Mercurial > repos > iuc > rna_starsolo
diff rg_rnaStarSolo.xml @ 9:ec9cbd6b9a49 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/rgrnastar commit 00c545ddbf0f008903f4b4c11d476e6089c3f531"
| author | iuc |
|---|---|
| date | Fri, 15 Jan 2021 17:39:11 +0000 |
| parents | 00fbfac99d39 |
| children | a6fba3d92531 |
line wrap: on
line diff
--- a/rg_rnaStarSolo.xml Fri Dec 04 22:05:36 2020 +0000 +++ b/rg_rnaStarSolo.xml Fri Jan 15 17:39:11 2021 +0000 @@ -17,68 +17,89 @@ STAR @REFGENOMEHANDLING@ - --readFilesIn - ## Check that the input pairs are of the same type - ## otherwise STARsolo will run for a long time and then error out. - ## We consume either repeats of two inputs R1 + R2 - ## or a collection of paired reads. + ## Supports Drop-seq, 10X Chromium, inDrop and Smart-Seq + --soloType $sc.solo_type - #if str($input_types.use) == "repeat": - #set $reads1 = [] - #set $reads2 = [] - #for $r1, $r2 in zip($input_types.input1, $input_types.input2): - #assert $r1.datatype == $r2.datatype - #silent $reads1.append(str($r1)) - #silent $reads2.append(str($r2)) - #end for - #set $reads1 = ','.join($reads1) - #set $reads2 = ','.join($reads2) - #elif str($input_types.use) == "list_paired": - #set $r1 = $input_types.input_collection.forward - #set $r2 = $input_types.input_collection.reverse - #set $reads1 = $r1 - #set $reads2 = $r2 - #end if - - ## cDNA sequence(s) [R2] always go first, then barcode(s) [R1] - ## see: Section 3.1 of STAR manual for multiple inputs, and Section 13 for STARsolo inputs - $reads2 $reads1 - - #if $r1.is_of_type('fastq.gz', 'fastqsanger.gz'): - @FASTQ_GZ_OPTION@ - #end if - - ## Droplet is the only mode available for now - --soloType Droplet - + #if str($sc.solo_type) == "CB_UMI_Simple": + @READSHANDLING@ + --soloCBwhitelist '$sc.soloCBwhitelist' ## 1 - check length of barcode, 0 - do not check ## Good for checking custom chemistries - --soloCBwhitelist '$soloCBwhitelist' - --soloBarcodeReadLength $solo.soloBarcodeReadLength - - #if str($solo.params.chemistry) == "CR2": + --soloBarcodeReadLength $sc.soloBarcodeReadLength + #if str($sc.params.chemistry) == "CR2": --soloCBstart 1 --soloCBlen 16 --soloUMIstart 17 --soloUMIlen 10 - #else if str($solo.params.chemistry) == "CR3": + #else if str($sc.params.chemistry) == "CR3": --soloCBstart 1 --soloCBlen 16 --soloUMIstart 17 --soloUMIlen 12 - #else if str($solo.params.chemistry) == "custom": - --soloCBstart $solo.params.soloCBstart - --soloCBlen $solo.params.soloCBlen - --soloUMIstart $solo.params.soloUMIstart - --soloUMIlen $solo.params.soloUMIlen + #else if str($sc.params.chemistry) == "custom": + --soloCBstart $sc.params.soloCBstart + --soloCBlen $sc.params.soloCBlen + --soloUMIstart $sc.params.soloUMIstart + --soloUMIlen $sc.params.soloUMIlen #end if + #elif str($sc.solo_type) == "CB_UMI_Complex": + @READSHANDLING@ + ## inDrop supports multiple cell barcodes of varying length + #set $cb_whitelist = [] + #set $cb_pos = [] + #for $cb in $sc.cb_whitelists: + #silent $cb_whitelist.append(str($cb.whitelist_file)) + #silent $cb_pos.append('_'.join([str($cb.cb_start_anchor), str($cb.cb_start_anchor_pos),str($cb.cb_end_anchor), str($cb.cb_end_anchor_pos)])) + #end for + #set $cb_whitelist = ' '.join($cb_whitelist) + --soloCBwhitelist $cb_whitelist + #set $cb_pos = ' '.join($cb_pos) + --soloCBposition $cb_pos + #set $umi_pos = '_'.join([str($sc.umi_start_anchor), str($sc.umi_start_anchor_pos), str($sc.umi_end_anchor), str($sc.umi_end_anchor_pos)]) + --soloUMIposition $umi_pos + --soloAdapterSequence $sc.soloAdapterSequence + --soloAdapterMismatchesNmax $sc.soloAdapterMismatchesNmax + + #elif str($sc.solo_type) == "SmartSeq": + ## Create a manifest file with fastq files and their corresponding cell-ids + ## For Smart-Seq [R1] is followed by [R2] + --readFilesManifest '$manifest_file' + #set $read_files_command = "" + #if str($sc.input_types_smart_seq.use) == "list_single_end": + #if $sc.input_types_smart_seq.single_end_collection[0].is_of_type('fastq.gz', 'fastqsanger.gz'): + @FASTQ_GZ_OPTION@ + #end if + #elif str($sc.input_types_smart_seq.use) == "list_paired_end": + #if $sc.input_types_smart_seq.paired_end_collection[0].forward.is_of_type('fastq.gz', 'fastqsanger.gz'): + @FASTQ_GZ_OPTION@ + #end if + #end if + --soloCBwhitelist None + #end if + + --soloUMIfiltering $solo.soloUMIfiltering --soloStrand $solo.soloStrand --soloFeatures $solo.soloFeatures - --soloUMIdedup $solo.soloUMIdedup + --soloUMIdedup $sc.soloUMIdedup --quantMode TranscriptomeSAM --outSAMtype BAM Unsorted + #if str($solo.filter.filter_type) == "cellranger2": + --soloCellFilter CellRanger2.2 $solo.filter.n_expected $solo.filter.max_perc $solo.filter.max_min_ratio + #else if str($solo.filter.filter_type) == "topcells": + --soloCellFilter TopCells $solo.filter.n_cells + #else if str($solo.filter.filter_type) == "no_filter": + --soloCellFilter None + #end if + ## Splice junctions are always under "raw" directory + + --soloOutFormatFeaturesGeneField3 '${solo.soloOutFormatFeaturesGeneField3}' + ## Rename the the selected features directory + && mv Solo.out/${solo.soloFeatures} Solo.out/soloFeatures + ## put the barcodes and features stats into a single file + && cat <(echo "Barcodes:") Solo.out/Barcodes.stats <(echo "Genes:") Solo.out/soloFeatures/Features.stats > '${output_stats}' + ## BAM sorting (logic copied from samtools_sort wrapper) ## choosing BAM SortedByCoord appeared once to give fewer reads ## than BAM Unsorted followed by a samtools sort @@ -92,26 +113,30 @@ addmemory=\${GALAXY_MEMORY_MB_PER_SLOT:-768} && ((addmemory=addmemory*75/100)) && samtools sort -@ \$addthreads -m \$addmemory"M" -T "\${TMPDIR:-.