn on top of all tracks following a bed file. It is used as a visual support where regions start / end over all tracks, for example to display TAD boundaries computed by HiCExplorer's ``hicFindTADs``.
+    - **Vhighlight:** vertical rectangles drawn on top of all tracks following a bed file. It is used as a visual support to highlight some regions.
     - **Hlines:** horizontal lines drawn either by themselves or on top of other tracks.
     - **Spacer:** Add some space between two tracks.
     - **X-axis:** Plot x-axis scale wherever you want.
     - **Scale bar track:** Plot scale bar.
+    - **Fasta track:** Display sequences from fasta.
+    - **Maf track:** Display alignments from maf.
 
 For each track, parameters for the color, the width or the font size can be defined.
 
diff -r a1abfa420d9d -r 7dd841a32245 test-data/bigwig_multiple.png
Binary file test-data/bigwig_multiple.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/chrM.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/chrM.fa	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,333 @@
+>chrM
+GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT
+TTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTG
+GAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATC
+CTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTA
+AAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAAT
+GTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAAATTTCCACCA
+AACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCA
+AACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTT
+TATCTTTTGGCGGTATGCACTTTTAACAGTCACCCCCCAACTAACACATT
+ATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATACAACCCCCGC
+CCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCA
+ACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAA
+GCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAAT
+AGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAA
+GCATCCCCGTTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAGGA
+ACAAGCATCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCAC
+ACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTT
+AACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGC
+GGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTA
+GATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACT
+CCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACAC
+ACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGCCC
+TAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAGAACACTACGAGC
+CACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGAGG
+AGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTC
+AGCCTATATACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAA
+GCGCAAGTACCCACGTAAAGACGTTAGGTCAAGGTGTAGCCCATGAGGTG
+GCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTAT
+GAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTAAGAGTAGAGTGC
+TTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCCTC
+AAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGA
+GGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAA
+CCAGAGTGTAGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCA
+ACTTAACTTGACCGCTCTGAGCTAAACCTAGCCCCAAACCCACTCCACCT
+TACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTATAGGCG
+ATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGATG
+AAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCT
+GCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGA
+CCCCCGAAACCAGACGAGCTACCTAAGAACAGCTAAAAGAGCACACCCGT
+CTATGTAGCAAAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCTAC
+CGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTTAGTTCAACTTTA
+AATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAGTC
+CAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGT
+AAAAAATTTAACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAA
+GCGTTCAAGCTCAACACCCACTACCTAAAAAATCCCAAACATATAACTGA
+ACTCCTCACACCCAATTGGACCAATCTATCACCCTATAGAAGAACTAATG
+TTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAAGCCTGCGTCAGA
+TTAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCAAC
+AAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGA
+AAGGTTAAAAAAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTA
+CCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCCCA
+GTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagcata
+atcacttgttccttaaatagggacctgtatgaatggctccacgagggttc
+agctgtctcttacttttaaccagtgaaattgacctgcccgtgaagaggcg
+ggcataacacagcaagacgagaagaccctatggagctttaatttaTTAAT
+GCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATT
+AAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCAGT
+ACATGCTAAGACTTCACCAGTCAAAGCGAACTACTATACTCAATTGATCC
+AATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATCCT
+ATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGATCA
+GGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATT
+AAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCT
+ATCTACNTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCCT
+ACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTATT
+ATACCCACACCCACCCAAGAACAGGGTTTgttaagatggcagagcccggt
+aatcgcataaaacttaaaactttacagtcagaggttcaattcctcttctt
+aacaacaTACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAAT
+CGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATAC
+AACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCC
+TTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCAC
+ATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCG
+CTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTC
+AACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTC
+AATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCG
+CACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATC
+ATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCT
+TATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGG
+CCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTC
+GACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATA
+CGCCGCAGGCCCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTA
+TTATAATAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGAC
+GCACTCTCCCCTGAACTCTACACAACATATTTTGTCACCAAGACCCTACT
+TCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTCCGCT
+ACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTA
+GCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCC
+CCCTCAAACCTAAGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTA
+AATAATAGGAGCTTAAACCCCCTTATTTctaggactatgagaatcgaacc
+catccctgagaatccaaaattctccgtgccacctatcacaccccatccta
+AAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGG
+TTATACCCTTCCCGTACTAATTAATCCCCTGGCCCAACCCGTCATCTACT
+CTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTT
+TTTACCTGAGTAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCT
+AACCAAAAAAATAAACCCTCGTTCCACAGAAGCTGCCATCAAGTATTTCC
+TCACGCAAGCAACCGCATCCATAATCCTTCTAATAGCTATCCTCTTCAAC
+AATATACTCTCCGGACAATGAACCATAACCAATACTACCAATCAATACTC
+ATCATTAATAATCATAATAGCTATAGCAATAAAACTAGGAATAGCCCCCT
+TTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGC
+CTGCTTCTTCTCACATGACAAAAACTAGCCCCCATCTCAATCATATACCA
+AATCTCTCCCTCACTAAACGTAAGCCTTCTCCTCACTCTCTCAATCTTAT
+CCATCATAGCAGGCAGTTGAGGTGGATTAAACCAAACCCAGCTACGCAAA
+ATCTTAGCATACTCCTCAATTACCCACATAGGATGAATAATAGCAGTTCT
+ACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTATCC
+TAACTACTACCGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACC
+CTACTACTATCTCGCACCTGAAACAAGCTAACATGACTAACACCCTTAAT
+TCCATCCACCCTCCTCTCCCTAGGAGGCCTGCCCCCGCTAACCGGCTTTT
+TGCCCAAATGGGCCATTATCGAAGAATTCACAAAAAACAATAGCCTCATC
+ATCCCCACCATCATAGCCACCATCACCCTCCTTAACCTCTACTTCTACCT
+ACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATATCTAACAACG
+TAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCC
+ACACTCATCGCCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACT
+AATAATCTTATAGAAATTTAGGTTAAATACAGACCAAGAGCCTTCAAAGC
+CCTCAGTAAGTTGCAATACTTAATTTCTGTAACAGCTAAGGACTGCAAAA
+CCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAG
+CCCTTACTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAGCT
+AAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGGAAAA
+AAGGCGGGAGAAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAA
+TTCAATATGAAAATCACCTCGGAGCTGGTAAAAAGAGGCCTAACCCCTGT
+CTTTAGATTTACAGTCCAATGCTTCACTCAGCCATTTTACCTCACCCCCA
+CTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGG
+AACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTC
+TAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGT
+AACGACCACATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAAT
+CTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTAG
+TTCCCCTAATAATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAAC
+ATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGCTCGCATCTGC
+TATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAG
+CAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCC
+TTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCAC
+AACAATTATCAATATAAAACCCCCTGCCATAACCCAATACCAAACGCCCC
+TCTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTC
+CCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAA
+CACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAAC
+ACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCA
+GGCTTCGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGA
+ACCATTTGGATACATAGGTATGGTCTGAGCTATGATATCAATTGGCTTCC
+TAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTA
+GACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCAC
+CGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGA
+AATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACC
+GTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGT
+ACTACACGACACGTACTACGTTGTAGCCCACTTCCACTATGTCCTATCAA
+TAGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTA
+TTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTAT
+CATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCC
+TATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACA
+TGAAACATCCTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAAT
+ATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCC
+TAATAGTAGAAGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCC
+CCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTAGACAaaa
+aaggaaggaatcgaaccccccaaagctggtttcaagccaaccccatggcc
+tccatgactttttcAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTC
+AAAGTTAAATTATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCG
+CAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTTATCAC
+CTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCC
+TGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATC
+TCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCAT
+CCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACG
+AGGTCAACGATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTAC
+TGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACAT
+ACTTCCCCCATTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTG
+ACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATAATTACA
+TCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAAC
+AGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGAC
+CGGGGGTATACTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGT
+TTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAAATAGG
+GCCCGTATTTACCCTATAGCACCCCCTCTACCCCCTCTAGAGCCCACTGT
+AAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAACCAACA
+CCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACCAT
+AATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATAT
+TAAACACAAACTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAA
+AATTATAACAAACCCTGAGAACCAAAATGAACGAAAATCTGTTCGCTTCA
+TTCATTGCCCCCACAATCCTAGGCCTACCCGCCGCAGTACTGATCATTCT
+ATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCATCAACAACCGAC
+TAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAAATGATA
+ACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTT
+AATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCAT
+TTACACCAACCACCCAACTATCTATAAACCTAGCCATGGCCATCCCCTTA
+TGAGCGGGCACAGTGATTATAGGCTTTCGCTCTAAGATTAAAAATGCCCT
+AGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAG
+TTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTA
+CGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGG
+AAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCA
+TCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTA
+ATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAA
+CACATAATGACCCACCAATCACATGCCTATCATATAGTAAAACCCAGCCC
+ATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAG
+CCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTA
+ACCAACACACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAAG
+CACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACG
+GGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTC
+TGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAATTAGGAGGGCA
+CTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACTCC
+TAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCAC
+CATAGTCTAATAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTAT
+TACAATTTTACTGGGTCTCTATTTTACCCTCCTACAAGCCTCAGAGTACT
+TCGAGTCTCCCTTCACCATTTCCGACGGCATCTACGGCTCAACATTTTTT
+GTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCTCAACTTTCCT
+CACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACATC
+ACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTT
+TGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAG
+TATAAATAGTACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAA
+AAAGAGTAATAAACTTCGCCTTAATTTTAATAATCAACACCCTCCTAGCC
+TTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGGCTACAT
+AGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCCC
+GCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTA
+TTTGATCTAGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAAC
+AACTAACCTGCCACTAATAGTTATGTCATCCCTCTTATTAATCATCATCC
+TAGCCCTAAGTCTGGCCTATGAGTGACTACAAAAAGGATTAGACTGAACC
+GAATTGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTA
+TGATAATCATATTTACCAAATGCCCCTCATTTACATAAATATTATACTAG
+CATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATA
+TCCTCCCTACTATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGC
+TACTCTCATAACCCTCAACACCCACTCCCTCTTAGCCAATATTGTGCCTA
+TTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTA
+CTAGTCTCAATCTCCAACACATATGGCCTAGACTACGTACATAACCTAAA
+CCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATATTACTACCACT
+GACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACA
+GCCTAATTATTAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAAC
+AACCTATTTAGCTGTTCCCCAACCTTTTCCTCCGACCCCCTAACAACCCC
+CCTCCTAATACTAACTACCTGACTCCTACCCCTCACAATCATGGCAAGCC
+AACGCCACTTATCCAGTGAACCACTATCACGAAAAAAACTCTACCTCTCT
+ATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGA
+ACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGG
+CTATCATCACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACA
+TACTTCCTATTCTACACCCTAGTAGGCTCCCTTCCCCTACTCATCGCACT
+AATTTACACTCACAACACCCTAGGCTCACTAAACATTCTACTACTCACTC
+TCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAACTTAATATGACTA
+GCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCACTT
+ATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTAC
+TTGCCGCAGTACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACA
+CTCATTCTCAACCCCCTGACAAAACACATAGCCTACCCCTTCCTTGTACT
+ATCCCTATGAGGCATAATTATAACAAGCTCCATCTGCCTACGACAAACAG
+ACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACATAGCCCTCGTA
+GTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTCAT
+TCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAA
+ACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGA
+CTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCT
+CGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTG
+TGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGA
+CTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACAAC
+ACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCA
+CACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTA
+TCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTT
+AACCAAAACATCAGATTGTGAATCTGACAACAGAGGCTTACGACCCCTTA
+TTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCCCCCATGTCTAAC
+AACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAG
+GCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACAC
+TACTATAACCACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCA
+CCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCC
+ATTGTCGCATCCACCTTTATTATCAGTCTCTTCCCCACAACAATATTCAT
+GTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACTGAGCCACAACCC
+AAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAATA
+TTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACT
+GTGATATATAAACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTAC
+TCATCTTCCTAATTACCATACTAATCTTAGTTACCGCTAACAACCTATTC
+CAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCAT
+CAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCAA
+TCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCATGA
+TTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAA
+CGCTAATCCAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAG
+GCAAATCAGCCCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGAA
+GGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTATAGTTGTAGC
+AGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAAAATAGCCCAC
+TAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGCA
+GCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTC
+CACTTCAAGTCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAAC
+CACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCATA
+CTATTTATGTGCTCCGGGTCCATCATCCACAACCTTAACAATGAACAAGA
+TATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTCACTTCAACCT
+CCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGGT
+TTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAA
+CGCCTGAGCCCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCT
+ATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGCTTCCCC
+ACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATTAA
+ACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCATTACTAACAACA
+TTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAACTC
+ACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAA
+CTACCTAACCAACAAACTTAAAATAAAATCCCCACTATGCACATTTTATT
+TCTCCAACATACTCGGATTCTACCCTAGCATCACACACCGCACAATCCCC
+TATCTAGGCCTTCTTACGAGCCAAAACCTGCCCCTACTCCTCCTAGACCT
+AACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAGCACCAAATCT
+CCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAAACTTTACTTC
+CTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACC
+TATTCCCCCGAGCAATCTCAATTACAATATATACACCAACAAACAATGTT
+CAACCAGTAACTACTACTAATCAACGCCCATAATCATACAAAGCCCCCGC
+ACCAATAGGATCCTCCCGAATCAACCCTGACCCCTCTCCTTCATAAATTA
+TTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCACCCCATCATAC
+TCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAAC
+ACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAA
+TAGCCATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAA
+ATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAAT
+AACACACCCGACCACACCGCTAACAATCAATACTAAACCCCCATAAATAG
+GAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACTAAACCCACACTC
+AACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGAC
+CAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGA
+CCCCAATACGCAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTC
+ATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCTC
+ACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTAG
+CCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCAC
+ATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAA
+TGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCC
+TATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATC
+CTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGTG
+AGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCCG
+CCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTAC
+TCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTT
+GCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACG
+AAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATC
+ACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCTT
+CCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGCG
+ACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACATC
+AAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCC
+TAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAG
+CAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCGC
+CCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTCT
+AACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGAC
+AAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAACT
+ATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGTAT
+AAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGG
+ACAAATCAGAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAG
+ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGT
+ACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACA
+TTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCAC
+CTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTA
+CAAGcaagtacagcaatcaaccctcaactatcacacatcaactgcaactC
+CAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAA
+CAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAA
+ATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGAC
+CACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCG
+CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACAT
+CTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCT
+TAAATAAGACATCACGATG
diff -r a1abfa420d9d -r 7dd841a32245 test-data/chrM.fa.fai
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/chrM.fa.fai	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,1 @@
+chrM	16569	6	50	51
diff -r a1abfa420d9d -r 7dd841a32245 test-data/fasta_indexes.loc
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fasta_indexes.loc	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,1 @@
+chrM	hg19	human mitochondrial genome	${__HERE__}/chrM.fa
diff -r a1abfa420d9d -r 7dd841a32245 test-data/first.maf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/first.maf	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,987 @@
+##maf version=1
+a score=41100.0
+s mm10.chr2 34705072 4 + 182113224 G-AAG     
+s rn5.chr3  19096925 4 + 183740530 G-AAG     
+i rn5.chr3                         C 0 C 0   
+s hg19.chr9 13114691 4 - 141213431 G-ACA     
+i hg19.chr9                        I 195 I 6 
+
+a score=423183.0
+s mm10.chr2 34705076 25 + 182113224 AGGTGGAGA-------ACTATAGAATTTGAAA 
+s rn5.chr3  19096929 25 + 183740530 AGGCAGAGA-------ACTGTGGAGTTTGAAA 
+i rn5.chr3                          C 0 C 0                          
+s hg19.chr9 13114701 25 - 141213431 AAATAAAAG-------GCTGTAAATCTTGAAG 
+i hg19.chr9                         I 6 C 0                          
+
+a score=66158.0
+s mm10.chr2 34705101 4 + 182113224 GTCT    
+s rn5.chr3  19096954 4 + 183740530 GGCT    
+i rn5.chr3                         C 0 C 0 
+s hg19.chr9 13114726 4 - 141213431 TTCT    
+i hg19.chr9                        C 0 C 0 
+
+a score=387811.0
+s mm10.chr2 34705105 18 + 182113224 AATATTGCTTTCA---GCAAA 
+s rn5.chr3  19096958 18 + 183740530 AATATTGCTTTCA---GCAAA 
+i rn5.chr3                          C 0 C 0               
+s hg19.chr9 13114730 18 - 141213431 AACACTGCTCTCA---GCAAA 
+i hg19.chr9                         C 0 C 0               
+
+a score=10920.0
+s mm10.chr2 34705123 1 + 182113224 T       
+s rn5.chr3  19096976 1 + 183740530 T       
+i rn5.chr3                         C 0 C 0 
+s hg19.chr9 13114748 1 - 141213431 T       
+i hg19.chr9                        C 0 C 0 
+
+a score=-29032.0
+s mm10.chr2 34705124 7 + 182113224 GTCTTGA--- 
+s rn5.chr3  19096977 7 + 183740530 GTCCTAA--- 
+i rn5.chr3                         C 0 C 0    
+s hg19.chr9 13114749 2 - 141213431 -----AA--- 
+i hg19.chr9                        C 0 C 0    
+
+a score=-6898.0
+s mm10.chr2 34705131 8 + 182113224 TTTA------AAAA 
+s rn5.chr3  19096984 8 + 183740530 TTTT------AAAA 
+i rn5.chr3                         C 0 C 0        
+s hg19.chr9 13114751 8 - 141213431 CTTT------AAAA 
+i hg19.chr9                        C 0 I 1        
+
+a score=37882.0
+s mm10.chr2 34705139 24 + 182113224 AAAAATCTATGAGTGAAATG---AATA 
+s rn5.chr3  19096992 23 + 183740530 CGAATTC-ATGAATGAAATG---AATA 
+i rn5.chr3                          C 0 C 0                     
+s hg19.chr9 13114760 24 - 141213431 AGATAAGTATGCAGAGGATG---GAAA 
+i hg19.chr9                         I 1 C 0                     
+
+a score=2589.0
+s mm10.chr2 34705163 1 + 182113224 T       
+s rn5.chr3  19097015 1 + 183740530 T       
+i rn5.chr3                         C 0 C 0 
+s hg19.chr9 13114784 1 - 141213431 T       
+i hg19.chr9                        C 0 C 0 
+
+a score=-36380.0
+s mm10.chr2 34705164 35 + 182113224 ATAATGCCATGAAAT--TGACTCTA-ATTTCT-AAATGT 
+s rn5.chr3  19097016 30 + 183740530 ATAATGCCACG-AAT--TAACTCTA-ATTTCT-AA---- 
+i rn5.chr3                          C 0 C 0                                 
+s hg19.chr9 13114785 32 - 141213431 -TTCAAACATAAAA---AAATTATT-A-ATCT-AAATGT 
+i hg19.chr9                         C 0 C 0                                 
+
+a score=33050.0
+s mm10.chr2 34705199 17 + 182113224 ACTA-TTTTA--GACTACAG 
+s rn5.chr3  19097046 14 + 183740530 ---A-TCTTA--GACTACAG 
+i rn5.chr3                          C 0 C 0              
+s hg19.chr9 13114817 13 - 141213431 -----TTTTA--GTCTGAAG 
+i hg19.chr9                         C 0 I 3470           
+
+a score=548.0
+s mm10.chr2 34705216 11 + 182113224 AACTCCCCCTC-- 
+s rn5.chr3  19097060 11 + 183740530 AACCCCCACTC-- 
+i rn5.chr3                          C 0 C 0       
+
+a score=-4856.0
+s mm10.chr2 34705227 6 + 182113224 CCCAAA- 
+s rn5.chr3  19097071 6 + 183740530 CCAAAA- 
+i rn5.chr3                         C 0 C 0 
+
+a score=87104.0
+s mm10.chr2 34705233 20 + 182113224 AGATAACCCTAACTAAGCAT 
+s rn5.chr3  19097077 16 + 183740530 AGATACCC----CTAAGCAC 
+i rn5.chr3                          C 0 C 0              
+
+a score=1769.0
+s mm10.chr2 34705253 1 + 182113224 G       
+s rn5.chr3  19097093 1 + 183740530 G       
+i rn5.chr3                         C 0 C 0 
+
+a score=-7449.0
+s mm10.chr2 34705254 3 + 182113224 TCT--   
+s rn5.chr3  19097094 3 + 183740530 TCT--   
+i rn5.chr3                         C 0 C 0 
+
+a score=-9682.0
+s mm10.chr2 34705257 3 + 182113224 TAA     
+s rn5.chr3  19097097 3 + 183740530 TAA     
+i rn5.chr3                         C 0 C 0 
+
+a score=45039.0
+s mm10.chr2 34705260 9 + 182113224 CACAACTAG 
+s rn5.chr3  19097100 9 + 183740530 CACAATTAG 
+i rn5.chr3                         C 0 C 0   
+
+a score=4300.0
+s mm10.chr2 34705269 1 + 182113224 A       
