# HG changeset patch
# User iuc
# Date 1454691380 18000
# Node ID ace9f5a2b40f27432107906fc8d1f6a15510cc0e
# Parent  bc685d13b63725c85e430a3d1d95c2959a022724
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/rgrnastar commit a89b30e7cbe4e7db22f36773112f7ed833285cb3

diff -r bc685d13b637 -r ace9f5a2b40f README.rst
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/README.rst	Fri Feb 05 11:56:20 2016 -0500
@@ -0,0 +1,7 @@
+
+System Requirements
+===================
+
+-  **Memory**: To run efficiently, RNA-STAR requires enough free memory to
+   hold the SA-indexed reference genome in RAM. For Human Genome hg19 this is
+   index about 27GB and running RNA-STAR requires approximately ~30GB of RAM.
diff -r bc685d13b637 -r ace9f5a2b40f rg_rnaStar.xml
--- a/rg_rnaStar.xml	Thu Nov 19 05:34:06 2015 -0500
+++ b/rg_rnaStar.xml	Fri Feb 05 11:56:20 2016 -0500
@@ -1,4 +1,4 @@
-<tool id="rna_star" name="RNA STAR" version="2.4.0d">
+<tool id="rna_star" name="RNA STAR" version="2.4.0d-2">
     <description>Gapped-read mapper for RNA-seq data</description>
     <requirements>
         <requirement type="package" version="2.4.0d">rnastar</requirement>
@@ -12,86 +12,160 @@
     </stdio>
 
     <command><![CDATA[
-    ##
-    ## Run STAR.
-    ##
+    ## Create temporary index for custom reference
     #if str($refGenomeSource.genomeSource) == 'history':
-       mkdir -p tempstargenomedir; STAR --runMode genomeGenerate --genomeDir "tempstargenomedir" --genomeFastaFiles "$refGenomeSource.ownFile" --runThreadN 2
+        mkdir -p tempstargenomedir &&
+        STAR
+            --runMode genomeGenerate
+            --genomeDir "tempstargenomedir"
+            --genomeFastaFiles "$refGenomeSource.ownFile"
+            --runThreadN \${GALAXY_SLOTS:-4}
+        
         #if str($refGenomeSource.geneModel) != 'None':
-          --sjdbOverhang "100" --sjdbGTFfile "$refGenomeSource.geneModel"
-          #if str($refGenomeSource.geneModel.ext) == 'gff3':
-            --sjdbGTFtagExonParentTranscript Parent
-          #end if
+            --sjdbOverhang "$refGenomeSource.overhang"
+            --sjdbGTFfile "$refGenomeSource.geneModel"
+            
+            #if str($refGenomeSource.geneModel.ext) == 'gff3':
+                --sjdbGTFtagExonParentTranscript Parent
+            #end if
         #end if
         ;
     #end if
+    
+    
+    ## Actual alignment
     STAR
-    ## Can adjust this as appropriate for the system.
-    --genomeLoad NoSharedMemory
+    --runThreadN \${GALAXY_SLOTS:-4}
+    --genomeLoad NoSharedMemory    
     #if str($refGenomeSource.genomeSource) == 'history':
         --genomeDir "tempstargenomedir"
     #else
         --genomeDir "$refGenomeSource.index.fields.path"
     #end if
-    --readFilesIn $singlePaired.input1
-    #if str($singlePaired.sPaired) == "paired"
-            $singlePaired.input2
+    
+    --readFilesIn
+    #if str($singlePaired.sPaired) == "paired_collection"
+        "$singlePaired.input.forward" "$singlePaired.input.reverse"
+    #else
+        "$singlePaired.input1"
+        #if str($singlePaired.sPaired) == "paired"
+            "$singlePaired.input2"
+        #end if
     #end if
-        --runThreadN \${GALAXY_SLOTS:-4}
-    #if str($params.settingsType) == "full":
-        --chimSegmentMin $params.chim_segment_min
-        --chimScoreMin $params.chim_score_min
-        --seedSearchStartLmax $params.seed_search_start_l_max
-        --alignSJDBoverhangMin $params.align_sjdb_overhang_min
-        --outFilterScoreMinOverLread $params.out_filter_score_min_over_l_read
+
+    ## Output parameters
+    #if str( $output_params.output_select ) == "yes":
+        --outSAMattributes $output_params.outSAMattributes
+        --outSAMstrandField $output_params.outSAMstrandField
+        --outFilterIntronMotifs $output_params.outFilterIntronMotifs
+        #if str( $output_params.output_params2.output_select2 ) == "yes":
+            --outSAMunmapped $output_params.output_params2.unmapped_opt
+            --outSAMprimaryFlag $output_params.output_params2.primary_opt
+            --outSAMmapqUnique "$output_params.output_params2.unique"
+            --outFilterType $output_params.output_params2.sjfilter_opt
+            --outFilterMultimapScoreRange "$output_params.output_params2.multiScoreRange"
+            --outFilterMultimapNmax "$output_params.output_params2.multiNmax"
+            --outFilterMismatchNmax "$output_params.output_params2.mismatchNmax"
+            --outFilterMismatchNoverLmax "$output_params.output_params2.mismatchNoverLmax"
+            --outFilterMismatchNoverReadLmax "$output_params.output_params2.mismatchNoverReadLmax"
+            --outFilterScoreMin "$output_params.output_params2.scoreMin"
+            --outFilterScoreMinOverLread "$output_params.output_params2.scoreMinOverLread"
+            --outFilterMatchNmin "$output_params.output_params2.matchNmin"
+            --outFilterMatchNminOverLread "$output_params.output_params2.matchNminOverLread"
+        #end if
     #end if
 
