# HG changeset patch
# User iuc
# Date 1539539089 14400
# Node ID 740ce0a18f0d3ed40299939055f946fe3bb34e35

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools/samtools_merge commit b3426aed6615742d96dfb8f7346a9e0d4e391a99

diff -r 000000000000 -r 740ce0a18f0d macros.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Sun Oct 14 13:44:49 2018 -0400
@@ -0,0 +1,172 @@
+<macros>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@TOOL_VERSION@">samtools</requirement>
+            <yield/>
+        </requirements>
+    </xml>
+    <token name="@TOOL_VERSION@">1.9</token>
+    <token name="@FLAGS@">#set $flags = sum(map(int, str($filter).split(',')))</token>
+    <token name="@PREPARE_IDX@"><![CDATA[
+        ##prepare input and indices 
+        ln -s '$input' infile &&
+        #if $input.is_of_type('bam'):
+            #if str( $input.metadata.bam_index ) != "None":
+                ln -s '${input.metadata.bam_index}' infile.bai &&
+            #else:
+                samtools index infile infile.bai &&
+            #end if
+        #elif $input.is_of_type('cram'):
+            #if str( $input.metadata.cram_index ) != "None":
+                ln -s '${input.metadata.cram_index}' infile.crai &&
+            #else:
+                samtools index infile infile.crai &&
+            #end if
+        #end if
+    ]]></token>
+    <token name="@PREPARE_IDX_MULTIPLE@"><![CDATA[
+        ##prepare input and indices 
+        #for $i, $bam in enumerate( $input_bams ):
+            ln -s '$bam' '${i}' &&
+            #if $bam.is_of_type('bam'):
+                #if str( $bam.metadata.bam_index ) != "None":
+                    ln -s '${bam.metadata.bam_index}' '${i}.bai' &&
+                #else:
+                    samtools index '${i}' '${i}.bai' &&
+                #end if
+            #elif $bam.is_of_type('cram'):
+                #if str( $bam.metadata.cram_index ) != "None":
+                    ln -s '${bam.metadata.cram_index}' '${i}.crai' &&
+                #else:
+                    samtools index '${i}' '${i}.crai' &&
+                #end if
+            #end if
+        #end for
+    ]]></token>
+    <token name="@PREPARE_FASTA_IDX@"><![CDATA[
+        ##checks for reference data ($addref_cond.addref_select=="history" or =="cached")
+        ##and sets the -t/-T parameters accordingly:
+        ##- in case of history a symbolic link is used because samtools (view) will generate
+        ##  the index which might not be possible in the directory containing the fasta file
+        ##- in case of cached the absolute path is used which allows to read the cram file
+        ##  without specifying the reference
+        #if $addref_cond.addref_select == "history":
+            ln -s '${addref_cond.ref}' reference.fa &&
+            samtools faidx reference.fa &&
+            #set reffa="reference.fa"
+            #set reffai="reference.fa.fai"
+        #elif $addref_cond.addref_select == "cached":
+            #set reffa=str($addref_cond.ref.fields.path)
+            #set reffai=str($addref_cond.ref.fields.path)+".fai"
+        #else
+            #set reffa=None
+            #set reffai=None
+        #end if
+    ]]></token>
+    <token name="@ADDTHREADS@"><![CDATA[
+        ##compute the number of ADDITIONAL threads to be used by samtools (-@)
+        addthreads=\${GALAXY_SLOTS:-1} && (( addthreads-- )) &&
+    ]]></token>
+    <token name="@ADDMEMORY@"><![CDATA[
+        ##compute the number of memory available to samtools sort (-m)
+        ##use only 75% of available: https://github.com/samtools/samtools/issues/831
+        addmemory=\${GALAXY_MEMORY_MB_PER_SLOT:-768} && 
+        ((addmemory=addmemory*75/100)) &&
+    ]]></token>
+    <xml name="seed_input">
+       <param name="seed" type="integer" optional="True" label="Seed for random number generator" help="If empty a random seed is used." /> 
+    </xml>
+    <xml name="flag_options">
+        <option value="1">read is paired</option>
+        <option value="2">read is mapped in a proper pair</option>
+        <option value="4">read is unmapped</option>
+        <option value="8">mate is unmapped</option>
+        <option value="16">read reverse strand</option>
+        <option value="32">mate reverse strand</option>
+        <option value="64">read is the first in a pair</option>