+s rn5.chr3  19097109 1 + 183740530 A       
+i rn5.chr3                         C 0 C 0 
+
+a score=135112.0
+s mm10.chr2 34705270 16 + 182113224 AA-T------ATTAAAATAG----GTA 
+s rn5.chr3  19097110 16 + 183740530 AA-T------ATTAAAATAG----GTA 
+i rn5.chr3                          C 0 C 0                     
+
+a score=171803.0
+s mm10.chr2 34705286 14 + 182113224 AGTATACAGAGACT 
+s rn5.chr3  19097126 14 + 183740530 AGTATAAAGATACC 
+i rn5.chr3                          C 0 C 0        
+
+a score=59500.0
+s mm10.chr2 34705300 4 + 182113224 AAAA       
+s rn5.chr3  19097140 4 + 183740530 AAAA       
+i rn5.chr3                         C 0 I 99   
+s hg19.chr9 13118300 4 - 141213431 ggac       
+i hg19.chr9                        I 3470 C 0 
+
+a score=26234.0
+s mm10.chr2 34705304 2 + 182113224 CT       
+s rn5.chr3  19097243 2 + 183740530 CT       
+i rn5.chr3                         I 99 C 0 
+s hg19.chr9 13118304 2 - 141213431 tt       
+i hg19.chr9                        C 0 C 0  
+
+a score=4664.0
+s mm10.chr2 34705306 1 + 182113224 T       
+s rn5.chr3  19097245 1 + 183740530 T       
+i rn5.chr3                         C 0 C 0 
+
+a score=10920.0
+s mm10.chr2 34705307 1 + 182113224 T       
+s rn5.chr3  19097246 1 + 183740530 T       
+i rn5.chr3                         C 0 C 0 
+s hg19.chr9 13118306 1 - 141213431 t       
+i hg19.chr9                        C 0 C 0 
+
+a score=10500.0
+s mm10.chr2 34705308 1 + 182113224 C       
+s rn5.chr3  19097247 1 + 183740530 C       
+i rn5.chr3                         C 0 C 0 
+s hg19.chr9 13118307 1 - 141213431 c       
+i hg19.chr9                        C 0 C 0 
+
+a score=1320.0
+s mm10.chr2 34705309 14 + 182113224 TCCACTCACGGATT---- 
+s rn5.chr3  19097248 14 + 183740530 TCCATTCATGGatt---- 
+i rn5.chr3                          C 0 C 0            
+s hg19.chr9 13118308 18 - 141213431 tctacacatggaattttt 
+i hg19.chr9                         C 0 C 0            
+
+a score=8456.0
+s mm10.chr2 34705323 15 + 182113224 TCCTTATAACAGATT 
+s rn5.chr3  19097262 15 + 183740530 tcattatgacagatt 
+i rn5.chr3                          C 0 C 0         
+s hg19.chr9 13118326 15 - 141213431 tcattatgactgaca 
+i hg19.chr9                         C 0 C 0         
+
+a score=352.0
+s mm10.chr2 34705338 11 + 182113224 TCTAGAAGTAG--- 
+s hg19.chr9 13118341 11 - 141213431 cctagaagtgg--- 
+i hg19.chr9                         C 0 C 0        
+
+a score=25195.0
+s mm10.chr2 34705349 194 + 182113224 TTCT-------------------TTTTTTTCCCCGCCTtttttttgagacagggtttctctgtgtagatcttg-------gctgtcctggaactcact--ctgtagac-caggctggccttgaactcagaaatccgcctgcctctgcctctgcctctgcctcccaagtgctgggattaaaggcttgcagcaccactgcctggcCtttttt-------ttttttttaaaga 
+
+a score=0.0
+s mm10.chr2 34705543 173 + 182113224 tttattattatttatatgtaagtacactgtagctatcctcagacacaccagtagagggcatcagatgtcatttcagatggttgtaaaccaccatgtggttgctaggatttgaactcaggaccttcattagaacagtcagtgctcttaaccgctgaaccatctctccagccccC 
+
+a score=1419.0
+s mm10.chr2 34705716 5 + 182113224 TCTAG   
+s rn5.chr3  19097277 5 + 183740530 tctag   
+i rn5.chr3                         C 0 C 0 
+
+a score=23757.0
+s mm10.chr2 34705721 71 + 182113224 AAGTAGTTCTAACTGATCCAAATTTAGAATATGATCATCTAAGTCCCCAAGAACACATTGACAAGTTATGC 
+s rn5.chr3  19097282 71 + 183740530 aagtagttctaactgaaccaaatttagaatatgaacatttaagtccccacgtacacactgacaagttatgc 
+i rn5.chr3                          C 0 I 271                                                               
+s hg19.chr9 13118352 65 - 141213431 ------aactaacctgactaaatttagaatgtgaacatttaagaccttaaatagatactgacaaagtatgt 
+i hg19.chr9                         C 0 C 0                                                                 
+
+a score=1587.0
+s mm10.chr2 34705792 4 + 182113224 CCCA      
+s rn5.chr3  19097624 4 + 183740530 CCTG      
+i rn5.chr3                         I 271 C 0 
+s hg19.chr9 13118417 4 - 141213431 ccca      
+i hg19.chr9                        C 0 I 76  
+
+a score=1744.0
+s mm10.chr2 34705796 49 + 182113224 CTTTGATTTTTAGGGCTTTGTTTT--GGTTGTTTTAGGATTTTTTTTTCTC 
+s rn5.chr3  19097628 51 + 183740530 CTTTGTTTTGTAGGAttttgcttttgggttttttcttctcttttttctttc 
+i rn5.chr3                          C 0 C 0                                             
+
+a score=-3038.0
+s mm10.chr2 34705845 83 + 182113224 CTTTTT----CTTTCGTttttggttttttggatcaggactcactatgtagact-tggctgacctagaactcactatgtagaccaggca 
+s rn5.chr3  19097679 83 + 183740530 tttttt----gttttttttttttttttttggataaaggctcactctacagact-tggctgacttggaactcactatgtaagccaggca 
+i rn5.chr3                          C 0 C 0                                                                                  
+
+a score=-8755.0
+s mm10.chr2 34705928 42 + 182113224 agtctcaaactcatagatattccctg----gcctctatct---gagttc 
+s rn5.chr3  19097762 45 + 183740530 aatcttaaactcacagataatcccct----gcctccacctcctgagtgc 
+i rn5.chr3                          C 0 C 0                                           
+
+a score=1299.0
+s mm10.chr2 34705970 3 + 182113224 tga     
+s rn5.chr3  19097807 3 + 183740530 tga     
+i rn5.chr3                         C 0 C 0 
+
+a score=-2713.0
+s mm10.chr2 34705973 5 + 182113224 cattC   
+s rn5.chr3  19097810 5 + 183740530 tacaa   
+i rn5.chr3                         C 0 C 0 
+
+a score=6695.0
+s mm10.chr2 34705978 1 + 182113224 T       
+s rn5.chr3  19097815 1 + 183740530 t       
+i rn5.chr3                         C 0 C 0 
+
+a score=395.0
+s mm10.chr2 34705979 1 + 182113224 A       
+s rn5.chr3  19097816 1 + 183740530 a       
+i rn5.chr3                         C 0 C 0 
+
+a score=28965.0
+s mm10.chr2 34705980 8 + 182113224 TAATTACC 
+s rn5.chr3  19097817 8 + 183740530 tgaTTACC 
+i rn5.chr3                         C 0 C 0  
+
+a score=12376.0
+s mm10.chr2 34705988 1 + 182113224 T       
+s rn5.chr3  19097825 1 + 183740530 T       
+i rn5.chr3                         C 0 C 0 
+
+a score=12907.0
+s mm10.chr2 34705989 1 + 182113224 T       
+s rn5.chr3  19097826 1 + 183740530 T       
+i rn5.chr3                         C 0 C 0 
+
+a score=258.0
+s mm10.chr2 34705990 1 + 182113224 A       
+s rn5.chr3  19097827 1 + 183740530 A       
+i rn5.chr3                         C 0 C 0 
+
+a score=29575.0
+s mm10.chr2 34705991 1 + 182113224 A       
+s rn5.chr3  19097828 1 + 183740530 A       
+i rn5.chr3                         C 0 C 0 
+
+a score=18893.0
+s mm10.chr2 34705992 1 + 182113224 A       
+s rn5.chr3  19097829 1 + 183740530 A       
+i rn5.chr3                         C 0 C 0 
+
+a score=395908.0
+s mm10.chr2               34705993 19 + 182113224 A-------AGCCATTCT------CACTCCTAC 
+s rn5.chr3                19097830 19 + 183740530 A-------GGTCATTCT------CACCCCCAC 
+i rn5.chr3                                        C 0 C 0                          
+s hg19.chr9               13118497 19 - 141213431 A-------AGTCATCCT------CATTTCCCC 
+i hg19.chr9                                       I 76 C 0                         
+s sorAra1.scaffold_258498     5366 18 +    196505 A-------AGCCcctct------ttttcca-t 
+i sorAra1.scaffold_258498                         N 0 C 0                          
+
+a score=11678.0
+s mm10.chr2               34706012 1 + 182113224 A       
+s rn5.chr3                19097849 1 + 183740530 A       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13118516 1 - 141213431 C       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5384 1 +    196505 t       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=41513.0
+s mm10.chr2               34706013 1 + 182113224 A       
+s rn5.chr3                19097850 1 + 183740530 A       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13118517 1 - 141213431 T       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5385 1 +    196505 t       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=154000.0
+s mm10.chr2               34706014 1 + 182113224 C       
+s rn5.chr3                19097851 1 + 183740530 C       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13118518 1 - 141213431 C       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5386 1 +    196505 c       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=98483.0
+s mm10.chr2               34706015 1 + 182113224 T       
+s rn5.chr3                19097852 1 + 183740530 T       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13118519 1 - 141213431 T       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5387 1 +    196505 t       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=13020051.0
+s mm10.chr2               34706016 111 + 182113224 T--ACCATGGGCTATGTCATCCATATCT--GGACTAGTTACA-GAATCTTTGCCCCC-AAAATCA-GAGCTGCACTCAGA-TCTCAGGTCTTCGATCTTATTGGGAATATCCTCCGATG 
+s rn5.chr3                19097853 111 + 183740530 T--ACCATGGGCTATGTCATCCACATCT--GGACTAGTTACA-GAATCTTTACCCCC-AAAATCA-GAGCTGCACTCAGA-TCGCAGGTCTTCGATCTTATTGGGAATATCCTCCGATG 
+i rn5.chr3                                         C 0 C 0                                                                                                                 
+s hg19.chr9               13118520 111 - 141213431 T--ACCGTGAGTTATTTCATCCATGTCT--GGACTAGTGACA-GAATCTTTACCCCC-AAAATCA-GAGCTGCACTCAGA-TCTCAGGTCTTCAATCTTATTGGGAATATCCTCAGAGG 
+i hg19.chr9                                        C 0 C 0                                                                                                                 
+s sorAra1.scaffold_258498     5388 111 +    196505 t--accATGAGTTACTTCATCCATGTCT--GGGCTAGTGACA-GAGTCTTTACCCCC-AAAGTCA-GAGCTGCACTCAGA-TCTCAGGTCTTCTATCTTATTAGGAATATCCTCAGAGG 
+i sorAra1.scaffold_258498                          C 0 C 0                                                                                                                 
+
+a score=1769347.0
+s mm10.chr2               34706127 14 + 182113224 TAGCACTTATACCT 
+s rn5.chr3                19097964 14 + 183740530 TAGCGCTTATGCCT 
+i rn5.chr3                                        C 0 C 0        
+s hg19.chr9               13118631 14 - 141213431 TTGCACTTATGCCT 
+i hg19.chr9                                       C 0 C 0        
+s sorAra1.scaffold_258498     5499 14 +    196505 TTGCACTTATgcct 
+i sorAra1.scaffold_258498                         C 0 C 0        
+
+a score=-78567.0
+s mm10.chr2               34706141 7 + 182113224 TTAAA-------------------AA----- 
+s rn5.chr3                19097978 7 + 183740530 TTGAA-------------------AA----- 
+i rn5.chr3                                       C 0 C 0                         
+s hg19.chr9               13118645 7 - 141213431 TTAAA-------------------AA----- 
+i hg19.chr9                                      C 0 C 0                         
+s sorAra1.scaffold_258498     5513 6 +    196505 tt-aa-------------------ag----- 
+i sorAra1.scaffold_258498                        C 0 C 0                         
+
+a score=-435240.0
+s mm10.chr2 34706148 8 + 182113224 ATACAGCA-------------------------------------- 
+s rn5.chr3  19097985 7 + 183740530 -TACAGCA-------------------------------------- 
+i rn5.chr3                         C 0 C 0                                        
+s hg19.chr9 13118652 1 - 141213431 -------A-------------------------------------- 
+i hg19.chr9                        C 0 C 0                                        
+
+a score=-126692.0
+s mm10.chr2               34706156 2 + 182113224 A-A-    
+s rn5.chr3                19097992 2 + 183740530 A-A-    
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13118653 2 - 141213431 C-A-    
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5519 2 +    196505 a-t-    
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=-311071.0
+s mm10.chr2               34706158 6 + 182113224 A-A----TACA-- 
+s rn5.chr3                19097994 5 + 183740530 A------TACA-- 
+i rn5.chr3                                       C 0 C 0       
+s hg19.chr9               13118655 3 - 141213431 A--------TA-- 
+i hg19.chr9                                      C 0 C 0       
+s sorAra1.scaffold_258498     5521 3 +    196505 a--------aa-- 
+i sorAra1.scaffold_258498                        C 0 C 0       
+
+a score=-651211.0
+s mm10.chr2               34706164 10 + 182113224 TA--A--G----------------------------------------------------------------------------------------------TAAA--TA 
+s rn5.chr3                19097999 10 + 183740530 GA--A--G----------------------------------------------------------------------------------------------TAAA--TA 
+i rn5.chr3                                        C 0 C 0                                                                                                        
+s hg19.chr9               13118658 10 - 141213431 GT--A--A----------------------------------------------------------------------------------------------AAAA--TA 
+i hg19.chr9                                       C 0 C 0                                                                                                        
+s sorAra1.scaffold_258498     5524 12 +    196505 at--a--a--------------------------------------------------------------------------------------------ttaaaa--ct 
+i sorAra1.scaffold_258498                         C 0 C 0                                                                                                        