-    ## may or may not need to generate SAM tags and handle non-canonicals for Cufflinks tools.
-    $outSAMstrandField $outFilterIntronMotifs $outSAMattributes
+    ## Other parameters
+    #if str( $params.settingsType ) == "star_fusion":
+        ## Preset parameters for STAR-Fusion
+##        --twopass1readsN 100000000
+##        --sjdbOverhang 100
+        --outReadsUnmapped None
+        --chimSegmentMin 12
+        --chimJunctionOverhangMin 12
+        --alignSJDBoverhangMin 10
+        --alignMatesGapMax 200000
+        --alignIntronMax 200000
+        ## --chimSegmentReadGapMax 3              ## not an option in STAR 2.4.0
+        ## --alignSJstitchMismatchNmax 5 -1 5 5   ## not an option in STAR 2.4.0
+
+    #elif str( $params.settingsType ) == "full":
+        ## Extended parameter options
+
+        ## Seed parameter options
+        #if str( $params.seed.seed_select ) == "yes":
+            --seedSearchStartLmax "$params.seed.searchStart"
+            --seedSearchStartLmaxOverLread "$params.seed.searchStartNorm"
+            --seedSearchLmax "$params.seed.searchLmax"
+            --seedMultimapNmax "$params.seed.multimap"
+            --seedPerReadNmax "$params.seed.readMax"
+            --seedPerWindowNmax "$params.seed.windowMax"
+            --seedNoneLociPerWindow "$params.seed.oneSeed"
+        #end if
 
-    ;
-    ##
+        ## Alignment parameter options
+        #if str( $params.align.align_select ) == "yes":
+            --alignIntronMin "$params.align.intronMin"
+            --alignIntronMax "$params.align.intronMax"
+            --alignMatesGapMax "$params.align.gapMax"
+            --alignSJoverhangMin "$params.align.sjOverhang"
+            --alignSJDBoverhangMin "$params.align.sjdbOverhang"
+            --alignSplicedMateMapLmin "$params.align.splicedMate"
+            --alignSplicedMateMapLminOverLmate "$params.align.splicedMateNorm"
+            --alignWindowsPerReadNmax "$params.align.windows"
+            --alignTranscriptsPerWindowNmax "$params.align.transWindow"
+            --alignTranscriptsPerReadNmax "$params.align.transRead"
+            --alignEndsType $params.align.endsType_opt
+        #end if
+
+        ## Chimeric alignment parameter options
+        #if str( $params.chim.chim_select ) == "yes":
+            --chimSegmentMin "$params.chim.segmentMin"
+            --chimScoreMin "$params.chim.scoreMin"
+            --chimScoreDropMax "$params.chim.scoreDrop"
+            --chimScoreSeparation "$params.chim.scoreSep"
+            --chimScoreJunctionNonGTAG "$params.chim.scoreJunction"
+            --chimJunctionOverhangMin "$params.chim.junctionOverhang"
+        #end if
+
+    #end if
+
     ## BAM conversion.
-    ##
-
+    
     ## Convert aligned reads.
-    samtools view -Shb Aligned.out.sam | samtools sort - AlignedSorted 2>/dev/null
-
+    && samtools view -@ \${GALAXY_SLOTS:-4} -Shb Aligned.out.sam | samtools sort -@ \${GALAXY_SLOTS:-4} - AlignedSorted 2>/dev/null
+    
     ## Convert chimeric reads.
-    #if str($params.settingsType) == "full" and $params.chim_segment_min > 0:
-        ; samtools view -Shb Chimeric.out.sam | samtools sort - ChimericSorted 2>/dev/null
+    #if str($params.settingsType) == "star_fusion" or ( str($params.settingsType) == "full" and str($params.chim.chim_select) == "yes" and int($params.chim.segmentMin) > 0 ):
+        && samtools view -@ \${GALAXY_SLOTS:-4} -Shb Chimeric.out.sam | samtools sort -@ \${GALAXY_SLOTS:-4} - ChimericSorted 2>/dev/null
     #end if
     ]]></command>
 
     <inputs>
-        <param name="jobName" type="text" value="rna-star run" label="Job narrative (added to output names)"
-          help="Only letters, numbers and underscores (_) will be retained in this field">
-           <sanitizer invalid_char="">
-              <valid initial="string.letters,string.digits"><add value="_" /> </valid>
-           </sanitizer>
-        </param>
         <!-- FASTQ input(s) and options specifically for paired-end data. -->
         <conditional name="singlePaired">
-            <param name="sPaired" type="select" label="Single ended or mate-pair ended reads in this library?">
+            <param name="sPaired" type="select" label="Single-end or paired-end reads">
               <option value="single" selected="true">Single-end</option>
-              <option value="paired">Paired-end</option>
+              <option value="paired">Paired-end (as individual datasets)</option>
+              <option value="paired_collection">Paired-end (as collection)</option>
             </param>
             <when value="single">
-                <param format="fastqsanger,fastq,fasta" name="input1" type="data" label="RNA-Seq FASTQ file" help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33"/>
+                <param format="fastq,fasta" name="input1" type="data" label="RNA-Seq FASTQ/FASTA file"/>
             </when>
             <when value="paired">
-                <param format="fastqsanger,fastq,fasta" name="input1" type="data" label="RNA-Seq FASTQ file, forward reads"
-            help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" />
-                <param format="fastqsanger,fastq,fasta" name="input2" type="data" label="RNA-Seq FASTQ file, reverse reads"
-            help="Nucleotide-space: Must have Sanger-scaled quality values with ASCII offset 33" />
+                <param format="fastq,fasta" name="input1" type="data" label="RNA-Seq FASTQ/FASTA file, forward reads"/>
+                <param format="fastq,fasta" name="input2" type="data" label="RNA-Seq FASTQ/FASTA file, reverse reads"/>
+            </when>
+            <when value="paired_collection">
+                <param format="fastq,fasta" name="input" type="data_collection" collection_type="paired" label="RNA-Seq FASTQ/FASTA paired reads"/>
             </when>
         </conditional>
 