+        <option value="128">read is the second in a pair</option>
+        <option value="256">alignment or read is not primary</option>
+        <option value="512">read fails platform/vendor quality checks</option>
+        <option value="1024">read is a PCR or optical duplicate</option>
+        <option value="2048">supplementary alignment</option>
+    </xml>
+
+    <!-- region specification macros and tokens for tools that allow the specification 
+         of region by bed file / space separated list of regions -->
+    <token name="@REGIONS_FILE@"><![CDATA[
+        #if $cond_region.select_region == 'tab':
+            -t '$cond_region.targetregions'
+        #end if
+    ]]></token>
+    <token name="@REGIONS_MANUAL@"><![CDATA[
+        #if $cond_region.select_region == 'text':
+            #for $i, $x in enumerate($cond_region.regions_repeat):
+               '${x.region}'
+            #end for
+        #end if
+    ]]></token>
+    <xml name="regions_macro">
+        <conditional name="cond_region">
+            <param name="select_region" type="select" label="Filter by regions" help="restricts output to only those alignments which overlap the specified region(s)">
+                <option value="no" selected="True">No</option>
+                <option value="text">Manualy specify regions</option>
+                <option value="tab">Regions from tabular file</option>
+            </param>
+            <when value="no"/>
+            <when value="text">
+                <repeat name="regions_repeat" min="1" default="1" title="Regions">
+                    <param name="region" type="text" label="region" help="format chr:from-to">
+                        <validator type="regex" message="Required format: CHR[:FROM[-TO]]; where CHR: string containing any character except quotes, whitespace and colon; FROM and TO: any integer">^[^\s'\":]+(:\d+(-\d+){0,1}){0,1}$</validator>
+                    </param>
+                </repeat>
+            </when>
+            <when value="tab">
+                <param name="targetregions" argument="-t/--target-regions" type="data" format="tabular" label="Target regions file" help="Do stats in these regions only. Tab-delimited file chr,from,to (1-based, inclusive)" />
+            </when>
+        </conditional>
+    </xml>
+
+    <xml name="citations">
+        <citations>
+            <citation type="bibtex">
+                @misc{SAM_def,
+                title={Definition of SAM/BAM format},
+                url = {https://samtools.github.io/hts-specs/},}
+            </citation>
+            <citation type="doi">10.1093/bioinformatics/btp352</citation>
+            <citation type="doi">10.1093/bioinformatics/btr076</citation>
+            <citation type="doi">10.1093/bioinformatics/btr509</citation>
+            <citation type="bibtex">
+                @misc{Danecek_et_al,
+                Author={Danecek, P., Schiffels, S., Durbin, R.},
+                title={Multiallelic calling model in bcftools (-m)},
+                url = {http://samtools.github.io/bcftools/call-m.pdf},}
+            </citation>
+            <citation type="bibtex">
+                @misc{Durbin_VCQC,
+                Author={Durbin, R.},
+                title={Segregation based metric for variant call QC},
+                url = {http://samtools.github.io/bcftools/rd-SegBias.pdf},}
+            </citation>
+            <citation type="bibtex">
+                @misc{Li_SamMath,
+                Author={Li, H.},
+                title={Mathematical Notes on SAMtools Algorithms},
+                url = {http://www.broadinstitute.org/gatk/media/docs/Samtools.pdf},}
+            </citation>
+            <citation type="bibtex">
+                @misc{SamTools_github,
+                title={SAMTools GitHub page},
+                url = {https://github.com/samtools/samtools},}
+            </citation>
+        </citations>
+    </xml>
+    <xml name="version_command">
+        <version_command><![CDATA[samtools 2>&1 | grep Version]]></version_command>
+    </xml>
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" level="fatal" description="Error" />
+        </stdio>
+    </xml>
+</macros>
diff -r 000000000000 -r 740ce0a18f0d samtools_merge.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/samtools_merge.xml	Sun Oct 14 13:44:49 2018 -0400
@@ -0,0 +1,129 @@