}" -O bam -o '$output_BAM' Aligned.out.bam - ]]></command> + <configfiles> + <configfile name="manifest_file" > + #if str($sc.solo_type) == "SmartSeq": + #set $cellids_fh = open(str($sc.cell_ids), 'r') + #set $cellids = [str(x.strip()) for x in $cellids_fh.readlines()] + #silent $cellids_fh.close() + #set $samples = [] + #if str($sc.input_types_smart_seq.use) == "list_single_end": + #assert len($cellids) == len($sc.input_types_smart_seq.single_end_collection.keys()) + #for $i,$r1 in enumerate($sc.input_types_smart_seq.single_end_collection): + #silent $samples.append('\t'.join([str($r1), '-', 'ID:' + $cellids[$i]])) + #end for + #elif str($sc.input_types_smart_seq.use) == "list_paired_end": + #assert len($cellids) == len($sc.input_types_smart_seq.paired_end_collection.keys()) + #for $i,($r1,$r2) in enumerate($sc.input_types_smart_seq.paired_end_collection): + #silent $samples.append('\t'.join([str($r1), str($r2), 'ID:' + $cellids[$i]])) + #end for + #end if + #echo '\n'.join($samples) + #end if + </configfile> + </configfiles> <inputs> - <conditional name="input_types" > - <param name="use" type="select" label="Input Type" > - <option value="repeat" >Separate barcode and cDNA reads</option> - <option value="list_paired" >Paired collection of barcode and cDNA reads</option> - </param> - <when value="repeat"> - <param format="fastq,fasta,fastq.gz,fastqsanger.gz" name="input1" type="data" multiple="true" - label="RNA-Seq FASTQ/FASTA file, Barcode reads" /> - <param format="fastq,fasta,fastq.gz,fastqsanger.gz" name="input2" type="data" multiple="true" - label="RNA-Seq FASTQ/FASTA file, cDNA reads"/> - </when> - <when value="list_paired"> - <param name="input_collection" collection_type="paired" type="data_collection" format="fastq,fasta,fastq.gz,fastqsanger.gz" label="Collection of Pairs" /> - </when> - </conditional> - <param format="txt,tsv" argument="--soloCBwhitelist" type="data" label="RNA-Seq Cell Barcode Whitelist" /> - <!-- Genome source. --> <conditional name="refGenomeSource"> <param name="geneSource" type="select" label="Custom or built-in reference genome" help="Built-ins were indexed using default options"> @@ -140,23 +165,83 @@ <expand macro="@SJDBOPTIONS@" optional="false"/> </when> </conditional> - - <section name="solo" title="Advanced Settings" expanded="true"> - <conditional name="params"> - <param name="chemistry" type="select" label="Configure Chemistry Options"> - <option value="CR2" selected="true">Cell Ranger v2</option> - <option value="CR3">Cell Ranger v3</option> - <option value="custom">Custom</option> + <conditional name="sc" > + <param name="solo_type" type="select" label="Type of single-cell RNA-seq" > + <option value="CB_UMI_Simple">Drop-seq or 10X Chromium</option> + <option value="CB_UMI_Complex">inDrop</option> + <option value="SmartSeq">Smart-Seq</option> + </param> + <when value="CB_UMI_Simple"> + <expand macro="input_selection" /> + <param format="txt,tsv" argument="--soloCBwhitelist" type="data" label="RNA-Seq Cell Barcode Whitelist"/> + <conditional name="params" > + <param name="chemistry" type="select" label="Configure Chemistry Options"> + <option value="CR2" selected="true">Cell Ranger v2</option> + <option value="CR3">Cell Ranger v3</option> + <option value="custom">Custom</option> + </param> + <when value="CR2" /> + <when value="CR3" /> + <when value="custom" > + <param argument="--soloCBstart" type="integer" min="1" value="1" label="Cell Barcode Start Base" /> + <param argument="--soloCBlen" type="integer" min="1" value="16" label="Cell Barcode Length" /> + <param argument="--soloUMIstart" type="integer" min="1" value="17" label="UMI Start Base" /> + <param argument="--soloUMIlen" type="integer" min="1" value="10" label="UMI Length" /> + </when> + </conditional> + <param argument="--soloBarcodeReadLength" type="boolean" truevalue="1" falsevalue="0" checked="true" label="Barcode Size is same size of the Read" help="Disable this if your R1 barcodes contain poly-T bases after the barcode sequence." /> + <param argument="--soloUMIdedup" type="select" label="UMI deduplication (collapsing) algorithm" help="All has all UMIs with 1 mismatch distance to each other collapsed, Directional follows the 'directional' method given in UMI-tools, Exact collapses only exactly matching UMIs."