         <!-- Genome source. -->
         <conditional name="refGenomeSource">
-            <param name="genomeSource" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+            <param name="genomeSource" type="select" label="Custom or built-in reference genome" help="Built-ins were indexed using default options">
                 <option value="indexed" selected="True">Use a built-in index</option>
-                <option value="history">Index and use a genome fasta file from my current history</option>
+                <option value="history">Index and use a genome fasta and GTF file from history</option>
             </param>
             <when value="indexed">
             <param name="index" type="select" label="Select a reference genome">
@@ -104,220 +178,325 @@
             <when value="history">
                 <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
                 <param name="geneModel" type="data" format="gff3,gtf" label="Gene model (gff3,gtf) file for splice junctions. Leave blank for none"
-                optional="true" help="Optional. If supplied, the index file will retain exon junction information for mapping splices" />
+                    optional="true" help="Optional. If supplied, the index file will retain exon junction information for mapping splices (--sjdbGTFfile)"/>
+                <param name="overhang" type="integer" min="0" value="100" label="Length of the genomic sequence around annotated junctions" help="Used in constructing the splice junctions database. Ideal value is ReadLength-1 (--sjdbOverhang)"/>
             </when>
         </conditional>
-            <param name="outSAMattributes" type="select" label="Include extra sam attributes for downstream processing">
-              <option value="--outSAMattributes Standard">Standard - eg for old Samtools downstream</option>
-              <option value="--outSAMattributes All" selected="true">All modern Samtools attributes - see below</option>
+        
+        <!-- Output parameter settings. -->
+        <conditional name="output_params">
+          <param name="output_select" type="select" label="Would you like to set output parameters (formatting and filtering)?">
+            <option value="no" selected="true">No</option>
+            <option value="yes">Yes</option>
+          </param>
+          <when value="yes">
+            <param name="outSAMattributes" type="select" label="Extra SAM attributes to include" help="See &quot;Extra SAM attributes&quot; below (--outSAMattributes)">
+              <option value="Standard" selected="true">Standard</option>
+              <option value="All">All</option>
+              <option value="None">None</option>
+            </param>
+            <param name="outSAMstrandField" type="select" label="Include strand field flag XS" help="For Cufflinks compatibility with unstranded RNA-seq data, this option is required (--outSAMstrandField)">
+              <option value="None" selected="true">No</option>
+              <option value="intronMotif">Yes -- and reads with inconsistent and/or non-canonical introns are filtered out</option>
+            </param>
+            <param name="outFilterIntronMotifs" type="select" label="Filter alignments containing non-canonical junctions" help="For Cufflinks compatibility, removing alignments with non-canonical junctions is recommended (--outFilterIntronMotifs)">
+              <option value="None" selected="true">No</option>
+              <option value="RemoveNoncanonical">Remove alignments with non-canonical junctions</option>
+              <option value="RemoveNoncanonicalUnannotated">Remove alignments with unannotated non-canonical junctions</option>
             </param>
-            <param name="outSAMstrandField" type="select" label="Include extra sam attributes for downstream processing">
-              <option value="--outSAMstrandField intronMotif" selected="true">Add XS for cufflinks</option>
-              <option value="">No XS added to sam output</option>
-            </param>
-            <param name="outFilterIntronMotifs" type="select" label="Canonical junction preparation for unstranded data (--outFilterIntronMotifs)">
-              <option value="">No special handling - all non-canonical junctions passed through</option>
-              <option value="--outFilterIntronMotifs RemoveNoncanonical" selected="true">Remove all non-canonical junctions for eg cufflinks</option>
-              <option value="--outFilterIntronMotifs RemoveNoncanonicalUnannotated">Remove only unannotated non-canonical junctions for eg cufflinks</option>
-            </param>
-        <!-- Parameter settings. -->
+
+            <!-- Additional output parameter settings. -->
+            <conditional name="output_params2">
+              <param name="output_select2" type="select" label="Would you like to set additional output parameters (formatting and filtering)?">
+                <option value="no" selected="true">No</option>
+                <option value="yes">Yes</option>
+              </param>
+              <when value="yes">
+                <param name="unmapped_opt" type="boolean" truevalue="Within" falsevalue="None" checked="false" label="Would you like unmapped reads included in the SAM?" help="(--outSAMunmapped)"/>
+                <param name="primary_opt" type="boolean" truevalue="AllBestScore" falsevalue="OneBestScore" checked="false" label="Would you like all alignments with the best score labeled primary?" help="(--outSAMprimaryFlag)"/>
+                <param name="unique" type="integer" value="255" min="0" max="255" label="MAPQ value for unique mappers" help="(--outSAMmapqUnique)"/>
+                <param name="sjfilter_opt" type="boolean" truevalue="BySJout" falsevalue="Normal" checked="false" label="Would you like to keep only reads that contain junctions that passed filtering?" help="(--outFilterType)"/>
+                <param name="multiScoreRange" type="integer" value="1" min="0" label="Score range below the maximum score for multimapping alignments" help="(--outFilterMultimapScoreRange)"/>
+                <param name="multiNmax" type="integer" value="10" min="1" label="Maximum number of alignments to output a read's alignment results, plus 1" help="Reads with at least this number of alignments will have no alignments output (--outFilterMultimapNmax)"/>
+                <param name="mismatchNmax" type="integer" value="10" min="0" label="Maximum number of mismatches to output an alignment, plus 1" help="Alignments with at least this number of mismatches will not be output (--outFilterMismatchNmax)"/>
+                <param name="mismatchNoverLmax" type="float" value="0.3" min="0" max="1" label="Maximum ratio of mismatches to mapped length" help="Alignments with a mismatch ratio of at least this value will not be output (--outFilterMismatchNoverLmax)"/>
+                <param name="mismatchNoverReadLmax" type="float" value="1" min="0" max="1" label="Maximum ratio of mismatches to read length" help="Alignments with a mismatch ratio of at least this value will not be output (--outFilterMismatchNoverReadLmax)"/>
+                <param name="scoreMin" type="integer" value="0" min="0" label="Minimum alignment score" help="Alignments must have scores higher than this value to be output (--outFilterScoreMin)"/>
+                <param name="scoreMinOverLread" type="float" value="0.66" min="0" max="1" label="Minimum alignment score, normalized to read length" help="Alignments must have (normalized) scores higher than this value to be output (--outFilterScoreMinOverLread)"/>
+                <param name="matchNmin" type="integer" value="0" min="0" label="Minimum number of matched bases" help="Alignments must have the number of matched bases higher than this value to be output (--outFilterMatchNmin)"/>
+                <param name="matchNminOverLread" type="float" value="0.66" min="0" max="1" label="Minimum number of matched bases, normalized to read length" help="Alignments must have the (normalized) number of matched bases higher than this value to be output (--outFilterMatchNminOverLread)"/>
+              </when>
+              <when value="no"/>
+            </conditional>
+
+          </when>
+          <when value="no"/>
+        </conditional>
+
+        <!-- Other parameter settings. -->
         <conditional name="params">
-            <param name="settingsType" type="select" label="Settings to use" help="You can use the default settings or set custom values for any STAR parameter.">
-                <option value="preSet" selected="true">Use Defaults</option>
-                <option value="full">Full parameter list</option>
-            </param>
-            <when value="preSet" />
-            <!-- Full/advanced params. -->
-            <when value="full">        
-                <param name="chim_segment_min" type="integer" min="0" value="0" label="Minimum chimeric segment length (--chimSegmentMin)" />
-                <param name="chim_score_min" type="integer" min="0" value="0" label="Minimum total (summed) score of the chimeric segments (--chimScoreMin)" />
-                <param name="seed_search_start_l_max" type="integer" min="0" value="50" label="Defines the search start point through the read - the read is split into pieces no longer than this value (--seedSearchStartLmax)" />
-                <param name="align_sjdb_overhang_min" type="integer" value="1" label="Minimum overhang for annotated junctions (--alignSJDBoverhangMin)" />
-                <param name="out_filter_score_min_over_l_read" type="float" value="0.66" label="OutFilterScoreMin normalized to read length; sum of mates’ lengths for paired-end reads (--outFilterScoreMinOverLread)" />
-            </when>
+          <param name="settingsType" type="select" label="Other parameters (seed, alignment, and chimeric alignment)">
+            <option value="default" selected="true">Use Defaults</option>
+            <option value="star_fusion">Use parameters suggested for STAR-Fusion</option>
+            <option value="full">Extended parameter list</option>
+          </param>
+          <when value="default"/>
+          <when value="star_fusion"/> <!-- Set STAR-fusion parameters automatically -->
+
+          <when value="full">
+
+            <!-- Seed parameters -->
+            <conditional name="seed">
+              <param name="seed_select" type="select" label="Would you like to set seed parameters?">
+                <option value="no" selected="true">No</option>
+                <option value="yes">Yes</option>
+              </param>
+              <when value="yes">
+                <param name="searchStart" type="integer" min="1" value="50" label="Search start point through the read" help="(--seedSearchStartLmax)"/>
+                <param name="searchStartNorm" type="float" min="0" value="1.0" label="Search start point through the read, normalized to read length" help="(--seedSearchStartLmaxOverLread)"/>
+                <param name="searchLmax" type="integer" min="0" value="0" label="Maximum length of seeds" help="Default of 0 indicates no maximum length (--seedSearchLmax)"/>
+                <param name="multimap" type="integer" min="1" value="10000" label="Maximum number of mappings to use a piece in stitching" help="(--seedMultimapNmax)"/>
+                <param name="readMax" type="integer" min="1" value="1000" label="Maximum number of seeds per read" help="(--seedPerReadNmax)"/>
+                <param name="windowMax" type="integer" min="1" value="50" label="Maximum number of seeds per window" help="(--seedPerWindowNmax)"/>
+                <param name="oneSeed" type="integer" min="1" value="10" label="Maximum number of one seed loci per window" help="(--seedNoneLociPerWindow)"/>
+              </when>
+              <when value="no"/>
+            </conditional>
+
+            <!-- Alignment parameters -->
+            <conditional name="align">
+              <param name="align_select" type="select" label="Would you like to set alignment parameters?">
+                <option value="no" selected="true">No</option>
+                <option value="yes">Yes</option>
+              </param>
+              <when value="yes">
+                <param name="intronMin" type="integer" min="0" value="21" label="Minimum intron size" help="(--alignIntronMin)"/>
+                <param name="intronMax" type="integer" min="0" value="0" label="Maximum intron size" help="(--alignIntronMax)"/>
+                <param name="gapMax" type="integer" min="0" value="0" label="Maximum gap between two mates" help="(--alignMatesGapMax)"/>
+                <param name="sjOverhang" type="integer" min="1" value="5" label="Minimum overhang for spliced alignments" help="(--alignSJoverhangMin)"/>
+                <param name="sjdbOverhang" type="integer" min="1" value="3" label="Minimum overhang for annotated spliced alignments" help="(--alignSJDBoverhangMin)"/>
+                <param name="splicedMate" type="integer" min="0" value="0" label="Minimum mapped length for a read mate that is spliced" help="(--alignSplicedMateMapLmin)"/>
+                <param name="splicedMateNorm" type="float" min="0" value="0.66" label="Minimum mapped length for a read mate that is spliced, normalized to mate length" help="(--alignSplicedMateMapLminOverLmate)"/>
+                <param name="windows" type="integer" min="1" value="10000" label="Maximum number of windows per read" help="(--alignWindowsPerReadNmax)"/>
+                <param name="transWindow" type="integer" min="1" value="100" label="Maximum number of transcripts per window" help="(--alignTranscriptsPerWindowNmax)"/>
+                <param name="transRead" type="integer" min="1" value="10000" label="Maximum number of different alignments per read to consider" help="(--alignTranscriptsPerReadNmax)"/>
+                <param name="endsType_opt" type="boolean" truevalue="EndToEnd" falsevalue="Local" checked="false" label="Use end-to-end read alignments, with no soft-clipping?" help="(--alignEndsType)"/>
+              </when>
+              <when value="no"/>
+            </conditional>
+
+            <!-- Chimeric alignment parameters -->
+            <conditional name="chim">
+              <param name="chim_select" type="select" label="Would you like to set chimeric alignment parameters?">
+                <option value="no" selected="true">No</option>
+                <option value="yes">Yes</option>
+              </param>
+              <when value="yes">
+                <param name="segmentMin" type="integer" min="0" value="0" label="Minimum length of chimeric segment" help="Default of 0 means no chimeric output (--chimSegmentMin)"/>
+                <param name="scoreMin" type="integer" min="0" value="0" label="Minimum total (summed) score of chimeric segments" help="(--chimScoreMin)"/>
+                <param name="scoreDrop" type="integer" min="0" value="20" label="Maximum difference of chimeric score from read length" help="(--chimScoreDropMax)"/>
+                <param name="scoreSep" type="integer" min="0" value="10" label="Minimum difference between the best chimeric score and the next one" help="(--chimScoreSeparation)"/>
+                <param name="scoreJunction" type="integer" value="-1" label="Penalty for a non-GT/AG chimeric junction" help="(--chimScoreJunctionNonGTAG)"/>
+                <param name="junctionOverhang" type="integer" min="0" value="20" label="Minimum overhang for a chimeric junction" help="(--chimJunctionOverhangMin)"/>
+              </when>
+              <when value="no"/>
+            </conditional>
+
+          </when>
         </conditional>
+        
     </inputs>
 