+<tool id="samtools_merge" name="Samtools merge" version="@TOOL_VERSION@">
+    <description>merge multiple sorted alignment files</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="stdio"/>
+    <expand macro="version_command"/>
+    <command><![CDATA[
+@ADDTHREADS@
+
+## prepare input (sort sam, link other), determine input ordering 
+## and check for consistent input ordering
+#set sortby=''
+#for $i, $bam in enumerate( $bamfiles ):
+    #if $bam.is_of_type('sam', 'cram', ):
+        samtools sort
+        -@ \$addthreads -m \${GALAXY_MEMORY_MB:-768}M -T sorttemp
+        -O sam
+        -o ${i}.sam
+        '$bam' &&
+    #else:
+        ln -s '$bam' ${i}.sam &&
+    #end if
+
+    #if ($sortby=='coord' or $sortby=='') and $bam.is_of_type('sam','bam','cram'):
+        #set sortby='coord'
+    #else if ($sortby=='name' or $sortby=='') and $bam.is_of_type('qname_sorted.bam', 'qname_input_sorted.bam'):
+        #set $sortby='name'
+    #else:
+        >&2 echo "inconsistently sorted input" && 
+        exit 1 &&
+    #end if
+#end for
+
+samtools merge
+-@ \$addthreads
+-s $seed
+## TODO force overwrite seems necessay (but I do not understand why ...)
+-f 
+## Galaxy provides only default compression
+## #if $compression == 'levelone'
+##     -1
+## #else if $compression == 'uncompressed'
+##     -u
+## #end if
+#if str($headerbam) != 'None'
+    -h '$headerbam'
+#end if
+#if $sortby=='name'
+    -n
+#end if
+## TODO since galaxy can't represent this as data type at the moment this option is unsupported
+## -t TAG    The input alignments have been sorted by the value of TAG, then by either position or name (if -n is given). 
+#if str($region) != ''
+    -R '$region'
+#end if
+## Attach an RG tag to each alignment. The tag value is inferred from file names.
+## -r
+## TODO -r makes no sense with the link names, is there some data set metadata (tags,...) that could be used?
+$idrg
+$idpg
+$output
+#for $i, $bam in enumerate( $bamfiles ):
+    ${i}.sam
+#end for
+    ]]></command>
+    <inputs>
+        <param name="bamfiles" type="data" format="sam,bam,cram" multiple="true" optional="false" label="Alignments in BAM format" help="Sets of aligned reads." />
+        <param name="region" type="text" optional="true" argument="-n" label="Merge files in a region" help="Merge files in the specified region indicated by a string" />
+        <param name="headerbam" type="data" format="sam,bam" argument="-h" multiple="false" optional="true" label="File to take @headers from" help="Use the lines of FILE as `@' headers to be copied to out.bam, replacing any header lines that would otherwise be copied from in1.bam. (FILE is actually in SAM format, though any alignment records it may contain are ignored.)" />
+        <param name="idrg" type="boolean" argument="-c" truevalue="-c" falsevalue="" checked="false" label="Make @RG headers unique" help="When several input files contain @RG headers with the same ID, emit only one of them (namely, the header line from the first file we find that ID in) to the merged output file. Combining these similar headers is usually the right thing to do when the files being merged originated from the same file. Without -c, all @RG headers appear in the output file, with random suffices added to their IDs where necessary to differentiate them." />
+        <param name="idpg" type="boolean" argument="-p" truevalue="-p" falsevalue="" checked="false" label="Make @PG headers unique" help="Similarly, for each @PG ID in the set of files to merge, use the @PG line of the first file we find that ID in rather than adding a suffix to differentiate similar IDs." />
+        <param name="seed" type="integer" argument="-s" value="1" label="random seed" />
+        <!-- compression options are not accessible in galaxy
+        <param name="compression" type="select" label="Advanced compression options" help="Select advanced compression options">
+            <option value="default" selected="true">default</option>
+            <option value="levelone">Use zlib compression level 1</option>
+            <option value="uncompressed">Uncompressed output</option>
+        </param>-->
+    </inputs>
+    <outputs>
+        <data name="output" format="bam" />
+    </outputs>
+    <tests>
+        <!-- tests and data extracted from 
+             https://github.com/samtools/samtools/blob/9ce8c64493f7ea3fa69bc5c1ac980b1a8e3dcf1f/test/test.pl
