# HG changeset patch # User iuc # Date 1642973512 0 # Node ID 5df83f4bad676af1fa9ea11b7a3eca83915ea431 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/spades commit 8734db131db6f76697b500b30f18ee7723d61813" diff -r 000000000000 -r 5df83f4bad67 macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Sun Jan 23 21:31:52 2022 +0000 @@ -0,0 +1,749 @@ + + 3.15.3 + 0 + + + spades + zip + + + + + + + + + + + + &1 | awk -F 'v' '{print $2}']]> + + + + + + + 10.1093/bioinformatics/btv688 + 10.1093/bioinformatics/btu266 + 10.1093/bioinformatics/btv337 + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + '$out_cs' || echo 'No contigs.fasta.' +#end if +#if 'ss' in $optional_output + && test -f 'output/scaffolds.fasta' && python '$__tool_directory__/write_tsv_script.py' < 'output/scaffolds.fasta' > '$out_ss' || echo 'No scaffolds.fasta.' +#end if +]]> + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + [0-9,]+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + 'ag' in optional_output + operation_mode != '--only-error-correction' + + + + + 'ags' in optional_output + operation_mode != '--only-error-correction' + + + + + 'cn' in optional_output + operation_mode != '--only-error-correction' + + + + + 'cp' in optional_output + operation_mode != '--only-error-correction' + + + + + + 'cr' in optional_output + operation_mode != '--only-assembler' + + + + + + + + + + 'cs' in optional_output + operation_mode != '--only-error-correction' + + + + + 'l' in optional_output + + + + + 'sc' in optional_output + operation_mode != '--only-error-correction' + + + + + 'sp' in optional_output + operation_mode != '--only-error-correction' + + + + + + + + 'ss' in optional_output + operation_mode != '--only-error-correction' + + + + + 'rs' in optional_output + + + + + 'b' in optional_output + + + + + 'dg' in optional_output + + + + + `_ of the manual. + ]]> + +- Assembly graph + + +- Assembly graph with scaffolds + + +- Contigs + + +- Contigs paths in the assembly graph + + +- Contigs stats + + +- Corrected reads by BayesHammer + + +- Log file + + +- Scaffolds (recommended for use as resulting sequences) + + +- Scaffolds paths in the assembly graph + + +- Scaffolds stats + + +SPAdes - St. Petersburg genome assembler - is an assembly toolkit containing various assembly pipelines. + + `_ (e.g. assemble using k-mer lengths 21,33,55,77,99,127). However, due to increased error rate some changes of k-mer lengths (e.g. selection of shorter ones) may be required. For example, if you ran SPAdes with k-mer lengths 21,33,55,77 and then decided to assemble the same data set using more iterations and larger values of K, you can run SPAdes once again specifying the same output folder and the following options: --restart-from k77 -k 21,33,55,77,99,127 --mismatch-correction -o . Do not forget to copy contigs and scaffolds from the previous run. We're planning to tackle issue of selecting k-mer lengths for IonTorrent reads in next versions. + +You may need no error correction for Hi-Q enzyme at all. However, we suggest trying to assemble your data with and without error correction and select the best variant. + +For non-trivial datasets (e.g. with high GC, low or uneven coverage) we suggest to enable single-cell mode (setting --sc option) and use k-mer lengths of 21,33,55. + + ]]> + + diff -r 000000000000 -r 5df83f4bad67 rnaviralspades.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rnaviralspades.xml Sun Jan 23 21:31:52 2022 +0000 @@ -0,0 +1,359 @@ + + de novo assembler for transcriptomes, metatranscriptomes and metaviromes + + macros.xml + + + + + + + + +
+ + + +
+ + + + + + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ `_ and on the `project website `_. + ]]> + +
diff -r 000000000000 -r 5df83f4bad67 test-data/A_R1.fastq.gz Binary file test-data/A_R1.fastq.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/A_R2.fastq.gz Binary file test-data/A_R2.fastq.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/B_R1.fastq.gz Binary file test-data/B_R1.fastq.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/B_R2.fastq.gz Binary file test-data/B_R2.fastq.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/corona_scaffold.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/corona_scaffold.fasta Sun Jan 23 21:31:52 2022 +0000 @@ -0,0 +1,18 @@ +>NODE_1_length_1009_cluster_1_candidate_1_domains_2 +GTTCAAGCTGAGGCAAAACGCCTTTTTCAACTTCTACTAAGCCACAAGTGCCATCTTTAG +GATGTTGACGTGCCTCTGATAAGACCGCCTCCACTGGAGGATACACAGGTTTAAAGGTTT +ATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAAC +GAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATA +ATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCT +GCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGT +GACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAAC +TCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGG +AGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGGCTTAGTAGAAG +TTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGATG +CTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTC +AGTACGGTCGTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAG +TGGCTTACCGCAAGGTTCTTCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTT +ACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGATCCTTATGAAG +ATTTAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAA +CAGCCCTATGTGTTCATCAAACGTTCGGATGCTCGAACTGCACCTCCTGGTCATGTTGAG +CTGGTAGCAGAACTCGAAGGCATTCAGTACGGTCGTAGTGGTGAGACAC diff -r 000000000000 -r 5df83f4bad67 test-data/covid.fastq.gz Binary file test-data/covid.fastq.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/ecoli_1K.fasta.gz Binary file test-data/ecoli_1K.fasta.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/ecoli_1K.fastq.gz Binary file test-data/ecoli_1K.fastq.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/ecoli_1K_1.fasta.gz Binary file test-data/ecoli_1K_1.fasta.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/ecoli_1K_1.fastq.gz Binary file test-data/ecoli_1K_1.fastq.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/ecoli_1K_2.fasta.gz Binary file test-data/ecoli_1K_2.fasta.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/ecoli_1K_2.fastq.gz Binary file test-data/ecoli_1K_2.fastq.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/pl1.fq.gz Binary file test-data/pl1.fq.gz has changed diff -r 000000000000 -r 5df83f4bad67 test-data/pl2.fq.gz Binary file test-data/pl2.fq.gz has changed