     <outputs>
-       <data format="txt" name="output_log" label="${jobName}.log" from_work_dir="Log.final.out"/>
-       <data format="interval" name="chimeric_junctions" label="${jobName}_starchimjunc.bed" from_work_dir="Chimeric.out.junction">
-          <filter>(params['settingsType'] == 'full' and params['chim_segment_min'] > 0)</filter>
-          <actions>
-             <conditional name="refGenomeSource.genomeSource">
-             <when value="indexed">
-               <action type="metadata" name="dbkey">
-                <option type="from_data_table" name="rnastar_index" column="1" offset="0">
-                 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
-                  <filter type="param_value" ref="refGenomeSource.index" column="0"/>
-                </option>
-               </action>
-             </when>
-             <when value="history">
-               <action type="metadata" name="dbkey">
-                 <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" />
-               </action>
-             </when>
-             </conditional>
-          </actions>
-       </data>
-       <data format="bam" name="chimeric_reads" label="${jobName}_starmappedchim.bam"
-                    from_work_dir="ChimericSorted.bam">
-         <filter>(params['settingsType'] == 'full' and params['chim_segment_min'] > 0)</filter>
-          <actions>
-             <conditional name="refGenomeSource.genomeSource">
-             <when value="indexed">
-               <action type="metadata" name="dbkey">
-                <option type="from_data_table" name="rnastar_index" column="1" offset="0">
-                 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
-                  <filter type="param_value" ref="refGenomeSource.index" column="0"/>
-                </option>
-               </action>
-             </when>
-             <when value="history">
-               <action type="metadata" name="dbkey">
-                 <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" />
-               </action>
-             </when>
-             </conditional>
-          </actions>
+        <data format="txt" name="output_log" label="${tool.name} on ${on_string}: log" from_work_dir="Log.final.out"/>
+        <data format="interval" name="chimeric_junctions" label="${tool.name} on ${on_string}: starchimjunc" from_work_dir="Chimeric.out.junction">
+            <filter>params['settingsType'] == "star_fusion" or ( params['settingsType'] == "full" and params['chim']['chim_select'] == "yes" and params['chim']['segmentMin'] > 0 )</filter>
+            <actions>
+                <conditional name="refGenomeSource.genomeSource">
+                    <when value="indexed">
+                        <action type="metadata" name="dbkey">
+                            <option type="from_data_table" name="rnastar_index" column="1" offset="0">
+                                <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
+                                <filter type="param_value" ref="refGenomeSource.index" column="0"/>
+                            </option>
+                        </action>
+                    </when>
+                    <when value="history">
+                        <action type="metadata" name="dbkey">
+                            <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" />
+                        </action>
+                    </when>
+                </conditional>
+            </actions>
         </data>
-        <data format="interval" name="splice_junctions" label="${jobName}_starsplicejunct.bed"
-                   from_work_dir="SJ.out.tab">
-          <actions>
-             <conditional name="refGenomeSource.genomeSource">
-             <when value="indexed">
-               <action type="metadata" name="dbkey">
-                <option type="from_data_table" name="rnastar_index" column="1" offset="0">
-                 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
-                  <filter type="param_value" ref="refGenomeSource.index" column="0"/>
-                </option>
-               </action>
-             </when>
-             <when value="history">
-               <action type="metadata" name="dbkey">
-                 <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" />
-               </action>
-             </when>
-             </conditional>
-          </actions>
+
+        <data format="bam" name="chimeric_reads" label="${tool.name} on ${on_string}: starmappedchim.bam" from_work_dir="ChimericSorted.bam">
+            <filter>params['settingsType'] == "star_fusion" or ( params['settingsType'] == "full" and params['chim']['chim_select'] == "yes" and params['chim']['segmentMin'] > 0 )</filter>
+            <actions>
+                <conditional name="refGenomeSource.genomeSource">
+                    <when value="indexed">
+                        <action type="metadata" name="dbkey">
+                            <option type="from_data_table" name="rnastar_index" column="1" offset="0">
+                                <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
+                                <filter type="param_value" ref="refGenomeSource.index" column="0"/>
+                            </option>
+                        </action>
+                    </when>
+                    <when value="history">
+                        <action type="metadata" name="dbkey">
+                            <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" />
+                        </action>
+                    </when>
+                </conditional>
+            </actions>
         </data>
-        <data format="bam" name="mapped_reads" label="${jobName}_starmapped.bam"
-                    from_work_dir="AlignedSorted.bam">
-          <actions>
-             <conditional name="refGenomeSource.genomeSource">
-             <when value="indexed">
-               <action type="metadata" name="dbkey">
-                <option type="from_data_table" name="rnastar_index" column="1" offset="0">
-                 <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
-                  <filter type="param_value" ref="refGenomeSource.index" column="0"/>
-                </option>
-               </action>
-             </when>
-             <when value="history">
-               <action type="metadata" name="dbkey">
-                 <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" />
-               </action>
-             </when>
-             </conditional>
-          </actions>
+        
+        <data format="interval" name="splice_junctions" label="${tool.name} on ${on_string}: starsplicejunct.bed" from_work_dir="SJ.out.tab">
+            <actions>
+                <conditional name="refGenomeSource.genomeSource">
+                    <when value="indexed">
+                        <action type="metadata" name="dbkey">
+                            <option type="from_data_table" name="rnastar_index" column="1" offset="0">
+                                <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
+                                <filter type="param_value" ref="refGenomeSource.index" column="0"/>
+                            </option>
+                        </action>
+                    </when>
+                    <when value="history">
+                        <action type="metadata" name="dbkey">
+                            <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" />
+                        </action>
+                    </when>
+                </conditional>
+            </actions>
+        </data>
+        
+        <data format="bam" name="mapped_reads" label="${tool.name} on ${on_string}: starmapped.bam" from_work_dir="AlignedSorted.bam">
+            <actions>
+                <conditional name="refGenomeSource.genomeSource">
+                    <when value="indexed">
+                        <action type="metadata" name="dbkey">
+                            <option type="from_data_table" name="rnastar_index" column="1" offset="0">
+                                <filter type="param_value" column="0" value="#" compare="startswith" keep="False"/>
+                                <filter type="param_value" ref="refGenomeSource.index" column="0"/>
+                            </option>
+                        </action>
+                    </when>
+                    <when value="history">
+                        <action type="metadata" name="dbkey">
+                            <option type="from_param" name="refGenomeSource.ownFile" param_attribute="dbkey" />
+                        </action>
+                    </when>
+                </conditional>
+            </actions>
         </data>
     </outputs>
+
     <tests>
         <test>
-            <param name='input1' value='tophat_in2.fastqsanger' ftype='fastqsanger' />
-            <param name='jobName' value='rnastar_test' />
-            <param name='genomeSource' value='history' />
-            <param name='ownFile' value='tophat_test.fa' />
-            <param name='sPaired' value='single' />
-            <param name='outSAMattributes' value='--outSAMattributes All' />
-            <param name='outSAMstrandField' value='--outSAMstrandField intronMotif' />
-            <param name='outFilterIntronMotifs' value='--outFilterIntronMotifs RemoveNoncanonical' />
+            <param name="input1" value="tophat_in2.fastqsanger" ftype="fastqsanger" />
+            <param name="genomeSource" value="history" />
+            <param name="ownFile" value="tophat_test.fa" />
+            <param name="sPaired" value="single" />
+
+            <param name="output_select" value="yes" />
+            <param name="outSAMattributes" value="All" />
+            <param name="outSAMstrandField" value="intronMotif" />
+            <param name="settingsType" value="default" />
             