+
+a score=165149.0
+s mm10.chr2               34706174 5 + 182113224 AATAA   
+s rn5.chr3                19098009 4 + 183740530 AACA-   
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13118668 4 - 141213431 AACA-   
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5536 2 +    196505 a--a-   
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=386714.0
+s mm10.chr2               34706179 12 + 182113224 GCTGCAAG----AAGA-------- 
+s rn5.chr3                19098013  9 + 183740530 ---GCAAG----AAGA-------- 
+i rn5.chr3                                        C 0 C 0                  
+s hg19.chr9               13118672  9 - 141213431 ---GGAAG----AAGA-------- 
+i hg19.chr9                                       C 0 C 0                  
+s sorAra1.scaffold_258498     5538 13 +    196505 ---gcAAACTGGAACA-------- 
+i sorAra1.scaffold_258498                         C 0 C 0                  
+
+a score=224266.0
+s mm10.chr2               34706191 6 + 182113224 CCAAAG-- 
+s rn5.chr3                19098022 6 + 183740530 ACAAAG-- 
+i rn5.chr3                                       C 0 C 0  
+s hg19.chr9               13118681 6 - 141213431 ACAAAA-- 
+i hg19.chr9                                      C 0 C 0  
+s sorAra1.scaffold_258498     5551 6 +    196505 ACAAAA-- 
+i sorAra1.scaffold_258498                        C 0 C 0  
+
+a score=584015.0
+s mm10.chr2               34706197 35 + 182113224 TAGTTACAC-------AA---------------------------------------------------------------------------------A--ATTT--TATG---------AAG--TT-------------------------------T-GGAGAAA----------------------------------------------------TT-- 
+s rn5.chr3                19098028 36 + 183740530 CAGTTACAC-------AA---------------------------------------------------------------------------------A--ATTC--TACT---------AAG--TT-------------------------------TTGGATAAA----------------------------------------------------TC-- 
+i rn5.chr3                                        C 0 C 0                                                                                                                                                                                                                          
+s hg19.chr9               13118687 36 - 141213431 TATCCACAC-A-----AA---------------------------------------------------------------------------------A--AGTA--TATG---------AAA--TT-------------------------------T-GGAGAAA----------------------------------------------------CT-- 
+i hg19.chr9                                       C 0 I 4                                                                                                                                                                                                                          
+s sorAra1.scaffold_258498     5557 36 +    196505 TAAGCACAC-A-----GA---------------------------------------------------------------------------------A--AGTT--TATG---------AAG--TC-------------------------------T-GGAGAAA----------------------------------------------------GT-- 
+i sorAra1.scaffold_258498                         C 0 I 4                                                                                                                                                                                                                          
+
+a score=-1110372.0
+s mm10.chr2               34706232 43 + 182113224 CCTTTTC-------------------------------------------------AAA---CT--A---TC--CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------CTACAC------ATGTGA-GTTGCTGAGTGCT-------- 
+s rn5.chr3                19098064 37 + 183740530 CCTCCTC-------------------------------------------------GAG---CT--G---TC--CAC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGTGA-GCTGCCGAGTGCT-------- 
+i rn5.chr3                                        C 0 C 0                                                                                                                                                                                                                                                                            
+s hg19.chr9               13118727 47 - 141213431 CATTCTC-------------------------------------------------GAA---TT--T---TG--T----------------------------GTCCCAGT--TC------------------------------------------------------------------------------------------------------------------------TATAC------ATGTGA----GTTTAGTATT-------- 
+i hg19.chr9                                       I 4 C 0                                                                                                                                                                                                                                                                            
+s sorAra1.scaffold_258498     5597 51 +    196505 TACCCTC-------------------------------------------------AATT--GT--T---TG--T----------------------------GTCCAGTTC-TA------------------------------------------------------------------------------------------------------------------------CACAC------AAGGGA-GCTG-CCGGTGTT-------- 
+i sorAra1.scaffold_258498                         I 4 C 0                                                                                                                                                                                                                                                                            
+
+a score=-57305.0
+s mm10.chr2 34706275 9 + 182113224 G-------------------GCAAGTTA 
+s rn5.chr3  19098101 9 + 183740530 G-------------------CCACCTCA 
+i rn5.chr3                         C 0 C 0                      
+
+a score=-785463.0
+s mm10.chr2               34706284 23 + 182113224 CCAC--------------------------------------------------------------------------TGTTA----TTCAAACACACT----TA----------- 
+s rn5.chr3                19098110 23 + 183740530 CCAC--------------------------------------------------------------------------TGCTG----TCCAAGTACACT----TA----------- 
+i rn5.chr3                                        C 0 C 0                                                                                                              
+s hg19.chr9               13118774 35 - 141213431 -------------------------------------------------------ATATCCTT---TA-T-GGTA--CTACTG----CTTAAATATACT----TA----------- 
+i hg19.chr9                                       C 0 C 0                                                                                                              
+s sorAra1.scaffold_258498     5648 36 +    196505 -------------------------------------------------------TCGGCTTT---TATC-AGTA--CTACTG----CTTAAATATGAT----TA----------- 
+i sorAra1.scaffold_258498                         C 0 C 0                                                                                                              
+
+a score=38342.0
+s mm10.chr2               34706307 6 + 182113224 TCTTGC- 
+s rn5.chr3                19098133 6 + 183740530 TCTTGC- 
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13118809 6 - 141213431 CCTTGC- 
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5684 5 +    196505 C-CCGA- 
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=173064.0
+s mm10.chr2               34706313 10 + 182113224 T-TTATACAAT 
+s rn5.chr3                19098139  8 + 183740530 T---ATACAGC 
+i rn5.chr3                                        C 0 C 0     
+s hg19.chr9               13118815 10 - 141213431 T-TTACACAAC 
+i hg19.chr9                                       C 0 C 0     
+s sorAra1.scaffold_258498     5689  7 +    196505 T-GTGTGC--- 
+i sorAra1.scaffold_258498                         C 0 C 0     
+
+a score=110922.0
+s mm10.chr2               34706323 13 + 182113224 ATCATC------------------------------------------AGA---ATT-A 
+s rn5.chr3                19098147 13 + 183740530 AGCATC------------------------------------------AAA---AGT-T 
+i rn5.chr3                                        C 0 C 0                                                     
+s hg19.chr9               13118825 13 - 141213431 ATAATC------------------------------------------AGA---ATC-G 
+i hg19.chr9                                       C 0 C 0                                                     
+s sorAra1.scaffold_258498     5696 12 +    196505 -AAAAT------------------------------------------ATC---CAA-G 
+i sorAra1.scaffold_258498                         C 0 I 1                                                     
+
+a score=-155855.0
+s mm10.chr2               34706336 16 + 182113224 CACGC----T----ATAC-----CTAAAT 
+s rn5.chr3                19098160 15 + 183740530 CATGC----T----GTAC-----CTAA-T 
+i rn5.chr3                                        C 0 C 0                       
+s hg19.chr9               13118838 14 - 141213431 --TAC----A----ATTC-----TAAAGT 
+i hg19.chr9                                       C 0 C 0                       
+s sorAra1.scaffold_258498     5709 16 +    196505 TACAT----G----CTCT-----GTACAC 
+i sorAra1.scaffold_258498                         I 1 I 5                       
+
+a score=5448.0
+s mm10.chr2 34706352 3 + 182113224 ATC     
+s rn5.chr3  19098175 3 + 183740530 ATT     
+i rn5.chr3                         C 0 C 0 
+
+a score=-7915.0
+s mm10.chr2 34706355 2 + 182113224 GT-     
+s rn5.chr3  19098178 2 + 183740530 GT-     
+i rn5.chr3                         C 0 C 0 
+
+a score=592160.0
+s mm10.chr2               34706357 20 + 182113224 AGCAAAAGC-----TAT-CAAAAA----TA 
+s rn5.chr3                19098180 20 + 183740530 AGCAGAAGC-----TAC-CAAAAG----TA 
+i rn5.chr3                                        C 0 C 0                        
+s hg19.chr9               13118852 20 - 141213431 AGGACAGGC-----TAC-TAAGAA----CA 
+i hg19.chr9                                       C 0 C 0                        
+s sorAra1.scaffold_258498     5730 20 +    196505 AGCAGAAGC-----TAT-GCAGTA----CA 
+i sorAra1.scaffold_258498                         I 5 C 0                        
+
+a score=-246926.0
+s mm10.chr2               34706377 6 + 182113224 TCA-----A--------GA 
+s rn5.chr3                19098200 6 + 183740530 TCG-----A--------AA 
+i rn5.chr3                                       C 0 C 0             
+s hg19.chr9               13118872 6 - 141213431 GAA-----A--------CA 
+i hg19.chr9                                      C 0 C 0             
+s sorAra1.scaffold_258498     5750 4 +    196505 GAT-----A---------- 
+i sorAra1.scaffold_258498                        C 0 C 0             
+
+a score=-935672.0
+s mm10.chr2               34706383 18 + 182113224 GCTG------------------AA--------AG---AGGAG-----------------------CAGCA 
+s rn5.chr3                19098206 17 + 183740530 GCTG------------------AA---------G---AAGAA-----------------------CAGTT 
+i rn5.chr3                                        C 0 C 0                                                                
+s hg19.chr9               13118878 17 - 141213431 GTTG------------------TA---------G---AGAGA-----------------------CTGTT 
+i hg19.chr9                                       C 0 C 0                                                                
+s sorAra1.scaffold_258498     5754 20 +    196505 ----------------------GT---------C---AGGGAA---CA---CAC-----A-----TGAGC 
+i sorAra1.scaffold_258498                         C 0 C 0                                                                
+
+a score=499767.0
+s mm10.chr2               34706401 25 + 182113224 CGTCCA--TTATTTT----AACAGGCTGTA--A 
+s rn5.chr3                19098223 23 + 183740530 CGTCAG--TTATC------AATAGGCTGTG--A 
+i rn5.chr3                                        C 0 C 0                           
+s hg19.chr9               13118895 26 - 141213431 TGCCAA--TTACTTC----AACAGGCTCCAT-A 
+i hg19.chr9                                       C 0 C 0                           
+s sorAra1.scaffold_258498     5774 26 +    196505 TGCAAA--TTACTTT----AATGAGCTCTGC-G 
+i sorAra1.scaffold_258498                         C 0 C 0                           
+
+a score=767553.0
+s mm10.chr2               34706426 54 + 182113224 A----AGC------CACATATT--AAGTT----CTCAAAGA----TTAT------------G-AAG-GCATAAAATTAAT-TTTTTTCC 
+s rn5.chr3                19098246 54 + 183740530 A----AGC------TACACATT--AGGTT----CTCAAAGA----TTAT------------G-AAA-GCGTAAAATTGAT-TTTGTTCC 
+i rn5.chr3                                        C 0 C 0                                                                                   
+s hg19.chr9               13118921 55 - 141213431 A----GGC------CACACATT--AAGTT----CTCAAAGAT---TTCA------------G-GTG-CAATGGAAATAAG-TTTGTTTT 
+i hg19.chr9                                       C 0 C 0                                                                                   
+s sorAra1.scaffold_258498     5800 55 +    196505 A----AGC------CGCACATT--AAGCT----CTCATAGCT---ATTT------------G-GTA-CCCTAGAAATAAT-TTCATTCC 
+i sorAra1.scaffold_258498                         C 0 C 0                                                                                   
+
+a score=512662.0
+s mm10.chr2               34706480 12 + 182113224 CTGG-GGACTACT 
