# HG changeset patch
# User iuc
# Date 1609930553 0
# Node ID 3d0adeee3f2b4f8ed9d9d7f67baa84f2a4e5b201
# Parent  dc51db22310c7bf74761bd1bb9c49df6fb65e36d
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/snpfreqplot/ commit c062eb1cd00ce9d565f3e2f3b042b3dd90d78ce4"

diff -r dc51db22310c -r 3d0adeee3f2b heatmap_for_variants.R
--- a/heatmap_for_variants.R	Fri Dec 18 23:48:01 2020 +0000
+++ b/heatmap_for_variants.R	Wed Jan 06 10:55:53 2021 +0000
@@ -153,9 +153,7 @@
 
                                         # Fix Labels
 ## Prettify names, check for label parity between final and ann_final
-fix_label <- function(name) {
-    ##' Reduce: 424 AGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTT A
-    ##'     to: 424 AGT… > A
+fix_label <- function(name, min_bases) {
     cols <- unlist(str_split(name, " "))
     ## first 3 are POS REF ALT, and the rest are optional differences
     pos_ref_alt <- cols[1:3]
@@ -164,11 +162,11 @@
         rest <- paste0(" :: ", paste0(cols[4:length(cols)], collapse = " "))
     }
     ## Trim the REF or ALT if too long
-    if (str_length(pos_ref_alt[2]) > 3) {
-        pos_ref_alt[2] <- paste0(substring(pos_ref_alt[2], 1, 3), "…")
+    if (str_length(pos_ref_alt[2]) > min_bases + 3) {
+        pos_ref_alt[2] <- paste0(substring(pos_ref_alt[2], 1, min_bases), "…+", str_length(pos_ref_alt[2]) - min_bases)
     }
-    if (str_length(pos_ref_alt[3]) > 3) {
-        pos_ref_alt[3] <- paste0(substring(pos_ref_alt[3], 1, 3), "…")
+    if (str_length(pos_ref_alt[3]) > min_bases + 3) {
+        pos_ref_alt[3] <- paste0(substring(pos_ref_alt[3], 1, min_bases), "…+", str_length(pos_ref_alt[3]) - min_bases)
     }
     ## Join required
     new_name <- paste0(pos_ref_alt[1], " ",
@@ -178,8 +176,32 @@
     new_name <- paste0(new_name, " ", rest)
 }
 
-colnames(final) <- sapply(colnames(final), fix_label)
-rownames(ann_final) <- sapply(rownames(ann_final), fix_label)
+fix_labels <- function(names) {
+    ## Try to reduce representations of variants by truncating REF and ALT
+    ## alleles.
+    ## Retries with less aggressive truncation if previous attempt did not
+    ## result in unique representations
+    ## For example, the variant representations:
+    ## 11074 C CTTTA
+    ## 11074 C CTTTAT
+    ## 11074 C CTTAGTT
+    ## will be turned into:
+    ## 11074 C > CTTTA
+    ## 11074 C > CTTTAT
+    ## 11074 C > CTT…+4
+
+    min_bases <- 3
+    repeat {
+        new_names <- sapply(names, fix_label, min_bases = min_bases)
+        if (length(unique(new_names)) == length(new_names)) {
+            break
+        }
+        min_bases <- min_bases + 1
+    }
+    return(new_names)
+}
+colnames(final) <- fix_labels(colnames(final))
+rownames(ann_final) <- fix_labels(rownames(ann_final))
 ## sanity test
 stopifnot(all(colnames(final) %in% rownames(ann_final)))
 
diff -r dc51db22310c -r 3d0adeee3f2b snpfreqplot.xml
--- a/snpfreqplot.xml	Fri Dec 18 23:48:01 2020 +0000
+++ b/snpfreqplot.xml	Wed Jan 06 10:55:53 2021 +0000
@@ -3,7 +3,7 @@
     <description>Generates a heatmap of allele frequencies grouped by variant type for SnpEff-annotated SARS-CoV-2 data</description>
     <macros>
         <token name="@VERSION@">1.0</token>
-        <token name="@GALAXY_VERSION@">2</token>
+        <token name="@GALAXY_VERSION@">3</token>
     </macros>
     <requirements>
         <requirement type="package" version="4.0">r-base</requirement>
@@ -209,7 +209,7 @@
             </section>
             <output name="outfile" ftype="svg">
                 <assert_contents>
-                    <has_text text="viewBox=&quot;0 0 1156 361&quot;" />
+                    <has_text text="viewBox=&quot;0 0 1156 380&quot;" />
                 </assert_contents>
             </output>
         </test>
@@ -245,7 +245,7 @@
             </section>
             <output name="outfile" ftype="svg">
                 <assert_contents>
-                    <has_text text="viewBox=&quot;0 0 754 292&quot;" />
+                    <has_text text="viewBox=&quot;0 0 754 293&quot;" />
                 </assert_contents>
             </output>
         </test>