+             https://github.com/samtools/samtools/tree/develop/test/merge -->
+        <!-- # Merge 1 - Standard 3 file SAM merge all presented on the command line (only checks for similar size, because generated header info differs) -->
+        <test>
+            <param name="bamfiles" value="test_input_1_a.sam,test_input_1_b.sam,test_input_1_c.sam" />
+            <output name="output" file="2.merge.expected.bam" compare="sim_size" delta="50" />
+        </test>
+        <!-- Merge 2 - Standard 3 file BAM merge all files presented on the command line -->
+        <test>
+            <param name="bamfiles" value="test_input_1_a.bam,test_input_1_b.bam,test_input_1_c.bam" />
+            <output name="output" file="2.merge.expected.bam" compare="sim_size" delta="50" />
+        </test>
+        <!-- Merge 4 - 1 file BAM merge with file presented on the command line -->
+        <test>
+            <param name="bamfiles" value="test_input_1_b.bam" />
+            <output name="output" file="4.merge.expected.bam" compare="sim_size" delta="50" />
+        </test>
+        <!--Merge 5 - 3 file SAM merge all presented on the command line override IDs to file names (not implemented in tool) -->
+        <!--Merge 6 - merge all presented on the command line, combine PG and RG rather than dedup -->
+        <test>
+            <param name="bamfiles" value="test_input_1_a.bam,test_input_1_b.bam" />
+            <param name="idrg" value="-c" />
+            <param name="idpg" value="-p" />
+            <output name="output" file="6.merge.expected.bam" compare="sim_size" delta="50" />
+        </test>
+        <!-- Merge 7 - ID and SN with regex in them (probably not necessary for the galaxy tool because just different input) -->
+        <test>
+            <param name="bamfiles" value="test_input_1_a_regex.sam,test_input_1_b_regex.sam" />
+            <output name="output" file="7.merge.expected.bam" compare="sim_size" delta="50" />
+        </test>
+        <!-- Sort inputs by PG, then merge (not implemented, since -t not supported in the tool) -->
+        <!-- Sort inputs by PG, then merge (name sorted) (not implemented, since -t not supported in the tool) -->
+    </tests>
+    <help>
+**What it does**
+Merge multiple sorted alignment files, producing a single sorted output file that contains all the input records and maintains the existing sort order.
+
+If a file to take @headers from is specified the @SQ headers of input files will be merged into the specified header, otherwise they will be merged into a composite header created from the input headers. If in the process of merging @SQ lines for coordinate sorted input files, a conflict arises as to the order (for example input1.bam has @SQ for a,b,c and input2.bam has b,a,c) then the resulting output file will need to be re-sorted back into coordinate order.
+
+Unless the @PG/@RG headers are made unique when merging @RG and @PG records into the output header then any IDs found to be duplicates of existing IDs in the output header will have a suffix appended to them to differentiate them from similar header records from other files and the read records will be updated to reflect this. 
+    </help>
+    <expand macro="citations"/>
+</tool>
diff -r 000000000000 -r 740ce0a18f0d test-data/2.merge.expected-samin.bam
Binary file test-data/2.merge.expected-samin.bam has changed
diff -r 000000000000 -r 740ce0a18f0d test-data/2.merge.expected.bam
Binary file test-data/2.merge.expected.bam has changed
diff -r 000000000000 -r 740ce0a18f0d test-data/2.merge.expected.sam
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/2.merge.expected.sam	Sun Oct 14 13:44:49 2018 -0400
@@ -0,0 +1,67 @@
+@HD	VN:1.4
+@SQ	SN:insert	LN:599
+@SQ	SN:ref1	LN:45
+@SQ	SN:ref2	LN:40
+@SQ	SN:ref3	LN:4
+@RG	ID:fish	PG:donkey
+@RG	ID:cow	PU:13_&^&&*(:332
+@RG	PU:*9u8jkjjkjd:	ID:colt
+@RG	ID:fish-55424A4	PG:llama
+@RG	ID:cow-3A2CCEF5	PU:13_&^&&*(:332	PG:donkey-4861F4EF
+@RG	PU:*9u8jkjjkjd:	ID:colt-6ADB4A65
+@RG	ID:fish-39E5EF
+@RG	ID:cow-1802EEEC	PU:13_&^&&*(:332
+@RG	PU:*9u8jkjjkjd:	ID:colt-7EC68B3F
+@PG	ID:bull	PP:donkey
+@PG	ID:donkey
+@PG	ID:moose
+@PG	PP:moose	ID:cow
+@PG	ID:llama
+@PG	ID:bull-2B019719	PP:donkey-4861F4EF
+@PG	ID:donkey-4861F4EF
+@PG	ID:bull-60104A41	PP:donkey-2EE20DF8
+@PG	ID:donkey-2EE20DF8
+@CO	
+@CO	Do you know?