+s rn5.chr3                19098300 12 + 183740530 CTGG-AGACTACT 
+i rn5.chr3                                        C 0 C 0       
+s hg19.chr9               13118976 12 - 141213431 CTGG-AAATTACT 
+i hg19.chr9                                       C 0 C 0       
+s sorAra1.scaffold_258498     5855 12 +    196505 CTGG-AAATCACC 
+i sorAra1.scaffold_258498                         C 0 C 0       
+
+a score=266794.0
+s mm10.chr2               34706492 19 + 182113224 GAG-AACTTAAATAA-CATA--T 
+s rn5.chr3                19098312 19 + 183740530 GAG-CTCTTAAATAA-CACA--T 
+i rn5.chr3                                        C 0 C 0                 
+s hg19.chr9               13118988 19 - 141213431 CAG-CTCTTAAATAT-AACA--T 
+i hg19.chr9                                       C 0 I 2                 
+s sorAra1.scaffold_258498     5867  1 +    196505 C---------------------- 
+i sorAra1.scaffold_258498                         C 0 C 0                 
+
+a score=43661.0
+s mm10.chr2 34706511 4 + 182113224 CT--CT  
+s rn5.chr3  19098331 4 + 183740530 CT--CT  
+i rn5.chr3                         C 0 C 0 
+s hg19.chr9 13119009 4 - 141213431 CT--TT  
+i hg19.chr9                        I 2 C 0 
+
+a score=10868.0
+s mm10.chr2 34706515 1 + 182113224 T       
+s rn5.chr3  19098335 1 + 183740530 T       
+i rn5.chr3                         C 0 C 0 
+s hg19.chr9 13119013 1 - 141213431 T       
+i hg19.chr9                        C 0 C 0 
+
+a score=-67977.0
+s mm10.chr2 34706516 23 + 182113224 gggggtggagatacagctcag----------------tg 
+s rn5.chr3  19098336 23 + 183740530 ggggacaaagctacagctcag----------------tg 
+i rn5.chr3                          C 0 C 0                                 
+
+a score=-16667.0
+s mm10.chr2 34706539 4 + 182113224 at---ga 
+s rn5.chr3  19098359 5 + 183740530 ac--aga 
+i rn5.chr3                         C 0 C 0 
+
+a score=-47800.0
+s mm10.chr2               34706543 9 + 182113224 acacatgac 
+s rn5.chr3                19098364 9 + 183740530 gcacatgac 
+i rn5.chr3                                       C 0 C 0   
+s sorAra1.scaffold_258498     5868 9 +    196505 GCTGGTAAT 
+i sorAra1.scaffold_258498                        C 0 C 0   
+
+a score=-120172.0
+s mm10.chr2 34706552 20 + 182113224 taacatgtcccaagtt--------------------ctgg 
+s rn5.chr3  19098373 20 + 183740530 taacatgtcccgagtt--------------------ctga 
+i rn5.chr3                          C 0 C 0                                  
+
+a score=-60366.0
+s mm10.chr2               34706572 21 + 182113224 gttcaacagatagtacca-------------------------------------------------------tac 
+s rn5.chr3                19098393 18 + 183740530 gttcaacagccagcacca---------------------------------------------------------- 
+i rn5.chr3                                        C 0 C 0                                                                      
+s sorAra1.scaffold_258498     5877  5 +    196505 -------------TATCA---------------------------------------------------------- 
+i sorAra1.scaffold_258498                         C 0 C 0                                                                      
+
+a score=-3306.0
+s mm10.chr2 34706593 3 + 182113224 cat-- 
+
+a score=-199980.0
+s mm10.chr2 34706596 23 + 182113224 aa------aacAGCCAACAAAACCC-AGTT-------------- 
+s rn5.chr3  19098411 18 + 183740530 ----------gcagcaacaaaaCCC-AGT--------------- 
+i rn5.chr3                          C 0 C 0                                      
+s hg19.chr9 13119014  7 - 141213431 ------------------TGTATCA------------------- 
+i hg19.chr9                         C 0 C 0                                      
+
+a score=21021.0
+s mm10.chr2 34706619 1 + 182113224 A       
+s rn5.chr3  19098429 1 + 183740530 A       
+i rn5.chr3                         C 0 C 0 
+
+a score=28151.0
+s mm10.chr2 34706620 3 + 182113224 TCT     
+s rn5.chr3  19098430 3 + 183740530 TCT     
+i rn5.chr3                         C 0 C 0 
+
+a score=21179.0
+s mm10.chr2 34706623 3 + 182113224 CTT-    
+s rn5.chr3  19098433 3 + 183740530 CTT-    
+i rn5.chr3                         C 0 C 0 
+
+a score=-542671.0
+s mm10.chr2               34706626 14 + 182113224 TGG-TAAC-----AC------------T--------TTAT-------- 
+s rn5.chr3                19098436 14 + 183740530 TGG-TAAC-----AC------------T--------TTAT-------- 
+i rn5.chr3                                        C 0 C 0                                          
+s hg19.chr9               13119021  7 - 141213431 -------------AC------------T--------TTAT-------- 
+i hg19.chr9                                       C 0 C 0                                          
+s sorAra1.scaffold_258498     5882  7 +    196505 -------------AC------------A--------TTAT-------- 
+i sorAra1.scaffold_258498                         C 0 C 0                                          
+
+a score=-12000.0
+s mm10.chr2               34706640 5 + 182113224 AAAC-A  
+s rn5.chr3                19098450 5 + 183740530 AAAC-A  
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119028 5 - 141213431 AAAT-A  
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5889 5 +    196505 ACAC-G  
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=112347.0
+s mm10.chr2               34706645 2 + 182113224 GA      
+s rn5.chr3                19098455 2 + 183740530 GA      
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119033 2 - 141213431 GG      
+i hg19.chr9                                      C 0 I 7 
+s sorAra1.scaffold_258498     5894 2 +    196505 GG      
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=-75428.0
+s mm10.chr2               34706647 10 + 182113224 AAGA-AGGGGA 
+s rn5.chr3                19098457 10 + 183740530 AAGA-AGGGGA 
+i rn5.chr3                                        C 0 C 0     
+s hg19.chr9               13119042 10 - 141213431 AGGG-GGTGAA 
+i hg19.chr9                                       I 7 C 0     
+s sorAra1.scaffold_258498     5896 10 +    196505 GTGG-TAGGAA 
+i sorAra1.scaffold_258498                         C 0 C 0     
+
+a score=26690.0
+s mm10.chr2               34706657 1 + 182113224 T       
+s rn5.chr3                19098467 1 + 183740530 T       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119052 1 - 141213431 C       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5906 1 +    196505 C       
+i sorAra1.scaffold_258498                        C 0 I 2 
+
+a score=582929.0
+s mm10.chr2               34706658 21 + 182113224 GCCTTCAAA--------------------TTCCTAGC----CCTT 
+s rn5.chr3                19098468 21 + 183740530 GCCTTCAAA--------------------TTCCTAGT----CCTT 
+i rn5.chr3                                        C 0 C 0                                       
+s hg19.chr9               13119053 21 - 141213431 ACCTTCAAA--------------------TCCCTACT----CCTT 
+i hg19.chr9                                       C 0 C 0                                       
+s sorAra1.scaffold_258498     5909 21 +    196505 ACCTTCCAA--------------------TCCTTATT----CCTT 
+i sorAra1.scaffold_258498                         I 2 C 0                                       
+
+a score=357258.0
+s mm10.chr2               34706679 6 + 182113224 AAAAC---------------------------------A--- 
+s rn5.chr3                19098489 6 + 183740530 AAAAC---------------------------------A--- 
+i rn5.chr3                                       C 0 C 0                                    
+s hg19.chr9               13119074 6 - 141213431 AAAAC---------------------------------A--- 
+i hg19.chr9                                      C 0 C 0                                    
+s sorAra1.scaffold_258498     5930 6 +    196505 AAAAC---------------------------------A--- 
+i sorAra1.scaffold_258498                        C 0 C 0                                    
+
+a score=522064.0
+s mm10.chr2               34706685 8 + 182113224 AGA-C-AGAC 
+s rn5.chr3                19098495 8 + 183740530 AGA-C-AGAC 
+i rn5.chr3                                       C 0 C 0    
+s hg19.chr9               13119080 8 - 141213431 AGA-C-AGAC 
+i hg19.chr9                                      C 0 C 0    
+s sorAra1.scaffold_258498     5936 8 +    196505 AGA-C-AGAC 
+i sorAra1.scaffold_258498                        C 0 C 0    
+
+a score=75873.0
+s mm10.chr2               34706693 1 + 182113224 A       
+s rn5.chr3                19098503 1 + 183740530 A       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119088 1 - 141213431 A       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5944 1 +    196505 A       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=117040.0
+s mm10.chr2               34706694 1 + 182113224 T       
+s rn5.chr3                19098504 1 + 183740530 T       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119089 1 - 141213431 T       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     5945 1 +    196505 T       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=18601995.0
+s mm10.chr2               34706695 141 + 182113224 A-CCGGACACAAC-ACTGAGG--CCTGGT-GTGC-TGGGGC-GGGAA--CTGACCTCCCTGAC-ATCCGTATCATCA-GATGTGCTG-CCCAGTCCAGAACAG---CTCT-CCAGCTCTTGGAGGCGCTCTTCCTGCTTTAAGTCTGGAGCCTCTGA 
+s rn5.chr3                19098505 141 + 183740530 A-CCGGACACAAC-ACTGAGG--CCTGGT-GTGC-TGGGGC-GGGAA--CTGACCTCCCTGAC-ATCCGTATCATCA-GATGTACTG-CCCAGTCCAGAACAG---CTCT-CCAGCTCTTGGAGGCGCTCTTCCTGCTTTAAGTCTGGAGCCTCTGC 
+i rn5.chr3                                         C 0 C 0                                                                                                                                                       
+s hg19.chr9               13119090 141 - 141213431 A-CCGGACACAAC-ACTGAGG--CCTGGT-GTGC-TGGGGC-GGGAA--CTGACCTCCCTGAC-ATCCGTATCATCA-GATGTGCTA-CCCAGTCCAGAACAG---CTCT-CCAGTTCTTGCAGACGCTCCTCCTGCTTTAGGTCTGGGGCCTCTAA 
+i hg19.chr9                                        C 0 C 0                                                                                                                                                       
+s sorAra1.scaffold_258498     5946 141 +    196505 A-CCCGACACAAC-ACTGAGG--CCTGGT-GTGC-TGGGGC-GGGAA--CTGACCTCCCTGAC-ATCCGTGTCGTCA-GAGGTGCTG-CCCAGGCCGGAACAG---CTCT-CCAGCTCCTGCAGACGCTCCTCCTGCTTCAGGTCTGGGGCTTCTAG 
+i sorAra1.scaffold_258498                          C 0 C 0                                                                                                                                                       
+
+a score=93544.0
+s mm10.chr2               34706836 1 + 182113224 A       
+s rn5.chr3                19098646 1 + 183740530 A       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119231 1 - 141213431 A       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     6087 1 +    196505 G       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=265691.0
+s mm10.chr2               34706837 6 + 182113224 CAGAAA- 
+s rn5.chr3                19098647 6 + 183740530 CAGAGA- 
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119232 6 - 141213431 TAGAAG- 
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     6088 6 +    196505 GAAAGA- 
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=100475.0
+s mm10.chr2               34706843 1 + 182113224 A        
+s rn5.chr3                19098653 1 + 183740530 A        
+i rn5.chr3                                       C 0 I 41 
+s hg19.chr9               13119238 1 - 141213431 A        
+i hg19.chr9                                      C 0 I 45 
+s sorAra1.scaffold_258498     6094 1 +    196505 G        
+i sorAra1.scaffold_258498                        C 0 I 41 
+
+a score=123198.0
+s mm10.chr2               34706844 2 + 182113224 CA       
+s rn5.chr3                19098695 2 + 183740530 CA       
+i rn5.chr3                                       I 41 C 0 
+s hg19.chr9               13119284 2 - 141213431 CA       
+i hg19.chr9                                      I 45 C 0 
+s sorAra1.scaffold_258498     6136 2 +    196505 CC       
+i sorAra1.scaffold_258498                        I 41 C 0 
+
+a score=83667.0
+s mm10.chr2               34706846 1 + 182113224 G       
+s rn5.chr3                19098697 1 + 183740530 G       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119286 1 - 141213431 G       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     6138 1 +    196505 A       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=30972.0
+s mm10.chr2               34706847 1 + 182113224 C       
+s rn5.chr3                19098698 1 + 183740530 C       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119287 1 - 141213431 C       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     6139 1 +    196505 C       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=74745.0
+s mm10.chr2               34706848 1 + 182113224 T       
+s rn5.chr3                19098699 1 + 183740530 T       
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119288 1 - 141213431 T       
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     6140 1 +    196505 T       
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=223036.0
+s mm10.chr2               34706849 11 + 182113224 TT------TG-TG--ACT-TA 
+s rn5.chr3                19098700 11 + 183740530 TT------TG-TG--ACT-TA 
