Mercurial > repos > iuc > remove_terminal_stop_codons
diff test-data/with_terminal_stop.fasta @ 0:0290a7285026 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tools/remove_terminal_stop_codons commit 0c1c0e260ebecab6beb23fd56322b391e62d12fa
| author | iuc |
|---|---|
| date | Fri, 05 Dec 2025 23:22:35 +0000 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/with_terminal_stop.fasta Fri Dec 05 23:22:35 2025 +0000 @@ -0,0 +1,6 @@ +>seq1 test sequence with terminal TAA stop +ATGAAACCCGGGTAA +>seq2 test sequence with terminal TAG stop +ATGCCCAAAGGGCCCAAATAG +>seq3 test sequence with terminal TGA stop +ATGGGGTTTAAACCCGGGTGA