> + <expand macro="umidedup_options" /> + <option value="Exact" >Exact</option> + </param> + <param argument="--soloCBmatchWLtype" type="select" label="Matching the Cell Barcodes to the WhiteList" help="Exact: only exact matches allowed; 1MM: only one match in whitelist with 1 mismatched base allowed. Allowed + CBs have to have at least one read with exact match; 1MM_multi: multiple matches in whitelist with 1 mismatched base allowed, posterior probability calculation is used choose one of the matches; 1MM_multi_pseudocounts: same as 1MM_Multi, but pseudocounts of 1 are added to all whitelist barcodes."> + <expand macro="cb_match_wl_common" /> + <expand macro="cb_match_wl_cellranger" /> </param> - <when value="CR2" /> - <when value="CR3" /> - <when value="custom" > - <param argument="--soloCBstart" type="integer" min="1" value="1" label="Cell Barcode Start Base" /> - <param argument="--soloCBlen" type="integer" min="1" value="16" label="Cell Barcode Length" /> - <param argument="--soloUMIstart" type="integer" min="1" value="17" label="UMI Start Base" /> - <param argument="--soloUMIlen" type="integer" min="1" value="10" label="UMI Length" /> - </when> - </conditional> + </when> + <when value="CB_UMI_Complex"> + <expand macro="input_selection" /> + <repeat name="cb_whitelists" title="Cell barcode whitelist information" max="2" > + <param name="whitelist_file" format="txt,tsv" type="data" label="RNA-Seq Cell Barcode Whitelist"/> + <param name="cb_start_anchor" type="select" label="Start anchor base for cell barcode"> + <expand macro="anchor_types" /> + </param> + <param name="cb_start_anchor_pos" type="integer" value="0" label="0-based position of the CB start with respect to the anchor base" /> + <param name="cb_end_anchor" type="select" label="End anchor base for cell barcode"> + <expand macro="anchor_types" /> + </param> + <param name="cb_end_anchor_pos" type="integer" value="0" label="0-based position of the CB end with respect to the anchor base" /> + </repeat> + <param name="umi_start_anchor" type="select" label="Start anchor base for UMI"> + <expand macro="anchor_types" /> + </param> + <param name="umi_start_anchor_pos" type="integer" value="0" label="0-based position of the UMI start with respect to the anchor base" /> + <param name="umi_end_anchor" type="select" label="End anchor base for UMI"> + <expand macro="anchor_types" /> + </param> + <param name="umi_end_anchor_pos" type="integer" value="0" label="0-based position of the UMI end with respect to the anchor base" /> + <param argument="--soloAdapterSequence" type="text" value="-" label="Adapter sequence to anchor barcodes." /> + <param argument="--soloAdapterMismatchesNmax" type="integer" min="1" value="1" label="Maximum number of mismatches allowed in adapter sequence" /> + <param argument="--soloUMIdedup" type="select" label="UMI deduplication (collapsing) algorithm" help="All has all UMIs with 1 mismatch distance to each other collapsed, Directional follows the 'directional' method given in UMI-tools, Exact collapses only exactly matching UMIs."> + <expand macro="umidedup_options" /> + <option value="Exact" >Exact</option> + </param> + <param argument="--soloCBmatchWLtype" type="select" label="Matching the Cell Barcodes to the WhiteList" help="Exact: only exact matches allowed; 1MM: only one match in whitelist with 1 mismatched base allowed. Allowed + CBs have to have at least one read with exact match; 1MM_multi: multiple matches in whitelist with 1 mismatched base allowed, posterior probability calculation is used choose one of the matches; 1MM_multi_pseudocounts: same as 1MM_Multi, but pseudocounts of 1 are added to all whitelist barcodes."> + <expand macro="cb_match_wl_common" /> + </param> + </when> + <when value="SmartSeq"> + <expand macro="input_selection_smart_seq" /> + <param name="cell_ids" type="data" label="File containing cell IDs of the samples. One ID per line in order of samples in the above collection."/> + <param argument="--soloUMIdedup" type="select" label="UMI deduplication (collapsing) algorithm" help="All has all UMIs with 1 mismatch distance to each other collapsed, Directional follows the 'directional' method given in UMI-tools, Exact collapses only exactly matching UMIs."