+i rn5.chr3                                        C 0 C 0               
+s hg19.chr9               13119289 11 - 141213431 TT------TG-TG--ACC-CA 
+i hg19.chr9                                       C 0 C 0               
+s sorAra1.scaffold_258498     6141 11 +    196505 TC------CG-TG--ACC-CA 
+i sorAra1.scaffold_258498                         C 0 C 0               
+
+a score=3047381.0
+s mm10.chr2               34706860 139 + 182113224 GACATACAAG---C-------G-ATT-GGGG----AATAAA-GAGAT---TT----------A-------TAAG------CCTAAGCTACTT-AGC-AAAG-CTAGTTAG---ATCA---TAGTTTAAAGAAGAT-A---AGGTTATGA--TTTC-CTCCTGATA-----TACACACT---AGTTTGT----------TATGTACAG-ATGTCAAC---T 
+s rn5.chr3                19098711 134 + 183740530 G----AGAAG---C-------C-ACT-GGGG----AATACC-TAGCT---TT----------A-------TAAG------TCTAAGTTACTC-ACC-AAAA-CTTGTTAG---ATCA---TAGATT-AAGAAGGC-A---AGGTTATAA--TTTC-CCCCTGATA-----TACACACT---AATTTGC----------TATGCACAG-ACGACAAC---T 
+i rn5.chr3                                         C 0 C 0                                                                                                                                                                                                                      
+s hg19.chr9               13119300 149 - 141213431 G----ATAAA---CAAAG--CT-ACC-AGGG----CATGAA-TAAAA---TCAGTG-CAAATACATGTG-TAAG------TCTGGACTAGTT-----AATG-CTAGTTAG---ATTA---AGTGTT----AAGTC-A---AAGTTGTGAT-TTTC-ATCCCAATA-----TAAGC--C---AGTTCAC----------TGTGCACAG-ATGAAAAC-GTG 
+i hg19.chr9                                        C 0 C 0                                                                                                                                                                                                                      
+s sorAra1.scaffold_258498     6152 151 +    196505 G----CTGAA---GAAAA--CTGAAC-AGGG----CTT--A-CGGAAGGGTCAGTG-TAAATAGATTTC-TAGG------TCTCGGCCAGTT-AGT-AAGG-CTGGTT-G---AAGA---AACGCCAAGGAAGTC-ATATCAACTCTGAT-TTTC--CCCCAGCA-----TAGGC--C---AGT----------------TGTACAG-ATAAAAAC-T-- 
+i sorAra1.scaffold_258498                          C 0 I 2                                                                                                                                                                                                                      
+
+a score=-43731.0
+s mm10.chr2               34706999 2 + 182113224 AT-     
+s rn5.chr3                19098845 2 + 183740530 GT-     
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119449 1 - 141213431 G--     
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     6305 2 +    196505 GG-     
+i sorAra1.scaffold_258498                        I 2 C 0 
+
+a score=126153.0
+s mm10.chr2               34707001 4 + 182113224 TTCT-   
+s rn5.chr3                19098847 4 + 183740530 TTCT-   
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119450 4 - 141213431 TTCT-   
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     6307 4 +    196505 TTTT-   
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=311713.0
+s mm10.chr2               34707005 8 + 182113224 AGAATACT 
+s rn5.chr3                19098851 8 + 183740530 AGACTACT 
+i rn5.chr3                                       C 0 C 0  
+s hg19.chr9               13119454 8 - 141213431 AGATCACT 
+i hg19.chr9                                      C 0 I 4  
+s sorAra1.scaffold_258498     6311 8 +    196505 AGATCACT 
+i sorAra1.scaffold_258498                        C 0 C 0  
+
+a score=-2161.0
+s mm10.chr2 34707013 2 + 182113224 TT        
+s rn5.chr3  19098859 2 + 183740530 CT        
+i rn5.chr3                         C 0 I 199 
+s hg19.chr9 13119466 1 - 141213431 -T        
+i hg19.chr9                        I 4 I 1   
+
+a score=-432190.0
+s mm10.chr2               34707015 20 + 182113224 AAAGAAAAAAAAAAGCG------------AT----------T--------------- 
+s rn5.chr3                19099060 26 + 183740530 aaacaaaacaaaacaaa------------acTGTA----CAT--------------- 
+i rn5.chr3                                        I 199 C 0                                                 
+s hg19.chr9               13119468 11 - 141213431 ---------------------------ACAGAGTA----TGC--------------- 
+i hg19.chr9                                       I 1 C 0                                                   
+s sorAra1.scaffold_258498     6319 17 +    196505 -------------------ATT--CTCAATGAGTG----TGC--------------- 
+i sorAra1.scaffold_258498                         C 0 C 0                                                   
+
+a score=221858.0
+s mm10.chr2               34707035 6 + 182113224 TCTTGG  
+s rn5.chr3                19099086 6 + 183740530 TCTTGG  
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119479 6 - 141213431 TATTGA  
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     6336 5 +    196505 TAC-GG  
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=458493.0
+s mm10.chr2               34707041 12 + 182113224 TTAACACGTAAA- 
+s rn5.chr3                19099092 12 + 183740530 TTAACACATAAA- 
+i rn5.chr3                                        C 0 C 0       
+s hg19.chr9               13119485 12 - 141213431 TTAACATGTGAA- 
+i hg19.chr9                                       C 0 C 0       
+s sorAra1.scaffold_258498     6341 12 +    196505 CTAACATGAAAA- 
+i sorAra1.scaffold_258498                         C 0 C 0       
+
+a score=67988.0
+s mm10.chr2               34707053 8 + 182113224 CTA---ATCAA 
+s rn5.chr3                19099104 5 + 183740530 CTG------AA 
+i rn5.chr3                                       C 0 C 0     
+s hg19.chr9               13119497 5 - 141213431 CTG------GA 
+i hg19.chr9                                      C 0 C 0     
+s sorAra1.scaffold_258498     6353 5 +    196505 CTG------AA 
+i sorAra1.scaffold_258498                        C 0 C 0     
+
+a score=123485.0
+s mm10.chr2               34707061 3 + 182113224 TAG     
+s rn5.chr3                19099109 3 + 183740530 CAG     
+i rn5.chr3                                       C 0 C 0 
+s hg19.chr9               13119502 3 - 141213431 CAA     
+i hg19.chr9                                      C 0 C 0 
+s sorAra1.scaffold_258498     6358 3 +    196505 CAA     
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=33526.0
+s mm10.chr2               34707064 4 + 182113224 GA--GC-- 
+s rn5.chr3                19099112 4 + 183740530 GA--GC-- 
+i rn5.chr3                                       C 0 C 0  
+s hg19.chr9               13119505 6 - 141213431 GAGAGT-- 
+i hg19.chr9                                      C 0 C 0  
+s sorAra1.scaffold_258498     6361 6 +    196505 GAACGC-- 
+i sorAra1.scaffold_258498                        C 0 C 0  
+
+a score=167903.0
+s mm10.chr2               34707068 8 + 182113224 A-CAGAAT--A 
+s rn5.chr3                19099116 8 + 183740530 A-CAGAAT--A 
+i rn5.chr3                                       C 0 C 0     
+s hg19.chr9               13119511 8 - 141213431 A-TGGAAT--A 
+i hg19.chr9                                      C 0 C 0     
+s sorAra1.scaffold_258498     6367 7 +    196505 A-GAGAAG--- 
+i sorAra1.scaffold_258498                        C 0 C 0     
+
+a score=2760.0
+s mm10.chr2 34707076 1 + 182113224 A       
+s rn5.chr3  19099124 1 + 183740530 G       
+i rn5.chr3                         C 0 C 0 
+s hg19.chr9 13119519 1 - 141213431 G       
+i hg19.chr9                        C 0 C 0 
+
+a score=-203.0
+s mm10.chr2 34707077 4 + 182113224 TATA--- 
+s rn5.chr3  19099125 3 + 183740530 TGT---- 
+i rn5.chr3                         C 0 C 0 
+s hg19.chr9 13119520 3 - 141213431 CCT---- 
+i hg19.chr9                        C 0 C 0 
+
+a score=73448.0
+s mm10.chr2               34707081 10 + 182113224 CAACACTGTA--- 
+s rn5.chr3                19099128  9 + 183740530 -AACACTGTA--- 
+i rn5.chr3                                        C 0 C 0       
+s hg19.chr9               13119523  9 - 141213431 -GGTATTAAA--- 
+i hg19.chr9                                       C 0 C 0       
+s sorAra1.scaffold_258498     6374  1 +    196505 ---------A--- 
+i sorAra1.scaffold_258498                         C 0 C 0       
+
+a score=-28287.0
+s mm10.chr2               34707091 5 + 182113224 TCAA---C 
+s rn5.chr3                19099137 7 + 183740530 TCCACT-C 
+i rn5.chr3                                       C 0 C 0  
+s sorAra1.scaffold_258498     6375 5 +    196505 TCAAC--- 
+i sorAra1.scaffold_258498                        C 0 C 0  
+
+a score=4831.0
+s mm10.chr2               34707096 1 + 182113224 T         
+s rn5.chr3                19099144 1 + 183740530 T         
+i rn5.chr3                                       C 0 C 0   
+s hg19.chr9               13119532 1 - 141213431 T         
+i hg19.chr9                                      C 0 I 709 
+s sorAra1.scaffold_258498     6380 1 +    196505 T         
+i sorAra1.scaffold_258498                        C 0 I 1   
+
+a score=555.0
+s mm10.chr2 34707097 1 + 182113224 C       
+s rn5.chr3  19099145 1 + 183740530 C       
+i rn5.chr3                         C 0 C 0 
+
+a score=18165.0
+s mm10.chr2               34707098 3 + 182113224 TCT     
+s rn5.chr3                19099146 3 + 183740530 TCT     
+i rn5.chr3                                       C 0 C 0 
+s sorAra1.scaffold_258498     6382 2 +    196505 -TT     
+i sorAra1.scaffold_258498                        I 1 C 0 
+
+a score=32760.0
+s mm10.chr2               34707101 3 + 182113224 AAA     
+s rn5.chr3                19099149 3 + 183740530 AAA     
+i rn5.chr3                                       C 0 C 0 
+s sorAra1.scaffold_258498     6384 3 +    196505 AAA     
+i sorAra1.scaffold_258498                        C 0 C 0 
+
+a score=-12377.0
+s mm10.chr2               34707104 8 + 182113224 TCTCAATG  
+s rn5.chr3                19099152 8 + 183740530 GTTCAATG  
+i rn5.chr3                                       C 0 C 0   
+s sorAra1.scaffold_258498     6387 6 +    196505 --TTTAAA  
+i sorAra1.scaffold_258498                        C 0 I 672 
+
+a score=13142.0
+s mm10.chr2 34707112 17 + 182113224 ttctcaaaagcacttaa--- 
+s rn5.chr3  19099160 17 + 183740530 TTTTCAAAAGCACTTAC--- 
+i rn5.chr3                          C 0 C 0              
+
+a score=2730.0
+s mm10.chr2 34707129 2 + 182113224 aa      
+s rn5.chr3  19099177 2 + 183740530 AA      
+i rn5.chr3                         C 0 C 0 
+
+a score=1746.0
+s mm10.chr2 34707131 3 + 182113224 tgg     
+s rn5.chr3  19099179 3 + 183740530 Tgg     
+i rn5.chr3                         C 0 C 0 
+
+a score=1998.0
+s mm10.chr2 34707134 22 + 182113224 gcat------gaca--gcagggcaatctca 
+s rn5.chr3  19099182 24 + 183740530 gcat------gatattgcagggcactctca 
+i rn5.chr3                          C 0 C 0                        
+
+a score=452.0
+s mm10.chr2 34707156 4 + 182113224 acac    
+s rn5.chr3  19099206 4 + 183740530 gcac    
+i rn5.chr3                         C 0 C 0 
+
+a score=8445.0
+s mm10.chr2 34707160 152 + 182113224 tcaataagcagaggcaggtggatctctgtgagtttgagtccagcctaaaatacactggcagttccatgaatagcctgagctacatgacgagatcctgtctcaaaCTAGCTCCAAAAAGGAAGACAGG-AAAATCATTTCTTTACTTAATACTT 
+s rn5.chr3  19099210 147 + 183740530 tcaagaggcagaggcaggtgga--tctgtaagtctgaggccagcctgaggttcactggcagttcca-gcatagcctgagctacatgatgagaccctggctcaaaccaa---aagaaaGAAAGAAAGGAAAAATGATTTCTTTATCTAATATTT 
+i rn5.chr3                           C 0 I 1                                                                                                                                                   
+
+a score=0.0
+s mm10.chr2 34707312 6 + 182113224 TACCTA 
+
diff -r a1abfa420d9d -r 7dd841a32245 test-data/islands.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/islands.bed	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,5 @@
+chr2	73970064	73983434	islandI
+chr2	74060473	74082287	islandII
+chr2	74201443	74221207	islandIII
+chr2	74264930	74274051	islandIV
+chr2	74290763	74304478	islandV
diff -r a1abfa420d9d -r 7dd841a32245 test-data/master_TADs_BW_plot.png
Binary file test-data/master_TADs_BW_plot.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/master_TADs_plot.png
Binary file test-data/master_TADs_plot.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/master_fasta.png
Binary file test-data/master_fasta.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test11.ini
--- a/test-data/test11.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test11.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -1,6 +1,6 @@
 [x-axis]
 where = top
-[hic_section_0_0]
+[hic_section_1_0]
 file = test-data/Li_et_al_2015.h5
 file_type = hic_matrix
 title = Kc DpnII (Li et al. 2015)
@@ -12,21 +12,25 @@
 rasterize = true
 [spacer]
 height = 0.05
-[bedgraph_matrix_2]
+[bedgraph_matrix_3]
 file = test-data/tad_score.gz
-title = TAD separation score (Ramirez et al.)
+title = TAD separation score (Ramirez et al.) as block with horizontal lines and data range
 height = 10.0
 type = lines
 file_type = bedgraph_matrix
 show_data_range = true
 plot_horizontal_lines = true
 pos_score_in_bin = block
-[bedgraph_matrix_3]
+individual_color = grey
+summary_color = #1f77b4
+[bedgraph_matrix_4]
 file = test-data/tad_score.gz
-title = TAD separation score (Ramirez et al.)