-            <output name='output_log' file='rnastar_test.log' compare='diff' lines_diff = '10'/>
-            <output name='splice_junctions' file="rnastar_test_splicejunctions.bed"/>
-            <output name='mapped_reads' file="rnastar_test_mapped_reads.bam" compare="sim_size" delta="200" />
+            <output name="output_log" file="rnastar_test.log" compare="diff" lines_diff = "10"/>
+            <output name="splice_junctions" file="rnastar_test_splicejunctions.bed"/>
+            <output name="mapped_reads" file="rnastar_test_mapped_reads.bam" compare="sim_size" delta="200" />
         </test>
         <test>
-            <param name='input1' value='tophat_in2.fastqsanger' ftype='fastqsanger' />
-            <param name='jobName' value='rnastar_test' />
-            <param name='genomeSource' value='history' />
-            <param name='ownFile' value='tophat_test.fa' />
-            <param name='sPaired' value='single' />
-            <param name='outSAMattributes' value='--outSAMattributes All' />
-            <param name='outSAMstrandField' value='--outSAMstrandField intronMotif' />
-            <param name='outFilterIntronMotifs' value='--outFilterIntronMotifs RemoveNoncanonical' />
+            <param name="input1" value="tophat_in2.fastqsanger" ftype="fastqsanger" />
+            <param name="genomeSource" value="history" />
+            <param name="ownFile" value="tophat_test.fa" />
+            <param name="sPaired" value="single" />
             