> + <option value="Exact" >Exact</option> + <option value="NoDedup">Do not deduplicate UMIs</option> + </param> + </when> + </conditional> + <section name="solo" title="Advanced Settings" expanded="true"> <param argument="--soloStrand" type="select" label="Strandedness of Library" help="Unstranded has no strand information, Forward has the read strand the same as the original RNA molecule, Reverse has the read strand opposite to the original RNA molecule"> <option value="Unstranded" /> <option value="Forward" selected="true" /> @@ -167,42 +252,86 @@ <option value="SJ" >Splice Junctions: Count reads at exon-intron junctions</option> <option value="GeneFull" >Full: Count all reads overlapping genes' exons and introns</option> </param> - <param argument="--soloUMIdedup" type="select" label="UMI deduplication (collapsing) algorithm" help="All has all UMIs with 1 mismatch distance to each other collapsed, Directional follows the 'directional' method given in UMI-tools, None has UMIs with 1 mismatch distance to others not collapsed"> - <option value="1MM_All" selected="true">All</option> - <option value="1MM_Directional" >Directional</option> - <option value="1MM_NotCollapsed" >None</option> + <param argument="--soloUMIfiltering" type="select" label="Type of UMI filtering" > + <option value="-" selected="true">Remove UMIs with N and homopolymers (similar to CellRanger 2.2.0)</option> + <option value="MultiGeneUMI" >Remove lower-count UMIs that map to more than one gene ((introduced in CellRanger 3.x.x)</option> </param> - <param argument="--soloBarcodeReadLength" type="boolean" truevalue="1" falsevalue="0" checked="true" label="Barcode Size is same size of the Read" help="Disable this if your R1 barcodes contain poly-T bases after the barcode sequence." /> + <conditional name="filter" > + <param name="filter_type" type="select" label="Cell filtering type and parameters" > + <option value="cellranger2" selected="true" >Simple filtering of CellRanger v2</option> + <option value="topcells" >Filter top N cells</option> + <option value="no_filter" >Do not filter</option> + </param> + <when value="cellranger2" > + <param name="n_expected" type="integer" min="1" value="3000" label="Number of expected cells" /> + <param name="max_perc" type="float" min="0" max="1" value="0.99" label="Robust maximum percentile for UMI count" /> + <param name="max_min_ratio" type="float" min="1" value="10" label="Maximum to minimum ratio for UMI count" /> + </when> + <when value="topcells" > + <param name="n_cells" type="integer" min="1" value="3000" label="Number of top cells to report sorted by UMI count" /> + </when> + <when value="no_filter" /> + </conditional> + <param argument="--soloOutFormatFeaturesGeneField3" type="text" value="Gene Expression" label="Field 3 in the Genes output." help="Input '-' to remove the 3rd column from the output." /> </section> </inputs> <outputs> <data format="txt" name="output_log" label="${tool.name} on ${on_string}: log" from_work_dir="Log.final.out"> <expand macro="dbKeyActions" /> </data> - <data format="tsv" name="output_genes" label="${tool.name} on ${on_string}: Genes" - from_work_dir="Solo.out/Gene/filtered/features.tsv" /> - <data format="tsv" name="output_barcodes" label="${tool.name} on ${on_string}: Barcodes" - from_work_dir="Solo.out/Gene/filtered/barcodes.tsv" /> - <data format="mtx" name="output_matrix" label="${tool.name} on ${on_string}: Matrix Gene Counts" - from_work_dir="Solo.out/Gene/filtered/matrix.mtx" > - <filter>solo['soloFeatures'] == "Gene" </filter> +<!-- + <data format="tsv" name="output_genes" label="${tool.name} on ${on_string}: Genes" /> + <data format="tsv" name="output_barcodes" label="${tool.name} on ${on_string}: Barcodes" /> + <data format="mtx" name="output_matrix" label="${tool.name} on ${on_string}: Matrix Gene Counts" > + <expand macro="dbKeyActions" /> + </data> +--> + <!-- soloCellFilter set to None, if SJ is selected for soloFeatures --> + <data format="tsv" name="output_genes" label="${tool.name} on ${on_string}: Genes raw" + from_work_dir="Solo.out/soloFeatures/raw/features.tsv" > + <filter>solo['filter']['filter_type'] == "no_filter" or solo['soloFeatures'] == "SJ" </filter> + </data> + <data format="tsv" name="output_genes_filtered" label="${tool.name} on ${on_string}: Genes filtered" + from_work_dir="Solo.out/soloFeatures/filtered/features.tsv" > + <filter>solo['filter']['filter_type'] != "no_filter" and solo['soloFeatures'] != "SJ" </filter> + </data> + <data format="tsv" name="output_barcodes" label="${tool.name} on ${on_string}: Barcodes raw" + from_work_dir="Solo.out/soloFeatures/raw/barcodes.tsv" > + <filter>solo['filter']['filter_type'] == "no_filter" or solo['soloFeatures'] == "SJ" </filter> + </data> + <data format="tsv" name="output_barcodes_filtered" label="${tool.name} on ${on_string}: Barcodes filtered" + from_work_dir="Solo.out/soloFeatures/filtered/barcodes.tsv" > + <filter>solo['filter']['filter_type'] != "no_filter" and solo['soloFeatures'] != "SJ" </filter> + </data> + <data format="mtx" name="output_matrix" label="${tool.name} on ${on_string}: Matrix Gene Counts raw" + from_work_dir="Solo.out/soloFeatures/raw/matrix.mtx" > + <filter>solo['soloFeatures'] == "Gene" and solo['filter']['filter_type'] == "no_filter" </filter> + <expand macro="dbKeyActions" /> + </data> + <data format="mtx" name="output_matrix_filtered" label="${tool.name} on ${on_string}: Matrix Gene Counts filtered" + from_work_dir="Solo.out/soloFeatures/filtered/matrix.mtx" > + <filter>solo['soloFeatures'] == "Gene" and solo['filter']['filter_type'] != "no_filter" </filter> <expand