+title = TAD separation score (Ramirez et al.) as center without horizontal lines, summary in red and individual in blue
 height = 10.0
 type = lines
 file_type = bedgraph_matrix
 show_data_range = false
 plot_horizontal_lines = false
-pos_score_in_bin = center
\ No newline at end of file
+pos_score_in_bin = center
+individual_color = blue
+summary_color = red
\ No newline at end of file
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test12.ini
--- a/test-data/test12.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test12.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -1,6 +1,6 @@
 [x-axis]
 where = top
-[hic_section_0_0]
+[hic_section_1_0]
 file = Li_et_al_2015.h5
 file_type = hic_matrix
 title = Kc DpnII (Li et al. 2015)
@@ -9,7 +9,7 @@
 transform = no
 scale_factor = 1.0
 rasterize = true
-[links_1]
+[links_2]
 file = test.arcs
 height = 1.5
 color = red
@@ -19,7 +19,7 @@
 links_type = loops
 overlay_previous = share-y
 file_type = links
-[links_2]
+[links_3]
 file = test.arcs
 title = test.arcs
 height = 5.0
@@ -29,6 +29,8 @@
 line_width = 0.5
 line_style = solid
 links_type = arcs
+compact_arcs_level = 0
+use_middle = false
 orientation = inverted
 overlay_previous = no
 file_type = links
\ No newline at end of file
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test15.ini
--- a/test-data/test15.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test15.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -2,16 +2,21 @@
 where = bottom
 [genes_1_0]
 file = dm3_genes.bed.gz
-title = flybase
+title = flybase backbone blue
 color = #000000
 border_color = #000000
 style = flybase
 height_utr = 1.0
 color_utr = grey
 arrowhead_included = false
+arrowhead_fraction = 0.004
+color_backbone = blue
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
 file_type = bed
 global_max_row = false
 max_labels = 60
@@ -19,14 +24,18 @@
 overlay_previous = no
 [genes_2_0]
 file = dm3_genes.bed.gz
-title = UCSC
+title = UCSC backbone blue
 color = #000000
 border_color = #000000
 style = UCSC
 arrow_interval = 10
+color_backbone = blue
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
 file_type = bed
 global_max_row = false
 max_labels = 60
@@ -43,6 +52,9 @@
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
 file_type = bed
 global_max_row = false
 max_labels = 60
@@ -60,6 +72,9 @@
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
 file_type = bed
 global_max_row = false
 max_labels = 60
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test17.ini
--- a/test-data/test17.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test17.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -1,67 +1,129 @@
-[test bedgraph]
+[bedgraph_0]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
-color = blue
-height = 5
 title = bedgraph color = blue transform = no
-transform = no
-
-[test bedgraph]
+color = blue
+alpha = 1.0
+height = 5.0
+show_data_range = true
+grid = false
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+overlay_previous = no
+[bedgraph_1]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
+title = bedgraph color = blue transform = log
 color = blue
-height = 5
-title = bedgraph color = blue transform = log
+alpha = 1.0
+height = 5.0
+show_data_range = true
+grid = false
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
 transform = log
-
-[test bedgraph]
+y_axis_values = transformed
+log_pseudocount = 0.0
+overlay_previous = no
+[bedgraph_2]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
+title = bedgraph color = red transform = log min_value = 1
 color = red
-height = 5
-title = bedgraph color = red transform = log min_value = 1
-min_value = 1
+alpha = 1.0
+height = 5.0
+min_value = 1.0
+show_data_range = true
+grid = false
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
 transform = log
-
-[test bedgraph]
+y_axis_values = transformed
+log_pseudocount = 0.0
+overlay_previous = no
+[bedgraph_3]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
-color = green
-height = 5
 title = bedgraph color = green transform = log log_pseudocount = 2 min_value = 0
-transform = log
-log_pseudocount = 2
-min_value = 0
-
-[test bedgraph with operation]
-file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 color = green
-height = 5
-title = bedgraph color = green operation = log(2+file) min_value = 0.7
-operation = log(2+file)
-min_value = 0.7
-
-[test bedgraph]
+alpha = 1.0
+height = 5.0
+min_value = 0.0
+show_data_range = true
+grid = false
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+transform = log
+y_axis_values = transformed
+log_pseudocount = 2.0
+overlay_previous = no
+[bedgraph_4]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
-color = black
-height = 5
+title = bedgraph color = green operation = log(2+file) min_value = 0.7
+color = green
+alpha = 1.0
+height = 5.0
+min_value = 0.7
+show_data_range = true
+grid = false
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+operation = log(2+file)
+overlay_previous = no
+[bedgraph_5]
+file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 title = bedgraph color = black transform = log2 log_pseudocount = 1 min_value = 0
-transform = log2
-log_pseudocount = 1
-min_value = 0
-
-[test bedgraph]
-file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 color = black
-height = 5
+alpha = 1.0
+height = 5.0
+min_value = 0.0
+show_data_range = true
+grid = false
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+transform = log2
+y_axis_values = transformed
+log_pseudocount = 1.0
+overlay_previous = no
+[bedgraph_6]
+file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 title = bedgraph color = black operation = log2(1+file) min_value = 0
-operation = log2(1+file)
-min_value = 0
-
-[test bedgraph]
-file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 color = black
-height = 5
+alpha = 1.0
+height = 5.0
+min_value = 0.0
+show_data_range = true
+grid = false
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+operation = log2(1+file)
+overlay_previous = no
+[bedgraph_7]
+file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 title = bedgraph color = black transform = log2 log_pseudocount = 1 min_value = 0 y_axis_values = original
+color = black
+alpha = 1.0
+height = 5.0
+min_value = 0.0
+show_data_range = true
+grid = false
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
 transform = log2
-log_pseudocount = 1
-min_value = 0
 y_axis_values = original
-
-[x-axis]
\ No newline at end of file
+log_pseudocount = 1.0
+overlay_previous = no
+[x-axis]
+where = bottom
\ No newline at end of file
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test19.ini
--- a/test-data/test19.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test19.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -1,75 +1,129 @@
-[test bedgraph]
+[bedgraph_0]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
+title = bedgraph color = blue transform = no
 color = blue
-height = 5
-title = bedgraph color = blue transform = no
-transform = no
+alpha = 1.0
+height = 5.0
+show_data_range = true
 grid = true
-
-[test bedgraph]
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+overlay_previous = no
+[bedgraph_1]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
-color = blue
-height = 5
 title = bedgraph color = blue transform = log
-transform = log
+color = blue
+alpha = 1.0
+height = 5.0
+show_data_range = true
 grid = true
-
-[test bedgraph]
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+transform = log
+y_axis_values = transformed
+log_pseudocount = 0.0
+overlay_previous = no
+[bedgraph_2]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
+title = bedgraph color = red transform = log min_value = 1
 color = red
-height = 5
-title = bedgraph color = red transform = log min_value = 1
-min_value = 1
+alpha = 1.0
+height = 5.0
+min_value = 1.0
+show_data_range = true
+grid = true
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
 transform = log
-grid = true
-
-[test bedgraph]
+y_axis_values = transformed
+log_pseudocount = 0.0
+overlay_previous = no
+[bedgraph_3]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
-color = green
-height = 5
 title = bedgraph color = green transform = log log_pseudocount = 2 min_value = 0
-transform = log
-log_pseudocount = 2
-min_value = 0
-grid = true
-
-[test bedgraph with operation]
-file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 color = green
-height = 5
-title = bedgraph color = green operation = log(2+file) min_value = 0.7
-operation = log(2+file)
-min_value = 0.7
+alpha = 1.0
+height = 5.0
+min_value = 0.0
+show_data_range = true
 grid = true
-
-[test bedgraph]
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+transform = log
+y_axis_values = transformed
+log_pseudocount = 2.0
+overlay_previous = no
+[bedgraph_4]
 file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
-color = black
-height = 5
+title = bedgraph color = green operation = log(2+file) min_value = 0.7
+color = green
+alpha = 1.0
+height = 5.0
+min_value = 0.7
+show_data_range = true
+grid = true
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+operation = log(2+file)
+overlay_previous = no
+[bedgraph_5]
+file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 title = bedgraph color = black transform = log2 log_pseudocount = 1 min_value = 0
-transform = log2
-log_pseudocount = 1
-min_value = 0
-grid = true
-
-[test bedgraph]
-file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 color = black
-height = 5
+alpha = 1.0
+height = 5.0
+min_value = 0.0
+show_data_range = true
+grid = true
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+transform = log2
+y_axis_values = transformed
+log_pseudocount = 1.0
+overlay_previous = no
+[bedgraph_6]
+file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 title = bedgraph color = black operation = log2(1+file) min_value = 0
-operation = log2(1+file)
-min_value = 0
-grid = true
-
-[test bedgraph]
-file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 color = black
-height = 5
+alpha = 1.0
+height = 5.0
+min_value = 0.0
+show_data_range = true
+grid = true
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+operation = log2(1+file)
+overlay_previous = no
+[bedgraph_7]
+file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
 title = bedgraph color = black transform = log2 log_pseudocount = 1 min_value = 0 y_axis_values = original
+color = black
+alpha = 1.0
+height = 5.0
+min_value = 0.0
+show_data_range = true
+grid = true
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
 transform = log2
-log_pseudocount = 1
-min_value = 0
 y_axis_values = original
-grid = true
-
-[x-axis]
\ No newline at end of file
+log_pseudocount = 1.0
+overlay_previous = no
+[x-axis]
+where = bottom
\ No newline at end of file
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test2.ini
--- a/test-data/test2.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test2.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -1,6 +1,6 @@
 [x-axis]
 where = top
-[bigwig_0]
+[bigwig_1]
 file = test-data/bigwig_chrx_2e6_5e6.bw
 title = rep 1 test line
 color = red
@@ -10,9 +10,10 @@
 nans_to_zeros = false
 type = line:1.0
 show_data_range = false
+grid = false
 file_type = bigwig
 overlay_previous = no
-[bigwig_0]
+[bigwig_1]
 file = test-data/bigwig_chrx_2e6_5e6.bw
 title = rep 1 test line
 color = red
@@ -22,9 +23,10 @@
 nans_to_zeros = false
 type = line:1.0
 show_data_range = false
+grid = false
 file_type = bigwig
 overlay_previous = no
-[bigwig_1]
+[bigwig_2]
 file = test-data/bigwig_chrx_2e6_5e6.bw
 title = nans_to_zeros
 color = blue
@@ -34,9 +36,10 @@
 nans_to_zeros = true
 type = line:1.0
 show_data_range = true
+grid = false
 file_type = bigwig
 overlay_previous = no
-[hlines_2]
+[hlines_3]
 height = 1.5
 y_values = 50
 show_data_range = false
@@ -46,7 +49,7 @@
 line_style = dashed
 overlay_previous = share-y
 file_type = hlines
-[hlines_3]
+[hlines_4]
 title = hlines
 height = 1.5
 min_value = 12.0
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test22.ini
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test22.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,21 @@
+
+[scale bar]
+file_type = scalebar
+title = scalebar height = 5
+where = right
+height = 5
+
+[spacer]
+
+[fasta_1]
+file_type = fasta
+title = fasta from cached
+file = chrM.fa
+
+[spacer]
+
+[fasta_2]
+file_type = fasta
+title = fasta from history height = 5
+file = chrM.fa
+height = 5
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test23.ini
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test23.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,61 @@
+[x-axis]
+where = top
+
+[spacer]
+height = 0.05
+
+[hic matrix]
+file = Li_et_al_2015.h5
+title = classical depth=300000 with arcs
+depth = 300000
+transform = log1p
+file_type = hic_matrix
+
+[test arcs overlay]
+file = test_wide.arcs
+color = red
+line_width = 5
+links_type = loops
+overlay_previous = share-y
+
+[hic matrix square]
+file = Li_et_al_2015.h5
+title = square with arcs
+transform = log1p
+file_type = hic_matrix_square
+
+[test arcs overlay]
+file = test_wide.arcs
+color = red
+line_width = 5
+links_type = squares
+overlay_previous = share-y
+
+[hic matrix square]
+file = Li_et_al_2015.h5
+title = square with arcs region2=chrX:3000000-3100000
+transform = log1p
+file_type = hic_matrix_square
+region2 = chrX:3000000-3100000
+
+[test arcs overlay]
+file = test_wide.arcs
+color = red
+line_width = 5
+links_type = squares
+overlay_previous = share-y
+
+[hic matrix square]
+file = Li_et_al_2015.h5
+title = square with domains, colormap = Blues, tranform = no, region2=chrX:3000000-3100000
+file_type = hic_matrix_square
+region2 = chrX:3000000-3100000
+colormap = Blues
+transform = no
+
+[test domains]
+file = tad_classification.bed
+color = none
+border_color = black
+display = squares
+overlay_previous = share-y
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test24.ini
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test24.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,44 @@
+[maf]
+file = first.maf
+reference = mm10
+file_index = /tmp/first.maf.index
+title = default
+
+[spacer]
+height = 1
+
+[maf]
+file = first.maf
+reference = mm10
+file_index = /tmp/first.maf.index
+title = height = 3 show sequence
+display_ref_seq = true
+height = 3
+
+[spacer]
+height = 1
+
+[maf]
+file = first.maf
+reference = mm10
+file_index = /tmp/first.maf.index
+title = species_order = hg19 rn5, species_labels = Human Rat
+species_order = hg19 rn5
+species_labels = Human Rat
+height = 3
+
+[spacer]
+height = 1
+
+[maf]
+file = first.maf
+reference = mm10
+file_index = /tmp/first.maf.index
+title = species_order = hg19, species_labels = Human, species_order_only = true
+species_order = hg19
+species_labels = Human
+species_order_only = true
+height = 3
+
+[x-axis]