+@CO	Do you know?
+@CO	Another comment from test_input_1_c
+r000	99	insert	50	30	10M	=	80	30	ATTTAGCTAC	AAAAAAAAAA	RG:Z:cow	PG:Z:bull
+r000	211	insert	80	30	10M	=	50	-30	CCCAATCATT	AAAAAAAAAA	RG:Z:cow	PG:Z:bull
+r001	163	ref1	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112	YY:i:100	RG:Z:fish
+r005	163	ref1	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112	YY:i:100	RG:Z:colt-6ADB4A65	PG:Z:donkey-4861F4EF
+r008	163	ref1	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112	YY:i:100	RG:Z:colt-7EC68B3F	PG:Z:donkey-2EE20DF8
+r002	0	ref1	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*	XA:Z:abc	XB:i:-10
+r003	0	ref1	9	30	5H6M	*	0	0	AGCTAA	*	RG:Z:cow
+r006	0	ref1	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*	XA:Z:abc	XB:i:-10	RG:Z:colt-6ADB4A65	PG:Z:donkey-4861F4EF
+r007	0	ref1	9	30	5H6M	*	0	0	AGCTAA	*	RG:Z:colt-6ADB4A65	PG:Z:donkey-4861F4EF
+r009	0	ref1	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*	XA:Z:abc	XB:i:-10	RG:Z:colt-7EC68B3F	PG:Z:donkey-2EE20DF8
+r010	0	ref1	9	30	5H6M	*	0	0	AGCTAA	*	RG:Z:colt-7EC68B3F	PG:Z:donkey-2EE20DF8
+r004	0	ref1	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*	RG:Z:colt
+r007	0	ref1	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*	RG:Z:colt-6ADB4A65	PG:Z:donkey-4861F4EF
+r010	0	ref1	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*	RG:Z:colt-7EC68B3F	PG:Z:donkey-2EE20DF8
+r003	16	ref1	29	30	6H5M	*	0	0	TAGGC	*	RG:Z:cow
+r006	16	ref1	29	30	6H5M	*	0	0	TAGGC	*	RG:Z:colt-6ADB4A65	PG:Z:donkey-4861F4EF
+r009	16	ref1	29	30	6H5M	*	0	0	TAGGC	*	RG:Z:colt-7EC68B3F	PG:Z:donkey-2EE20DF8
+r001	83	ref1	37	30	9M	=	7	-39	CAGCGCCAT	*	RG:Z:fish
+r005	83	ref1	37	30	9M	=	7	-39	CAGCGCCAT	*	RG:Z:colt-6ADB4A65	PG:Z:donkey-4861F4EF
+r008	83	ref1	37	30	9M	=	7	-39	CAGCGCCAT	*	RG:Z:colt-7EC68B3F	PG:Z:donkey-2EE20DF8
+x1	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	*	RG:Z:colt	PG:Z:bull
+x7	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	*	RG:Z:cow-3A2CCEF5	PG:Z:bull-2B019719
+x10	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	*	RG:Z:cow-1802EEEC	PG:Z:bull-60104A41
+x2	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????	RG:Z:colt	PG:Z:bull
+x8	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????	RG:Z:cow-3A2CCEF5	PG:Z:bull-2B019719
+x11	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????	RG:Z:cow-1802EEEC	PG:Z:bull-60104A41
+x3	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????	RG:Z:fish	PG:Z:bull
+x9	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????	RG:Z:cow-3A2CCEF5	PG:Z:bull-2B019719
+x12	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????	RG:Z:cow-1802EEEC	PG:Z:bull-60104A41
+x4	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????	RG:Z:fish	PG:Z:bull
+x10	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????	RG:Z:cow-3A2CCEF5	PG:Z:bull-2B019719
+x13	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????	RG:Z:cow-1802EEEC	PG:Z:bull-60104A41
+x5	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????	RG:Z:fish	PG:Z:bull
+x11	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????	RG:Z:cow-3A2CCEF5	PG:Z:bull-2B019719
+x14	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????	RG:Z:cow-1802EEEC	PG:Z:bull-60104A41
+x6	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????	RG:Z:cow
+x12	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????	RG:Z:cow-3A2CCEF5	PG:Z:bull-2B019719
+x15	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????	RG:Z:cow-1802EEEC	PG:Z:bull-60104A41
+u1	4	*	0	30	23M	*	0	0	TAATTAAGTCTACAGAAAAAAAA	???????????????????????