macro="dbKeyActions" /> </data> <data format="mtx" name="output_matrixSJ" label="${tool.name} on ${on_string}: Matrix Splice Junction Counts" - from_work_dir="Solo.out/Gene/filtered/matrixSJ.mtx" > + from_work_dir="Solo.out/soloFeatures/raw/matrix.mtx" > <filter>solo['soloFeatures'] == "SJ" </filter> <expand macro="dbKeyActions" /> </data> - <data format="mtx" name="output_matrixGeneFull" label="${tool.name} on ${on_string}: Matrix Full Gene Counts" - from_work_dir="Solo.out/Gene/filtered/matrixGeneFull.mtx" > - <filter>solo['soloFeatures'] == "GeneFull" </filter> + <data format="mtx" name="output_matrixGeneFull" label="${tool.name} on ${on_string}: Matrix Full Gene Counts raw" + from_work_dir="Solo.out/soloFeatures/raw/matrix.mtx" > + <filter>solo['soloFeatures'] == "GeneFull" and solo['filter']['filter_type'] == "no_filter" </filter> + <expand macro="dbKeyActions" /> + </data> + <data format="mtx" name="output_matrixGeneFull_filtered" label="${tool.name} on ${on_string}: Matrix Full Gene Counts filtered" + from_work_dir="Solo.out/soloFeatures/filtered/matrix.mtx" > + <filter>solo['soloFeatures'] == "GeneFull" and solo['filter']['filter_type'] != "no_filter" </filter> <expand macro="dbKeyActions" /> </data> <data format="bam" name="output_BAM" label="${tool.name} on ${on_string}: Alignments" > <expand macro="dbKeyActions" /> </data> - <data format="txt" name="output_stats" label="${tool.name} on ${on_string}: Feature Statistic Summaries" - from_work_dir="Solo.out/Gene/Features.stats" /> + <data format="txt" name="output_stats" label="${tool.name} on ${on_string}: Barcode/Feature Statistic Summaries"/> </outputs> <!-- Generating test data that is big enough for STARsolo to detect and small enough for Galaxy to test requires careful modification of input FASTA and GTF data, @@ -214,12 +343,6 @@ --> <tests> <test expect_num_outputs="6"> - <conditional name="input_types"> - <param name="use" value="repeat" /> - <param name="input1" value="pbmc_1k_v2_L001.R1.10k.fastq.gz" ftype="fastqsanger.gz" /> - <param name="input2" value="pbmc_1k_v2_L001.R2.10k.fastq.gz" ftype="fastqsanger.gz" /> - </conditional> - <param name="soloCBwhitelist" value="filtered.barcodes.txt" /> <conditional name="refGenomeSource"> <param name="geneSource" value="history" /> <param name="genomeFastaFiles" value="filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz" /> @@ -227,19 +350,31 @@ <param name="sjdbOverhang" value="100" /> <param name="sjdbGTFfile" value="filtered3.Homo_sapiens.GRCh38.100.chr21.gtf" ftype="gtf"/> </conditional> - <section name="solo" > + <conditional name="sc" > + <param name="solo_type" value="CB_UMI_Simple" /> + <conditional name="input_types"> + <param name="use" value="repeat" /> + <param name="input1" value="pbmc_1k_v2_L001.R1.10k.fastq.gz" ftype="fastqsanger.gz" /> + <param name="input2" value="pbmc_1k_v2_L001.R2.10k.fastq.gz" ftype="fastqsanger.gz" /> + </conditional> + <param name="soloCBwhitelist" value="filtered.barcodes.txt" /> <conditional name="params"> <param name="chemistry" value="CR3" /> </conditional> + <param name="soloUMIdedup" value="1MM_All" /> + </conditional> + <section name="solo" > + <conditional name="filter"> + <param name="filter_type" value="no_filter" /> + </conditional> <param name="soloStrand" value="Forward" /> <param name="soloFeatures" value="Gene" /> - <param name="soloUMIdedup" value="1MM_All" /> </section> <output name="output_barcodes" > <assert_contents> <!-- first and last line --> - <has_line line="ACACCGGTCTAACGGT" /> - <has_line line="TTCTCAATCCACGTTC" /> + <has_line line="AAACCTGAGCGCTCCA" /> + <has_line line="TTTGGTTAGTGGGCTA" /> </assert_contents> </output> <output name="output_genes"> @@ -250,8 +385,8 @@ </output> <output name="output_matrix" > <assert_contents> - <has_line_matching expression="14\s+7\s+7" /> - <has_line_matching expression="4\s+7\s+1" /> + <has_line_matching expression="14\s+394\s+7" /> + <has_line_matching expression="4\s+381\s+1" /> </assert_contents> </output> <output name="output_stats" > @@ -263,12 +398,6 @@ <output name="output_BAM" value="filtered3.bam" compare="sim_size" delta="600" /> </test> <test expect_num_outputs="6"><!-- same as above, but using custom --> - <conditional name="input_types"> - <param name="use" value="repeat" /> - <param name="input1" value="pbmc_1k_v2_L001.R1.10k.fastq.gz" ftype="fastqsanger.gz" /> - <param name="input2" value="pbmc_1k_v2_L001.R2.10k.fastq.gz" ftype="fastqsanger.gz" /> - </conditional> - <param name="soloCBwhitelist" value="filtered.barcodes.txt" /> <conditional name="refGenomeSource"> <param name="geneSource" value="history" /> <param name="genomeFastaFiles" value="filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz" /> @@ -276,7 +405,14 @@ <param name="sjdbOverhang" value="100" /> <param name="sjdbGTFfile" value="filtered3.Homo_sapiens.GRCh38.100.chr21.gtf" ftype="gtf"/> </conditional> - <section