+            <param name="output_select" value="yes" />
+            <param name="outSAMattributes" value="All" />
+            <param name="outSAMstrandField" value="intronMotif" />
+            <param name="outFilterIntronMotifs" value="RemoveNoncanonical" />
+            
+            <param name="output_select2" value="yes" />
+            <param name="scoreMinOverLread" value="0.9" />
             <param name="settingsType" value="full" />
-
-            <param name="chim_segment_min" value="0" />
-            <param name="chim_score_min" value="0" />
-            <param name="seed_search_start_l_max" value="25" />
-            <param name="align_sjdb_overhang_min" value="3" />
-            <param name="out_filter_score_min_over_l_read" value="0.9" />
+            <param name="seed_select" value="yes" />
+            <param name="searchStart" value="25" />
 
-            <output name='output_log' file='rnastar_test2.log' compare='diff' lines_diff = '10'/>
-            <output name='splice_junctions' file="rnastar_test2_splicejunctions.bed"/>
-            <output name='mapped_reads' file="rnastar_test2_mapped_reads.bam" compare="sim_size" delta="200" />
+            <output name="output_log" file="rnastar_test2.log" compare="diff" lines_diff="10"/>
+            <output name="splice_junctions" file="rnastar_test2_splicejunctions.bed"/>
+            <output name="mapped_reads" file="rnastar_test2_mapped_reads.bam" compare="sim_size" delta="200" />
         </test>
-    </tests>
-<help>
-**What it does**
-Runs the rna star gapped aligner. Suited to paired or single end rna-seq.
-
-8.2: SAM alignments
 
-The number of loci Nmap a read maps to (multi-mapping) is given by NH:i: field.
-The mapping quality MAPQ (column 5) is 255 for uniquely mapping reads, and int(-10*log10(1-1/Nmap)) for
-multi-mapping reads. This scheme is same as the one used by Tophat and is compatible with Cufflinks.
-
-For multi-mappers, all alignments except one are marked with 0x100 (secondary alignment) in the FLAG
-column 2. The un-marked alignment is either the best one (i.e. highest scoring), or is randomly selected from
-the alignments of equal quality.
-
-8.2.1: Standard SAM attributes
-With default --outSAMattributes Standard option the following SAM attributes will be generated:
+        <test>
+            <param name="input1" value="test3.fastqsanger" ftype="fastqsanger" />
+            <param name="genomeSource" value="history" />
+            <param name="ownFile" value="test3.ref.fa" />
+            <param name="sPaired" value="single" />
 