+u2	4	*	0	30	*	*	0	0	TAATTAAGTCTACAGAAAAAAAA	???????????????????????
diff -r 000000000000 -r 740ce0a18f0d test-data/4.merge.expected.bam
Binary file test-data/4.merge.expected.bam has changed
diff -r 000000000000 -r 740ce0a18f0d test-data/6.merge.expected.bam
Binary file test-data/6.merge.expected.bam has changed
diff -r 000000000000 -r 740ce0a18f0d test-data/7.merge.expected.bam
Binary file test-data/7.merge.expected.bam has changed
diff -r 000000000000 -r 740ce0a18f0d test-data/test_input_1_a.bam
Binary file test-data/test_input_1_a.bam has changed
diff -r 000000000000 -r 740ce0a18f0d test-data/test_input_1_a.sam
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_input_1_a.sam	Sun Oct 14 13:44:49 2018 -0400
@@ -0,0 +1,28 @@
+@HD	VN:1.4
+@SQ	SN:insert	LN:599
+@SQ	SN:ref1	LN:45
+@SQ	SN:ref2	LN:40
+@SQ	SN:ref3	LN:4
+@RG	ID:fish	PG:donkey
+@RG	ID:cow	PU:13_&^&&*(:332
+@RG	PU:*9u8jkjjkjd:	ID:colt
+@PG	ID:bull	PP:donkey
+@PG	ID:donkey
+@PG	ID:moose
+@PG	PP:moose	ID:cow
+@CO	
+r000	99	insert	50	30	10M	=	80	30	ATTTAGCTAC	AAAAAAAAAA	RG:Z:cow	PG:Z:bull
+r000	211	insert	80	30	10M	=	50	-30	CCCAATCATT	AAAAAAAAAA	RG:Z:cow	PG:Z:bull
+r001	163	ref1	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112	YY:i:100	RG:Z:fish	PG:Z:donkey
+r002	0	ref1	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*	XA:Z:abc	XB:i:-10	PG:Z:donkey
+r003	0	ref1	9	30	5H6M	*	0	0	AGCTAA	*	RG:Z:cow
+r004	0	ref1	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*	RG:Z:colt	PG:Z:donkey
+r003	16	ref1	29	30	6H5M	*	0	0	TAGGC	*	RG:Z:cow	PG:Z:donkey
+r001	83	ref1	37	30	9M	=	7	-39	CAGCGCCAT	*	RG:Z:fish	PG:Z:donkey
+x1	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	*	RG:Z:colt	PG:Z:bull
+x2	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????	RG:Z:colt	PG:Z:bull
+x3	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????	RG:Z:fish	PG:Z:bull
+x4	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????	RG:Z:fish	PG:Z:bull
+x5	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????	RG:Z:fish	PG:Z:bull
+x6	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????	RG:Z:cow
+u1	4	*	0	30	23M	*	0	0	TAATTAAGTCTACAGAAAAAAAA	???????????????????????