name="solo" > + <conditional name="sc" > + <param name="solo_type" value="CB_UMI_Simple" /> + <conditional name="input_types"> + <param name="use" value="repeat" /> + <param name="input1" value="pbmc_1k_v2_L001.R1.10k.fastq.gz" ftype="fastqsanger.gz" /> + <param name="input2" value="pbmc_1k_v2_L001.R2.10k.fastq.gz" ftype="fastqsanger.gz" /> + </conditional> + <param name="soloCBwhitelist" value="filtered.barcodes.txt" /> <conditional name="params"> <param name="chemistry" value="custom" /> <param name="soloCBstart" value="1" /> @@ -284,23 +420,25 @@ <param name="soloUMIstart" value="17" /> <param name="soloUMIlen" value="12" /> </conditional> + <param name="soloUMIdedup" value="1MM_All" /> + </conditional> + <section name="solo" > <param name="soloStrand" value="Forward" /> <param name="soloFeatures" value="Gene" /> - <param name="soloUMIdedup" value="1MM_All" /> </section> - <output name="output_barcodes" > + <output name="output_barcodes_filtered" > <assert_contents> <has_line line="ACACCGGTCTAACGGT" /> <has_line line="TTCTCAATCCACGTTC" /> </assert_contents> </output> - <output name="output_genes"> + <output name="output_genes_filtered"> <assert_contents> <has_line_matching expression="ENSG00000279493\s+FP565260\.4\s+Gene\s+Expression" /> <has_line_matching expression="ENSG00000279064\s+FP236315\.1\s+Gene\s+Expression" /> </assert_contents> </output> - <output name="output_matrix" > + <output name="output_matrix_filtered" > <assert_contents> <has_line_matching expression="14\s+7\s+7" /> <has_line_matching expression="4\s+7\s+1" /> @@ -315,12 +453,6 @@ <output name="output_BAM" value="filtered3.bam" compare="sim_size" delta="600" /> </test> <test expect_num_outputs="6"><!-- Multiple repeats test --> - <conditional name="input_types"> - <param name="use" value="repeat" /> - <param name="input1" value="pbmc_1k_v2_L001.R1.10k.fastq.gz,pbmc_1k_v2_L001.R1.10k.fastq.gz,pbmc_1k_v2_L001.R1.10k.fastq.gz" ftype="fastqsanger.gz" /> - <param name="input2" value="pbmc_1k_v2_L001.R2.10k.fastq.gz,pbmc_1k_v2_L001.R2.10k.fastq.gz,pbmc_1k_v2_L001.R2.10k.fastq.gz" ftype="fastqsanger.gz" /> - </conditional> - <param name="soloCBwhitelist" value="filtered.barcodes.txt" /> <conditional name="refGenomeSource"> <param name="geneSource" value="history" /> <param name="genomeFastaFiles" value="filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz" /> @@ -328,15 +460,24 @@ <param name="sjdbOverhang" value="100" /> <param name="sjdbGTFfile" value="filtered3.Homo_sapiens.GRCh38.100.chr21.gtf" ftype="gtf"/> </conditional> - <section name="solo" > + <conditional name="sc" > + <param name="solo_type" value="CB_UMI_Simple" /> + <conditional name="input_types"> + <param name="use" value="repeat" /> + <param name="input1" value="pbmc_1k_v2_L001.R1.10k.fastq.gz,pbmc_1k_v2_L001.R1.10k.fastq.gz,pbmc_1k_v2_L001.R1.10k.fastq.gz" ftype="fastqsanger.gz" /> + <param name="input2" value="pbmc_1k_v2_L001.R2.10k.fastq.gz,pbmc_1k_v2_L001.R2.10k.fastq.gz,pbmc_1k_v2_L001.R2.10k.fastq.gz" ftype="fastqsanger.gz" /> + </conditional> + <param name="soloCBwhitelist" value="filtered.barcodes.txt" /> <conditional name="params"> <param name="chemistry" value="CR3" /> </conditional> + <param name="soloUMIdedup" value="1MM_All" /> + </conditional> + <section name="solo" > <param name="soloStrand" value="Forward" /> <param name="soloFeatures" value="Gene" /> - <param name="soloUMIdedup" value="1MM_All" /> </section> - <output name="output_barcodes" > + <output name="output_barcodes_filtered" > <assert_contents> <has_line line="ACACCGGTCTAACGGT" /> <has_line line="TTCTCAATCCACGTTC" /> @@ -346,16 +487,97 @@ </test> <test expect_num_outputs="6"> <!-- Test with paired collection --> - <conditional name="input_types"> - <param name="use" value="list_paired" /> - <param name="input_collection" > - <collection type="paired"> - <element name="forward" value="pbmc_1k_v2_L001.R1.10k.fastq.gz" ftype="fastqsanger.gz" /> - <element name="reverse" value="pbmc_1k_v2_L001.R2.10k.fastq.gz" ftype="fastqsanger.gz" /> - </collection> - </param> + <conditional name="refGenomeSource"> + <param name="geneSource" value="history" /> + <param name="genomeFastaFiles" value="filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz" /> + <param name="genomeSAindexNbases" value="4" /> + <param name="sjdbOverhang" value="100" /> + <param name="sjdbGTFfile" value="filtered3.Homo_sapiens.GRCh38.100.chr21.gtf" ftype="gtf"/> + </conditional> + <conditional name="sc" > + <param name="solo_type" value="CB_UMI_Simple" /> + <conditional name="input_types"> + <param name="use" value="list_paired" /> + <param name="input_collection" > + <collection type="paired"> + <element name="forward" value="pbmc_1k_v2_L001.R1.10k.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="pbmc_1k_v2_L001.R2.10k.