comparison stacks_assembleperead.xml @ 3:ee52d9cfaffc draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit e1c1550e0bd61c88ffead2b1c4f6ab7393052393

2:fea78fd36a05

<tool id="stacks_assembleperead" name="Stacks: assemble read pairs by locus" version="@WRAPPER_VERSION@.0">
    <description>run the STACKS sort_read_pairs.pl and exec_velvet.pl wrappers</description>
    <macros>
        <import>macros.xml</import>
    </macros>
    <expand macro="requirements"/>

        &&

        #for $input_file in $stacks_col:
            #set $ext = ""
            #if not str($input_file.name).endswith('.tsv'):
                #set $ext = ".tsv"
            #end if
            ln -s "${input_file}" "stacks_inputs/${input_file.name}${ext}" &&
        #end for

        #for $input_file in $reads:
            #set $name = str($input_file.name)
            #if $name.endswith('.2.fq'):
                ## sort_read_pairs is expecting strange fastq names...
                #set $name = $name[:-5]+".fq_2"
            #end if
            ln -s "${input_file}" "reads/${name}" &&
        #end for

        sort_read_pairs.pl

        #end if

    ]]></command>
    <inputs>
        <param name="stacks_col" argument="-p" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" />
        <param name="reads" argument="-s" format="fastqsanger" type="data" multiple="true" label="Files containing sequences" help="Files containing parent sequences from a mapping cross" />

        <param name="whitelist" argument="-w" format="txt,tabular" type="data" optional="true" label="White list of catalog IDs to include" />
        <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/>

       <conditional name="velvet">

            </when>
        </conditional>
    </inputs>
    <outputs>
        <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}">
            <discover_datasets pattern="(?P&lt;name&gt;.+)\.fa(sta)?" ext="fasta" directory="stacks_outputs" />
        </collection>

        <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa">
            <filter>velvet['use_velvet']</filter>
        </data>

            </param>
            <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" />
            <param name="velvet|use_velvet" value="true" />
            <param name="velvet|contig_length" value="20" />

            <output_collection name="collated">
                <element name="1">
                    <assert_contents>
                        <has_text text="CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG" />
                    </assert_contents>
                </element>
            </output_collection>

            <output name="contigs">
                <assert_contents>
                    <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" />
                </assert_contents>
            </output>

3:ee52d9cfaffc

<tool id="stacks_assembleperead" name="Stacks: assemble read pairs by locus" version="@WRAPPER_VERSION@.1">
    <description>run the STACKS sort_read_pairs.pl and exec_velvet.pl wrappers</description>
    <macros>
        <import>macros.xml</import>
    </macros>
    <expand macro="requirements"/>

        &&

        #for $input_file in $stacks_col:
            #set $ext = ""
            #if not str($input_file.element_identifier).endswith('.tsv'):
                #set $ext = ".tsv"
            #end if
            ln -s "${input_file}" "stacks_inputs/${input_file.element_identifier}${ext}" &&
        #end for

        #for $input_file in $reads:
            #set $name = str($input_file.element_identifier)
            ## sort_read_pairs is expecting strange fastq names: <sample_name>.fq_2
            #if $name.endswith('.1.fq'):
                ## handle a common case
                #set $name = $name[:-5]+".fq_1"
            #else if $name.endswith('.2.fq'):
                ## handle a common case
                #set $name = $name[:-5]+".fq_2"
            #else if not $name.endswith('.fq') and not $name.endswith('.fq_2'):
                ## no extension, consider it's a fq_2 file
                #set $name = $name + ".fq_2"
            #end if
            ln -s "${input_file}" "reads/${name}" &&
        #end for

        sort_read_pairs.pl

        #end if

    ]]></command>
    <inputs>
        <param name="stacks_col" argument="-p" format="tabular,txt" type="data_collection" collection_type="list" label="Output from previous Stacks pipeline steps (e.g. denovo_map or refmap)" />
        <param name="reads" argument="-s" format="fastqsanger" type="data" multiple="true" label="Files containing reads to assemble" help="only R2 reads" />

        <param name="whitelist" argument="-w" format="txt,tabular" type="data" optional="true" label="White list of catalog IDs to include" />
        <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/>

       <conditional name="velvet">

            </when>
        </conditional>
    </inputs>
    <outputs>
        <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}">
            <filter>not velvet['use_velvet']</filter>
            <discover_datasets pattern="(?P&lt;name&gt;.+)\.fa(sta)?$" ext="fasta" directory="stacks_outputs" />
        </collection>

        <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa">
            <filter>velvet['use_velvet']</filter>
        </data>

            </param>
            <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" />
            <param name="velvet|use_velvet" value="true" />
            <param name="velvet|contig_length" value="20" />

            <output name="contigs">
                <assert_contents>
                    <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" />
                </assert_contents>
            </output>