diff -r 000000000000 -r 740ce0a18f0d test-data/test_input_1_a_regex.sam
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_input_1_a_regex.sam	Sun Oct 14 13:44:49 2018 -0400
@@ -0,0 +1,28 @@
+@HD	VN:1.4
+@SQ	SN:insert	LN:599
+@SQ	SN:ref1|this=that	LN:45
+@SQ	SN:ref2*HLA:1a:2:b	LN:40
+@SQ	SN:ref3	LN:4
+@RG	ID:fish	PG:donkey
+@RG	ID:cow	PU:13_&^&&*(:332
+@RG	PU:*9u8jkjjkjd:	ID:colt
+@PG	ID:bull	PP:donkey
+@PG	ID:donkey
+@PG	ID:moose
+@PG	PP:moose	ID:cow
+@CO	
+r000	99	insert	50	30	10M	=	80	30	ATTTAGCTAC	AAAAAAAAAA	RG:Z:cow	PG:Z:bull
+r000	211	insert	80	30	10M	=	50	-30	CCCAATCATT	AAAAAAAAAA	RG:Z:cow	PG:Z:bull
+r001	163	ref1|this=that	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112	YY:i:100	RG:Z:fish	PG:Z:colt
+r002	0	ref1|this=that	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*	XA:Z:abc	XB:i:-10	PG:Z:colt
+r003	0	ref1|this=that	9	30	5H6M	*	0	0	AGCTAA	*	RG:Z:cow
+r004	0	ref1|this=that	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*	RG:Z:colt	PG:Z:colt
+r003	16	ref1|this=that	29	30	6H5M	*	0	0	TAGGC	*	RG:Z:cow	PG:Z:colt
+r001	83	ref1|this=that	37	30	9M	=	7	-39	CAGCGCCAT	*	RG:Z:fish	PG:Z:colt
+x1	0	ref2*HLA:1a:2:b	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	*	RG:Z:colt	PG:Z:bull
+x2	0	ref2*HLA:1a:2:b	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????	RG:Z:colt	PG:Z:bull
+x3	0	ref2*HLA:1a:2:b	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????	RG:Z:fish	PG:Z:bull
+x4	0	ref2*HLA:1a:2:b	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????	RG:Z:fish	PG:Z:bull
+x5	0	ref2*HLA:1a:2:b	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????	RG:Z:fish	PG:Z:bull
+x6	0	ref2*HLA:1a:2:b	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????	RG:Z:cow
+u1	4	*	0	30	23M	*	0	0	TAATTAAGTCTACAGAAAAAAAA	???????????????????????
diff -r 000000000000 -r 740ce0a18f0d test-data/test_input_1_b.bam
Binary file test-data/test_input_1_b.bam has changed
diff -r 000000000000 -r 740ce0a18f0d test-data/test_input_1_b.sam
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_input_1_b.sam	Sun Oct 14 13:44:49 2018 -0400
@@ -0,0 +1,24 @@
+@HD	VN:1.4
+@SQ	SN:insert	LN:599
+@SQ	SN:ref1	LN:45
+@SQ	SN:ref2	LN:40
+@SQ	SN:ref3	LN:4
+@PG	ID:llama
+@RG	ID:fish	PG:llama
+@RG	ID:cow	PU:13_&^&&*(:332	PG:donkey
+@RG	PU:*9u8jkjjkjd:	ID:colt
+@PG	ID:bull	PP:donkey
+@PG	ID:donkey
+@CO	Do you know?
+r005	163	ref1	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112	YY:i:100	RG:Z:colt	PG:Z:donkey
+r006	0	ref1	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*	XA:Z:abc	XB:i:-10	RG:Z:colt	PG:Z:donkey
+r007	0	ref1	9	30	5H6M	*	0	0	AGCTAA	*	RG:Z:colt	PG:Z:donkey
+r007	0	ref1	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*	RG:Z:colt	PG:Z:donkey
+r006	16	ref1	29	30	6H5M	*	0	0	TAGGC	*	RG:Z:colt	PG:Z:donkey
+r005	83	ref1	37	30	9M	=	7	-39	CAGCGCCAT	*	RG:Z:colt	PG:Z:donkey
+x7	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	*	RG:Z:cow	PG:Z:bull
+x8	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????	RG:Z:cow	PG:Z:bull
+x9	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????	RG:Z:cow	PG:Z:bull
+x10	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????	RG:Z:cow	PG:Z:bull
+x11	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????	RG:Z:cow	PG:Z:bull
+x12	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????	RG:Z:cow	PG:Z:bull
diff -r 000000000000 -r 740ce0a18f0d test-data/test_input_1_b_regex.sam
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_input_1_b_regex.sam	Sun Oct 14 13:44:49 2018 -0400
@@ -0,0 +1,24 @@
+@HD	VN:1.4
+@SQ	SN:insert	LN:599
+@SQ	SN:ref2*HLA:1a:2:b	LN:40
+@SQ	SN:ref3	LN:4
+@SQ	SN:ref1	LN:45
+@PG	ID:llama_{a}
+@RG	ID:fish-[1]	PG:llama_{a}
+@RG	ID:cow-[2]	PU:13_&^&&*(:332	PG:donkey
+@RG	PU:*9u8jkjjkjd:	ID:colt
+@PG	ID:bull	PP:donkey
+@PG	ID:donkey
+@CO	Do you know?