+where = bottom
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test25.ini
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test25.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,21 @@
+[bedgraph_0]
+file = GSM3182416_E12DHL_WT_Hoxd11vp.bedgraph.gz
+title = bedgraph color = blue
+color = blue
+alpha = 1.0
+height = 5.0
+show_data_range = true
+grid = false
+nans_to_zeros = false
+use_middle = false
+file_type = bedgraph
+type = fill
+overlay_previous = no
+max_value = 5
+
+[islands as highlight]
+file = islands.bed
+type = vhighlight
+
+[x-axis]
+where = bottom
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test4.ini
--- a/test-data/test4.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test4.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -9,6 +9,7 @@
 number_of_bins = 2000
 type = fill
 show_data_range = false
+grid = false
 file_type = bigwig
 overlay_previous = no
 [bigwig_1]
@@ -21,6 +22,7 @@
 number_of_bins = 300
 type = fill
 show_data_range = false
+grid = false
 file_type = bigwig
 overlay_previous = share-y
 [x-axis]
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test5.ini
--- a/test-data/test5.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test5.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -1,6 +1,6 @@
 [x-axis]
 where = top
-[genes_0_0]
+[genes_1_0]
 file = dm3_subset_BDGP5.78.gtf.gz
 prefered_name = transcript_name
 merge_transcripts = false
@@ -12,15 +12,16 @@
 display = stacked
 height = 10.0
 labels = true
-file_type = bed
+all_labels_inside = false
+labels_in_margin = false
+file_type = gtf
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
 [spacer]
 height = 1.0
-[genes_1_0]
+[genes_2_0]
 file = dm3_subset_BDGP5.78_asbed4.bed.gz
 title = test
 color = #000000
@@ -30,11 +31,12 @@
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
 file_type = bed
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
 [spacer]
 height = 1.0
\ No newline at end of file
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test6.ini
--- a/test-data/test6.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test6.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -5,6 +5,7 @@
 type = box
 use_summit = true
 height = 4.0
+line_width = 1.0
 show_labels = true
 file_type = narrow_peak
 overlay_previous = no
@@ -15,8 +16,8 @@
 type = box
 use_summit = true
 height = 4.0
+line_width = 2.0
 show_labels = true
-line_width = 2
 file_type = narrow_peak
 overlay_previous = no
 [narrow_peak_2_0]
@@ -29,6 +30,7 @@
 width_adjust = 3.0
 max_value = 50.0
 height = 4.0
+line_width = 1.0
 show_labels = false
 file_type = narrow_peak
 overlay_previous = no
@@ -43,6 +45,7 @@
 show_data_range = false
 width_adjust = 1.5
 height = 4.0
+line_width = 1.0
 show_labels = true
 file_type = narrow_peak
 overlay_previous = no
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test7.ini
--- a/test-data/test7.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test7.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -1,42 +1,79 @@
 [x-axis]
 where = top
-[genes_0_0]
-file = test-data/dm3_genes.bed.gz
-title = genes
+[genes_1_0]
+file = test-data/dm3_subset_BDGP5.78.gtf.gz
+prefered_name = transcript_name
+title = gtf default
 color = #000000
 border_color = #000000
 style = flybase
 height_utr = 1.0
 color_utr = grey
+arrowhead_included = false
+arrowhead_fraction = 0.004
+color_backbone = #000000
 display = stacked
 height = 10.0
 labels = true
-file_type = bed
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
+file_type = gtf
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
-[genes_1_0]
+[genes_2_0]
 file = test-data/dm3_subset_BDGP5.78.gtf.gz
 prefered_name = gene_name
 merge_transcripts = true
-title = gtf
+merge_overlapping_exons = false
+title = gtf merge transcripts, use gene_name, red 0.75 UTR
 color = #000000
 border_color = #000000
 style = flybase
 height_utr = 0.75
 color_utr = #ff0000
+arrowhead_included = false
+arrowhead_fraction = 0.004
+color_backbone = #000000
 display = stacked
 height = 10.0
 labels = true
-file_type = bed
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
+file_type = gtf
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
-[genes_2_0]
+[genes_3_0]
+file = test-data/dm3_subset_BDGP5.78.gtf.gz
+prefered_name = gene_name
+merge_transcripts = true
+merge_overlapping_exons = true
+title = same but merge overlapping exons
+color = #000000
+border_color = #000000
+style = flybase
+height_utr = 0.75
+color_utr = #ff0000
+arrowhead_included = false
+arrowhead_fraction = 0.004
+color_backbone = #000000
+display = stacked
+height = 10.0
+labels = true
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
+file_type = gtf
+global_max_row = false
+max_labels = 60
+line_width = 0.5
+overlay_previous = no
+[genes_4_0]
 file = test-data/dm3_genes_withrgbandscore.bed.gz
 title = genes with scores
 color = cool_r
@@ -44,33 +81,43 @@
 style = flybase
 height_utr = 1.0
 color_utr = grey
+arrowhead_included = false
+arrowhead_fraction = 0.004
+color_backbone = #000000
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
 file_type = bed
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
-[genes_3_0]
+[genes_5_0]
 file = test-data/dm3_genes_withrgbandscore.bed.gz
 title = genes with utr as bed_rgb
-color = black
+color = #000000
 border_color = #000000
 style = flybase
 height_utr = 1.0
 color_utr = bed_rgb
+arrowhead_included = false
+arrowhead_fraction = 0.004
+color_backbone = #000000
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
 file_type = bed
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
-[genes_3_0]
+[genes_6_0]
 file = test-data/dm3_genes_withrgbandscore.bed.gz
 title = genes with coding as bed_rgb - labels_in_margin
 color = bed_rgb
@@ -78,17 +125,21 @@
 style = flybase
 height_utr = 1.0
 color_utr = grey
+arrowhead_included = false
+arrowhead_fraction = 0.004
+color_backbone = #000000
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
 labels_in_margin = true
+fontstyle = normal
 file_type = bed
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
-[genes_4_0]
+[genes_7_0]
 file = test-data/dm3_genes_withrgbandscore.bed.gz
 title = genes bed_rgb like - all_labels_inside
 color = bed_rgb
@@ -96,13 +147,17 @@
 style = flybase
 height_utr = 1.0
 color_utr = bed_rgb
+arrowhead_included = false
+arrowhead_fraction = 0.004
+color_backbone = #000000
 display = stacked
 height = 10.0
 labels = true
 all_labels_inside = true
+labels_in_margin = false
+fontstyle = normal
 file_type = bed
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
\ No newline at end of file
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test8.ini
--- a/test-data/test8.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test8.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -1,6 +1,6 @@
 [x-axis]
 where = top
-[genes_0_0]
+[genes_1_0]
 file = test-data/dm3_genes.bed.gz
 title = dm3_genes.bed
 color = #000000
@@ -10,13 +10,14 @@
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
 file_type = bed
 global_max_row = true
 max_labels = 15
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
-[genes_1_0]
+[genes_2_0]
 file = test-data/dm3_genes.bed.gz
 title = genes.bed.gz
 color = #000000
@@ -26,9 +27,10 @@
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
 file_type = bed
 global_max_row = false
 max_labels = 60
 line_width = 2.0
-arrowhead_included = false
 overlay_previous = no
\ No newline at end of file
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test9.ini
--- a/test-data/test9.ini	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/test9.ini	Sat Oct 01 08:43:22 2022 +0000
@@ -1,29 +1,58 @@
 [x-axis]
 where = top
-[genes_0_0]
+[genes_1_0]
 file = dm3_subset_BDGP5.78.gtf.gz
 prefered_name = transcript_name
 merge_transcripts = false
-title = test
+title = defaut arrowhead fontstyle italic
 color = #000000
 border_color = #000000
 style = flybase
 height_utr = 1.0
 color_utr = grey
+arrowhead_included = false
+arrowhead_fraction = 0.004
 display = stacked
 height = 10.0
 labels = true
-file_type = bed
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = italic
+file_type = gtf
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
 [spacer]
 height = 1.0
-[genes_1_0]
+[genes_2_0]
+file = dm3_subset_BDGP5.78.gtf.gz
+prefered_name = transcript_name
+merge_transcripts = false
+title = arrowhead_fraction 0.1 fontstyle oblique
+color = #000000
+border_color = #000000
+style = flybase
+height_utr = 1.0
+color_utr = grey
+arrowhead_included = false
+arrowhead_fraction = 0.1
+display = stacked
+height = 10.0
+labels = true
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = oblique
+file_type = gtf
+global_max_row = false
+max_labels = 60
+line_width = 0.5
+overlay_previous = no
+[spacer]
+height = 1.0
+[genes_3_0]
 file = dm3_subset_BDGP5.78_asbed4.bed.gz
-title = test
+title = genes without orientation
 color = red
 border_color = #000000
 style = UCSC
@@ -31,35 +60,42 @@
 display = stacked
 height = 10.0
 labels = true
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
 file_type = bed
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = false
 overlay_previous = no
 [spacer]
 height = 1.0
-[genes_2_0]
+[genes_4_0]
 file = dm3_subset_BDGP5.78.gtf.gz
 prefered_name = transcript_name
 merge_transcripts = false
-title = test
+title = arrowhead included
 color = red
 border_color = #000000
 style = flybase
 height_utr = 1.0
 color_utr = grey
+arrowhead_included = true
+arrowhead_fraction = 0.004
 display = stacked
 height = 10.0
 labels = true
-file_type = bed
+all_labels_inside = false
+labels_in_margin = false
+fontstyle = normal
+file_type = gtf
 global_max_row = false
 max_labels = 60
 line_width = 0.5
-arrowhead_included = true
 overlay_previous = no
 [spacer]
 height = 1.0
-[vlines_3]
+[vlines_5]
 file = dm3_subset_BDGP5.78_asbed4.bed.gz
+line_width = 0.5
 type = vlines
\ No newline at end of file
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_TADs_bdgm.png
Binary file test-data/test_TADs_bdgm.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_alpha.png
Binary file test-data/test_alpha.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_arcs_use_middle.png
Binary file test-data/test_arcs_use_middle.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_arrowhead_zoom.png
Binary file test-data/test_arrowhead_zoom.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_gtf_bed4.png
Binary file test-data/test_gtf_bed4.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_gtf_flybase_param.png
Binary file test-data/test_gtf_flybase_param.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_link.png
Binary file test-data/test_link.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_log.png
Binary file test-data/test_log.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_log_grid.png
Binary file test-data/test_log_grid.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_maf.png
Binary file test-data/test_maf.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_matrix_square.png
Binary file test-data/test_matrix_square.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_narrowPeak.png
Binary file test-data/test_narrowPeak.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_operation.png
Binary file test-data/test_operation.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_tssarrow.png
Binary file test-data/test_tssarrow.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_ucsc_param.png
Binary file test-data/test_ucsc_param.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/test_vhighlight.png
Binary file test-data/test_vhighlight.png has changed
diff -r a1abfa420d9d -r 7dd841a32245 test-data/testpyGT.sh
--- a/test-data/testpyGT.sh	Sun Feb 13 22:43:45 2022 +0000
+++ b/test-data/testpyGT.sh	Sat Oct 01 08:43:22 2022 +0000
@@ -20,5 +20,9 @@
 pgt --tracks test-data/test19.ini --region chr2:73,800,000-75,744,000 --fontSize 12 -o test-data/test_log_grid.png
 pgt --tracks test-data/test20.ini --region chrX:3000000-3300000 --fontSize 12 -o test-data/test_arcs_use_middle.png
 pgt --tracks test-data/test21.ini --region X:3000000-3600000 --fontSize 12 --trackLabelFraction 0.3 --plotWidth 12 --dpi 20 -o test-data/master_scale_bar_startend.png
+pgt --tracks test-data/test22.ini --region chrM:10-30 --fontSize 12 -o test-data/master_fasta.png
+pgt --tracks test-data/test23.ini --region chrX:3000000-3300000 --fontSize 12 -o test-data/test_matrix_square.png
+pgt --tracks test-data/test24.ini --region 2:34704975-34705208 --fontSize 12 -o test-data/test_maf.png
+pgt --tracks test-data/test25.ini --region chr2:73,800,000-75,744,000 --fontSize 12 -o test-data/test_vhighlight.png
 
 conda_env_deactivate
diff -r a1abfa420d9d -r 7dd841a32245 tool-data/fasta_indexes.loc.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/fasta_indexes.loc.sample	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,29 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Samtools indexed sequences data files.  You will need
+#to create these data files and then create a fasta_indexes.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The fasta_indexes.loc
+#file has this format (white space characters are TAB characters):
+#
+# <unique_build_id>	<dbkey>	<display_name>	<file_base_path>
+#
+#So, for example, if you had hg19 Canonical indexed stored in
+#
+# /depot/data2/galaxy/hg19/sam/,
+#
+#then the fasta_indexes.loc entry would look like this:
+#
+#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
+#
+#and your /depot/data2/galaxy/hg19/sam/ directory
+#would contain hg19canon.fa and hg19canon.fa.fai files.
+#
+#Your fasta_indexes.loc file should include an entry per line for
+#each index set you have stored.  The file in the path does actually
+#exist, but it should never be directly used. Instead, the name serves
+#as a prefix for the index file.  For example:
+#
+#hg18canon	hg18	Human (Homo sapiens): hg18 Canonical	/depot/data2/galaxy/hg18/sam/hg18canon.fa
+#hg18full	hg18	Human (Homo sapiens): hg18 Full	/depot/data2/galaxy/hg18/sam/hg18full.fa
+#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
+#hg19full	hg19	Human (Homo sapiens): hg19 Full	/depot/data2/galaxy/hg19/sam/hg19full.fa
diff -r a1abfa420d9d -r 7dd841a32245 tool_data_table_conf.xml.sample
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,7 @@
+<tables>
+    <!-- Location of SAMTools indexes for FASTA files -->
+    <table name="fasta_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/fasta_indexes.loc" />
+    </table>
+</tables>
diff -r a1abfa420d9d -r 7dd841a32245 tool_data_table_conf.xml.test
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Sat Oct 01 08:43:22 2022 +0000
@@ -0,0 +1,6 @@
+<tables>
+    <table name="fasta_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="${__HERE__}/test-data/fasta_indexes.loc" />
+    </table>
+</tables>