-Column 12: NH: number of loci a read (pair) maps to
-Column 13: IH: alignment index for all alignments of a read
-Column 14: aS: alignment score
-Column 15: nM: number of mismatches (does not include indels)
-
-8.2.2: Extra SAM attrbiutes
-If --outSAMattributes All option is used, the following additional attributes will be output:
-
-Column 16: jM:B:c,M1,M2,... Intron motifs for all junctions (i.e. N in CIGAR):
-0: non-canonical; 1:GT/AG, 2: CT/AC, 3: GC/AG, 4: CT/GC, 5: AT/AC, 6: GT/AT.
-
-If splice junctions database is used, and a junction is annotated, 20 is added to its motif value.
-Column 17: jI:B:I,Start1,End1,Start2,End2,... Start and End of introns for all junctions (1-based)
-
-Note, that samtools 0.1.18 or later have to be used with these extra attributes.
-
-
-8.2.3: XS SAM strand attribute for Cufflinks/Cuffdiff
+            <param name="output_select" value="yes" />
+            <param name="outSAMattributes" value="All" />
+            <param name="outSAMstrandField" value="intronMotif" />
+            <param name="settingsType" value="star_fusion" />
+            
+            <output name="chimeric_junctions" file="test3.chimjunc.tabular"/>
+        </test>
+        
+        <test>
+            <param name="input1" value="tophat_in2.fastqsanger" ftype="fastqsanger" />
+            <param name="genomeSource" value="history" />
+            <param name="ownFile" value="tophat_test.fa" />
+            <param name="sPaired" value="single" />
+            
+            <param name="output_select" value="yes" />
+            <param name="outSAMattributes" value="All" />
+            <param name="outSAMstrandField" value="intronMotif" />
+            <param name="outFilterIntronMotifs" value="RemoveNoncanonical" />
+            
+            <param name="output_select2" value="yes" />
+            <param name="settingsType" value="full" />
+            <param name="seed_select" value="yes" />
+            <param name="align_select" value="yes" />
+            <param name="chim_select" value="yes" />
+            
+            <!-- Uses default settings, should be similar to test1, but tests the parameters -->
+            <output name="output_log" file="rnastar_test.log" compare="diff" lines_diff="10"/>
+            <output name="splice_junctions" file="rnastar_test_splicejunctions.bed"/>
+            <output name="mapped_reads" file="rnastar_test_mapped_reads.bam" compare="sim_size" delta="634" /><!-- header is 434 bytes larger  -->
+        </test>
 
-If you have un-stranded RNA-seq data, and wish to run Cufflinks/Cuffdiff on STAR alignments, you will
-need to run STAR with --outSAMstrandField intronMotif option, which will generate the XS
-strand attribute for all alignments that contain splice junctions. The spliced alignments that have undefined
-strand (i.e. containing only non-canonical junctions) will be suppressed.
+    </tests>
+    <help>
+**What it does**
+
+This tool runs STAR, an ultrafast universal RNA-seq aligner.
 
-If you have stranded RNA-seq data, you do not need to use any specific STAR options. Instead, you need
-to run Cufflinks with the library option --library-type options. For example, cufflinks with
-library-type fr-firststrand should be used for the b
+**Extra SAM attributes**
+
+The Standard option includes the following four attributes::
 
-It is recommended to remove the non-canonical junctions for Cufflinks runs using b
+  NH: Number of reported alignments that contain the query in the current record.
+  HI: Query hit index, indicating the alignment record is the i-th one stored in SAM
+  AS: Local alignment score (paired for paired-end reads)
+  nM: Number of mismatches per (paired) alignment
 
+The All option includes the Standard attributes, plus the following four::
 
---outFilterIntronMotifs RemoveNoncanonical
-filter out alignments that contain non-canonical junctions
-
-OR
+  NM: Edit distance to the reference, including ambiguous bases but excluding clipping
+  MD: String for mismatching positions
+  jM: Intron motifs for all junctions
+  jI: Start and end of introns for all junctions
 
---outFilterIntronMotifs RemoveNoncanonicalUnannotated
-filter out alignments that contain non-canonical unannotated junctions
-when using annotated splice junctions database. The annotated non-
-canonical junctions will be kept.
+**STAR-Fusion**
 
+STAR-Fusion_ is used to identify candidate fusion transcripts. The recommended_ parameters for running
+STAR prior to STAR-Fusion can be pre-selected, with the following exceptions::
+
+  --twopassMode Basic                   # not an option in STAR 2.4.0
+  --chimSegmentReadGapMax 3             # not an option in STAR 2.4.0
+  --alignSJstitchMismatchNmax 5 -1 5 5  # not an option in STAR 2.4.0
 