+x7	0	ref2*HLA:1a:2:b	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	*	RG:Z:cow-[2]	PG:Z:bull
+x8	0	ref2*HLA:1a:2:b	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????	RG:Z:cow-[2]	PG:Z:bull
+x9	0	ref2*HLA:1a:2:b	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????	RG:Z:cow-[2]	PG:Z:bull
+x10	0	ref2*HLA:1a:2:b	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????	RG:Z:cow-[2]	PG:Z:bull
+x11	0	ref2*HLA:1a:2:b	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????	RG:Z:cow-[2]	PG:Z:bull
+x12	0	ref2*HLA:1a:2:b	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????	RG:Z:cow-[2]	PG:Z:bull
+r005	163	ref1	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112	YY:i:100	RG:Z:colt	PG:Z:donkey
+r006	0	ref1	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*	XA:Z:abc	XB:i:-10	RG:Z:colt	PG:Z:donkey
+r007	0	ref1	9	30	5H6M	*	0	0	AGCTAA	*	RG:Z:colt	PG:Z:donkey
+r007	0	ref1	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*	RG:Z:colt	PG:Z:donkey
+r006	16	ref1	29	30	6H5M	*	0	0	TAGGC	*	RG:Z:colt	PG:Z:donkey
+r005	83	ref1	37	30	9M	=	7	-39	CAGCGCCAT	*	RG:Z:colt	PG:Z:donkey
diff -r 000000000000 -r 740ce0a18f0d test-data/test_input_1_c.bam
Binary file test-data/test_input_1_c.bam has changed
diff -r 000000000000 -r 740ce0a18f0d test-data/test_input_1_c.sam
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test_input_1_c.sam	Sun Oct 14 13:44:49 2018 -0400
@@ -0,0 +1,23 @@
+@HD	VN:1.4
+@SQ	SN:ref1	LN:45
+@SQ	SN:ref2	LN:40
+@RG	ID:fish
+@RG	ID:cow	PU:13_&^&&*(:332
+@RG	PU:*9u8jkjjkjd:	ID:colt
+@PG	ID:bull	PP:donkey
+@PG	ID:donkey
+@CO	Do you know?
+@CO	Another comment from test_input_1_c
+r008	163	ref1	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112	YY:i:100	RG:Z:colt	PG:Z:donkey
+r009	0	ref1	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*	XA:Z:abc	XB:i:-10	RG:Z:colt	PG:Z:donkey
+r010	0	ref1	9	30	5H6M	*	0	0	AGCTAA	*	RG:Z:colt	PG:Z:donkey
+r010	0	ref1	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*	RG:Z:colt	PG:Z:donkey
+r009	16	ref1	29	30	6H5M	*	0	0	TAGGC	*	RG:Z:colt	PG:Z:donkey
+r008	83	ref1	37	30	9M	=	7	-39	CAGCGCCAT	*	RG:Z:colt	PG:Z:donkey
+x10	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	*	RG:Z:cow	PG:Z:bull
+x11	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????	RG:Z:cow	PG:Z:bull
+x12	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????	RG:Z:cow	PG:Z:bull
+x13	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????	RG:Z:cow	PG:Z:bull
+x14	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????	RG:Z:cow	PG:Z:bull
+x15	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????	RG:Z:cow	PG:Z:bull
+u2	4	*	0	30	*	*	0	0	TAATTAAGTCTACAGAAAAAAAA	???????????????????????