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </param> + </conditional> + <param name="soloCBwhitelist" value="filtered.barcodes.txt" /> + <conditional name="params"> + <param name="chemistry" value="CR3" /> + </conditional> + <param name="soloUMIdedup" value="1MM_All" /> + </conditional> + <section name="solo" > + <param name="soloStrand" value="Forward" /> + <param name="soloFeatures" value="Gene" /> + </section> + <output name="output_barcodes_filtered" > + <assert_contents> + <has_line line="ACACCGGTCTAACGGT" /> + <has_line line="TTCTCAATCCACGTTC" /> + </assert_contents> + </output> + <output name="output_BAM" value="filtered3.bam" compare="sim_size" delta="600" /> + </test> + <test expect_num_outputs="6"> + <!-- Test soloFeatures, soloCBmatchWLtype, soloCellFilter, soloOutFormatFeaturesGeneField3, soloUMIfiltering --> + <conditional name="refGenomeSource"> + <param name="geneSource" value="history" /> + <param name="genomeFastaFiles" value="filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz" /> + <param name="genomeSAindexNbases" value="4" /> + <param name="sjdbOverhang" value="100" /> + <param name="sjdbGTFfile" value="filtered3.Homo_sapiens.GRCh38.100.chr21.gtf" ftype="gtf"/> </conditional> - <param name="soloCBwhitelist" value="filtered.barcodes.txt" /> + <conditional name="sc" > + <param name="solo_type" value="CB_UMI_Simple" /> + <conditional name="input_types"> + <param name="use" value="repeat" /> + <param name="input1" value="pbmc_1k_v2_L001.R1.10k.fastq.gz" ftype="fastqsanger.gz" /> + <param name="input2" value="pbmc_1k_v2_L001.R2.10k.fastq.gz" ftype="fastqsanger.gz" /> + </conditional> + <param name="soloCBwhitelist" value="filtered.barcodes.txt" /> + <param name="soloCBmatchWLtype" value="1MM_multi_pseudocounts" /> + <conditional name="params"> + <param name="chemistry" value="CR3" /> + </conditional> + <param name="soloUMIdedup" value="1MM_All" /> + </conditional> + <section name="solo" > + <param name="soloUMIfiltering" value="MultiGeneUMI" /> + <param name="soloStrand" value="Forward" /> + <param name="soloFeatures" value="GeneFull" /> + <conditional name="filter"> + <param name="filter_type" value="topcells" /> + <param name="n_cells" value="5" /> + </conditional> + <param name="soloOutFormatFeaturesGeneField3" value="Dummy Text" /> + </section> + <output name="output_barcodes_filtered" > + <assert_contents> + <!-- first and last line --> + <has_line line="AGACGTTCAAGGCTCC" /> + <has_line line="TCAACGAAGCTAGTGG" /> + </assert_contents> + </output> + <output name="output_genes_filtered" > + <assert_contents> + <has_line_matching expression="ENSG00000279493\s+FP565260\.4\s+Dummy\s+Text" /> + <has_line_matching expression="ENSG00000279064\s+FP236315\.1\s+Dummy\s+Text" /> + </assert_contents> + </output> + <output name="output_matrixGeneFull_filtered" > + <assert_contents> + <has_line_matching expression="14\s+6\s+14" /> + <has_line_matching expression="10\s+6\s+1" /> + </assert_contents> + </output> + </test> + <test expect_num_outputs="6"> + <!-- Test soloType CB_UMI_Complex --> <conditional name="refGenomeSource"> <param name="geneSource" value="history" /> <param name="genomeFastaFiles" value="filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz" /> @@ -363,21 +585,168 @@ <param name="sjdbOverhang" value="100" /> <param name="sjdbGTFfile" value="filtered3.Homo_sapiens.GRCh38.100.chr21.gtf" ftype="gtf"/> </conditional> - <section name="solo" > - <conditional name="params"> - <param name="chemistry" value="CR3" /> + <conditional name="sc" > + <param name="solo_type" value="CB_UMI_Complex" /> + <conditional name="input_types"> + <param name="use" value="repeat" /> + <param name="input1" value="indrop.R1.fastq.gz" ftype="fastqsanger.gz" /> + <param name="input2" value="indrop.R2.fastq.gz" ftype="fastqsanger.gz" /> </conditional> - <param name="soloStrand" value="Forward" /> - <param name="soloFeatures" value="Gene" /> + <repeat name="cb_whitelists" > + <param name="whitelist_file" value="indrop.barcodes1.txt"/> + <param name="cb_start_anchor" value="0" /> + <param name="cb_start_anchor_pos" value="0" /> + <param name="cb_end_anchor" value="2" /> + <param name="cb_end_anchor_pos" value="-1" /> + </repeat> + <repeat name="cb_whitelists" > + <param name="whitelist_file" value="indrop.barcodes2.txt"/> + <param name="cb_start_anchor" value="3" /> + <param name="cb_start_anchor_pos" value="1" /> + <param name="cb_end_anchor" value="3" /> + <param name="cb_end_anchor_pos" value="8" /> + </repeat> + <param name="umi_start_anchor" value="3" /> + <param name="umi_start_anchor_pos" value="9" /> + <param name="umi_end_anchor" value="3" /> + <param name="umi_end_anchor_pos" value="14" /> + <param name="soloAdapterSequence" value="GAGTGATTGCTTGTGACGCCTT" /> + <param name="soloAdapterMismatchesNmax" value="1" /> <param name="soloUMIdedup" value="1MM_All" /> - </section> - <output name="output_barcodes" > + <param name="soloCBmatchWLtype" value="1MM" /> + </conditional> + <output name="output_barcodes_filtered" > + <assert_contents> + <!