 **Attributions**
 
@@ -341,13 +520,13 @@
 
 .. _STAR: https://bitbucket.org/jgoecks/jeremys-code/raw/fa1930a689b8e2f6b59cc1706e5ba0ed8ad357be/galaxy/tool-wrappers/star.xml
 .. _licensed: http://creativecommons.org/licenses/by-nc-nd/3.0/
+.. _STAR-Fusion: https://github.com/STAR-Fusion/STAR-Fusion
+.. _recommended: https://github.com/STAR-Fusion/STAR-Fusion/wiki#alternatively-running-star-yourself-and-then-running-star-fusion-using-the-existing-outputs
 .. _rna_star: https://github.com/alexdobin/STAR
 .. _rna_starMS: http://bioinformatics.oxfordjournals.org/content/29/1/15.full
 .. _Galaxy: http://getgalaxy.org
-
 </help>
-<citations>
-    <citation type="doi">10.1093/bioinformatics/bts635</citation>
-</citations>
+    <citations>
+        <citation type="doi">10.1093/bioinformatics/bts635</citation>
+    </citations>
 </tool>
-
diff -r bc685d13b637 -r ace9f5a2b40f test-data/test3.chimjunc.tabular
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test3.chimjunc.tabular	Fri Feb 05 11:56:20 2016 -0500
@@ -0,0 +1,24 @@
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_60	181	60M15S	241	60S15M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_62	183	58M17S	241	58S17M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_64	185	56M19S	241	56S19M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_66	187	54M21S	241	54S21M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_68	189	52M23S	241	52S23M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_70	191	50M25S	241	50S25M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_72	193	48M27S	241	48S27M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_74	195	46M29S	241	46S29M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_76	197	44M31S	241	44S31M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_78	199	42M33S	241	42S33M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_80	201	40M35S	241	40S35M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_82	203	38M37S	241	38S37M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_84	205	36M39S	241	36S39M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_86	207	34M41S	241	34S41M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_88	209	32M43S	241	32S43M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_90	211	30M45S	241	30S45M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_92	213	28M47S	241	28S47M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_94	215	26M49S	241	26S49M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_96	217	24M51S	241	24S51M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_98	219	22M53S	241	22S53M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_100	221	20M55S	241	20S55M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_102	223	18M57S	241	18S57M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_104	225	16M59S	241	16S59M
+chr1	241	+	chr2	240	+	0	0	0	test_chimeric_mRNA_106	227	14M61S	241	14S61M
diff -r bc685d13b637 -r ace9f5a2b40f test-data/test3.fastqsanger
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test3.fastqsanger	Fri Feb 05 11:56:20 2016 -0500
@@ -0,0 +1,332 @@
+@test_chimeric_mRNA_0
+CAAACTCCTGATCCAGTTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_2
+AACTCCTGATCCAGTTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_4
+CTCCTGATCCAGTTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_6
+CCTGATCCAGTTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_8
+TGATCCAGTTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_10
+ATCCAGTTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_12
+CCAGTTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_14
+AGTTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_16
+TTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_18
+TAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_20
+ACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_22
+TCACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_24
+ACCAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_26
+CAAATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_28
+AATTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_30
+TTATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_32
+ATAGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_34
+AGCCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_36
+CCATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_38
+ATACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_40
+ACAGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_42
+AGACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_44
+ACCCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_46
+CCAAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_48
+AAATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_50
+ATTTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_52
+TTTAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_54
+TAAATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_56
+AATCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_58
+TCATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_60
+ATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_62
+ATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_64
+CACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_66
+CGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_68
+CGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_70
+ACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_72
+TAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_74
+GCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_76
+CTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_78
+CTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_80
+GCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_82
+TTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_84
+AATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_86
+TTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_88
+TCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_90
+TGTGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_92
+TGCTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_94
+CTCAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_96
+CAAGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_98
+AGGGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_100
+GGTTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_102
+TTTTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_104
+TTGGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_106
+GGTCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_108
+TCCGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_110
+CGCCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_112
+CCCGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_114
+CGAGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_116
+AGCGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_118
+CGTTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_120
+TTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_122
+ATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_124
+CGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_126
+TAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_128
+AGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_130
+GAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_132
+ACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_134
+AGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_136
+CCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_138
+GATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_140
+TCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_142
+TTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_144
+AATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_146
+TGGATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_148
+GATGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_150
+TGGCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_152
+GCCGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_154
+CGCAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_156
+CAGGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGGCGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_158
+GGTGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGGCGATTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_160
+TGGTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGGCGATTCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_162
+GTATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGGCGATTCTATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@test_chimeric_mRNA_164
+ATGGAAGCTATAAGCGCGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGGCGATTCTATAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
diff -r bc685d13b637 -r ace9f5a2b40f test-data/test3.ref.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test3.ref.fa	Fri Feb 05 11:56:20 2016 -0500
@@ -0,0 +1,18 @@
+>chr1
+GACGGACGTATTCCTCTGGCCTCAACGGTTCCTGCTTTCGCTGGGATCCAAGATTGGCAG
+CTGAAACCGCCTTTCCAAAGTGAGTCCTTCGTCTGTGACTAACTGTGCCAAATCGTCTTG
+CAAACTCCTGATCCAGTTTAACTCACCAAATTATAGCCATACAGACCCAAATTTTAAATC
+ATATCACGCGACTAGCCTCTGCTTAATTTCTGTGCTCAAGGGTTTTGGTCCGCCCGAGCG
+GTGCAGCCGATTAGGACCATCTAATGCACTTGTTACAAGACTTCTTTTAAATACTTTCTT
+CCTGCCCAGTAGCGGATGATAATGGTTGTTGCCAGCCGGTGTGGAAGGTAACAGCACCGG
+TGCGAGCCTAATGTGCCGTCTCCACCAACACAAGGCTATCCGGTCGTATAATAGGATTCC
+GCAATGGGGTTAGCAAATGGCAGCCTAAACGATATCGGGGACTTGCGATGTACATGCTTT
+>chr2
+TCAACAATAAGCGCTTTTTGTAGGCAGGGGCACCCCCTATCAGTGGCTGCGCCAAAACAT
+CTTCGGATCCCCTTGTCCAATCAAATTGATCGAATTCTTTCATTTAAGACCCTAATATGA
+CATCATTAGTGATTAAATGCCACTCCCAAAATTCTGCCTAGAAATGTTTAAGTTCGCTCC
+ACTAAAGTTGTTTAAAACGACTACTAAATCCGCGTGATAGGGGATTTCATATTTAATCTT
+TTATCGTAAGGAACAGCCGATCTTAATGGATGGCCGCAGGTGGTATGGAAGCTATAAGCG
+CGGGTGAGAGGGTAATTAGGCGTGTTCACCTACACTACGCTAACGGGCGATTCTATAAGA
+TTGCACATTGCGTCTACTTATAAGATGTCTCAACGGCATGCGCAACTTGTGAAGTGCCTA
+CTATCCTTAAACGCATATCTCGCACAGTAACTCCCCAATATGTGAGCATCTGATGTTGCC