diff test-data/with_terminal_stop.fasta @ 0:0290a7285026 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/remove_terminal_stop_codons commit 0c1c0e260ebecab6beb23fd56322b391e62d12fa
author iuc
date Fri, 05 Dec 2025 23:22:35 +0000
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/with_terminal_stop.fasta	Fri Dec 05 23:22:35 2025 +0000
@@ -0,0 +1,6 @@
+>seq1 test sequence with terminal TAA stop
+ATGAAACCCGGGTAA
+>seq2 test sequence with terminal TAG stop
+ATGCCCAAAGGGCCCAAATAG
+>seq3 test sequence with terminal TGA stop
+ATGGGGTTTAAACCCGGGTGA