-- first and last line --> + <has_line line="ACAACGTGG_AAACCTCC" /> + <has_line line="ATTCCAGAC_TTCGCTGG" /> + </assert_contents> + </output> + <output name="output_genes_filtered"> <assert_contents> - <has_line line="ACACCGGTCTAACGGT" /> - <has_line line="TTCTCAATCCACGTTC" /> + <has_line_matching expression="ENSG00000279493\s+FP565260\.4\s+Gene\s+Expression" /> + <has_line_matching expression="ENSG00000279064\s+FP236315\.1\s+Gene\s+Expression" /> + </assert_contents> + </output> + <output name="output_matrix_filtered" > + <assert_contents> + <has_line_matching expression="14\s+33\s+36" /> + <has_line_matching expression="2\s+33\s+1" /> + </assert_contents> + </output> + <output name="output_stats" > + <assert_contents> + <has_line_matching expression="\s+nExactMatch\s+791" /> + <has_line_matching expression="\s+nUMIs\s+36" /> </assert_contents> </output> - <output name="output_BAM" value="filtered3.bam" compare="sim_size" delta="600" /> + </test> + <test expect_num_outputs="6"> + <!-- Test soloType SmartSeq --> + <conditional name="refGenomeSource"> + <param name="geneSource" value="history" /> + <param name="genomeFastaFiles" value="filtered3.Homo_sapiens.GRCh38.dna.chromosome.21.fa.gz" /> + <param name="genomeSAindexNbases" value="4" /> + <param name="sjdbOverhang" value="100" /> + <param name="sjdbGTFfile" value="filtered3.Homo_sapiens.GRCh38.100.chr21.gtf" ftype="gtf"/> + </conditional> + <conditional name="sc" > + <param name="solo_type" value="SmartSeq" /> + <conditional name="input_types_smart_seq"> + <param name="use" value="list_paired_end" /> + <param name="paired_end_collection" > + <collection type="list:paired"> + <element name="pair1"> + <collection type="paired"> + <element name="forward" value="smartseq1.R1.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="smartseq1.R2.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </element> + <element name="pair2"> + <collection type="paired"> + <element name="forward" value="smartseq2.R1.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="smartseq2.R2.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </element> + <element name="pair3"> + <collection type="paired"> + <element name="forward" value="smartseq3.R1.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="smartseq3.R2.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </element> + <element name="pair4"> + <collection type="paired"> + <element name="forward" value="smartseq4.R1.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="smartseq4.R2.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </element> + <element name="pair5"> + <collection type="paired"> + <element name="forward" value="smartseq5.R1.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="smartseq5.R2.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </element> + <element name="pair6"> + <collection type="paired"> + <element name="forward" value="smartseq6.R1.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="smartseq6.R2.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </element> + <element name="pair7"> + <collection type="paired"> + <element name="forward" value="smartseq7.R1.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="smartseq7.R2.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </element> + <element name="pair8"> + <collection type="paired"> + <element name="forward" value="smartseq8.R1.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="smartseq8.R2.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </element> + <element name="pair9"> + <collection type="paired"> + <element name="forward" value="smartseq9.R1.fastq.gz" ftype="fastqsanger.gz" /> + <element name="reverse" value="smartseq9.R2.fastq.gz" ftype="fastqsanger.gz" /> + </collection> + </element> + </collection> + </param> + </conditional> + <param name="cell_ids" value="smartseq.cellids.txt" /> + <param name="soloUMIdedup" value="Exact" /> + </conditional> + <section name="solo" > + <param name="soloStrand" value="Unstranded" /> + <conditional name="filter"> + <param name="filter_type" value="topcells" /> + <param name="n_cells" value="2" /> + </conditional> + </section> + <output name="output_barcodes_filtered" > + <assert_contents> + <has_line line="CSC6_D02" /> + <not_has_text text="MGH26_A02" /> + </assert_contents> + </output> + <output name="output_genes_filtered"> + <assert_contents> + <has_line_matching expression="ENSG00000279493\s+FP565260\.4\s+Gene\s+Expression" /> + <has_line_matching expression="ENSG00000279064\s+FP236315\.1\s+Gene\s+Expression" /> + </assert_contents> + </output> + <output name="output_matrix_filtered" > + <assert_contents> + <has_line_matching expression="14\s+3\s+10" /> + <has_line_matching expression="12\s+3\s+1" /> + </assert_contents> + </output> + <output name="output_stats" > + <assert_contents> + <has_line_matching expression="\s+nExactMatch\s+9000" /> + <has_line_matching expression="\s+nUMIs\s+32" /> + </assert_contents> + </output> </test> </tests> <help><![CDATA[