Mercurial > repos > iuc > stacks_assembleperead
changeset 8:e6919d8ae34d draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks commit dc23703c260d004a28fe24a2a7c00cb4371bc32e
| author | iuc |
|---|---|
| date | Thu, 27 Apr 2017 04:18:45 -0400 |
| parents | e194abc415a6 |
| children | b08cd32d03ad |
| files | macros.xml stacks_assembleperead.xml test-data/demultiplexed/PopA_01.1.fq.gzip test-data/denovo_map/popmap_cstacks.tsv test-data/procrad/R1.fq.gzip test-data/ustacks/ustacks.out |
| diffstat | 6 files changed, 80 insertions(+), 21 deletions(-) [+] |
line wrap: on
line diff
--- a/macros.xml Fri Apr 07 11:48:12 2017 -0400 +++ b/macros.xml Thu Apr 27 04:18:45 2017 -0400 @@ -2,14 +2,14 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="1.42">stacks</requirement> + <requirement type="package" version="1.46">stacks</requirement> <requirement type="package" version="1.2.10">velvet</requirement> - <container type="docker">quay.io/biocontainers/stacks:1.42--2</container> + <requirement type="package" version="1.1">stacks_summary</requirement> <yield/> </requirements> </xml> - <token name="@WRAPPER_VERSION@">1.42</token> + <token name="@WRAPPER_VERSION@">1.46</token> <xml name="stdio"> <stdio> @@ -90,6 +90,7 @@ <option value="bsaHI">bsaHI</option> <option value="hpaII">hpaII</option> <option value="ncoI">ncoI</option> + <option value="ApaLI">ApaLI</option> </xml> <xml name="cross_types"> @@ -100,6 +101,19 @@ <option value="GEN">GEN (generic, unspecific to any map type)</option> </xml> + <token name="@CLEAN_EXT@"> + <![CDATA[ + #from os.path import splitext + #import re + #def clean_ext($identifier) + #while $identifier.endswith(('.1', '.fa', '.fq', '.fasta', '.fastq', '.gz', '.gzip', '.sam', '.bam')) + #set $identifier = splitext($identifier)[0] + #end while +$identifier#slurp + #end def + ]]> + </token> + <token name="@NORM_GENOTYPES_OUTPUT_LIGHT@"> <![CDATA[ ## We need to do this as the output file names contains the value of an option (min progeny)
--- a/stacks_assembleperead.xml Fri Apr 07 11:48:12 2017 -0400 +++ b/stacks_assembleperead.xml Thu Apr 27 04:18:45 2017 -0400 @@ -11,45 +11,45 @@ && - #for $input_file in $stacks_col: + #for $input_file in $stacks_col #set $ext = "" - #if not str($input_file.element_identifier).endswith('.tsv'): + #if not str($input_file.element_identifier).endswith('.tsv') #set $ext = ".tsv" #end if - ln -s "${input_file}" "stacks_inputs/${input_file.element_identifier}${ext}" && + ln -s '${input_file}' 'stacks_inputs/${input_file.element_identifier}${ext}' && #end for - #for $input_file in $reads: + #for $input_file in $reads #set $name = str($input_file.element_identifier) ## sort_read_pairs is expecting strange fastq names: <sample_name>.fq_2 - #if $name.endswith('.1.fq'): + #if $name.endswith('.1.fq') ## handle a common case #set $name = $name[:-5]+".fq_1" - #else if $name.endswith('.2.fq'): + #else if $name.endswith('.2.fq') ## handle a common case #set $name = $name[:-5]+".fq_2" - #else if not $name.endswith('.fq') and not $name.endswith('.fq_2'): + #else if not $name.endswith('.fq') and not $name.endswith('.fq_2') ## no extension, consider it's a fq_2 file #set $name = $name + ".fq_2" #end if - ln -s "${input_file}" "reads/${name}" && + ln -s '${input_file}' 'reads/${name}' && #end for sort_read_pairs.pl -p stacks_inputs -s 'reads' - #if $whitelist: + #if $whitelist -w '$whitelist' #end if - #if $threshold: + #if $threshold -r $threshold #end if -o stacks_outputs - #if $velvet.use_velvet: + #if $velvet.use_velvet == "yes" ## remove possible empty files && find stacks_outputs -type f -size 0 -delete @@ -70,21 +70,24 @@ <param name="threshold" argument="-r" type="integer" value="" optional="true" label="Minimum number of reads by locus"/> <conditional name="velvet"> - <param name="use_velvet" type="boolean" checked="false" label="Perform assembly with Velvet" help="If not selected, the tool will only produce of collection of fasta files (one per locus) containing reads ready to assemble." /> - <when value="false"></when> - <when value="true"> + <param name="use_velvet" type="select" label="Perform assembly with Velvet" help="If not selected, the tool will only produce of collection of fasta files (one per locus) containing reads ready to assemble."> + <option value="no" selected="true">No</option> + <option value="yes">Yes</option> + </param> + <when value="no"/> + <when value="yes"> <param name="contig_length" type="integer" value="200" label="Minimum length for asssembled contigs"/> </when> </conditional> </inputs> <outputs> <collection name="collated" type="list" label="Collated FASTA files per locus on ${on_string}"> - <filter>not velvet['use_velvet']</filter> + <filter>velvet['use_velvet'] == "no"</filter> <discover_datasets pattern="(?P<name>.+)\.fa(sta)?$" ext="fasta" directory="stacks_outputs" /> </collection> <data format="fasta" name="contigs" label="Assembled contigs on ${on_string}" from_work_dir="assembled/collated.fa"> - <filter>velvet['use_velvet']</filter> + <filter>velvet['use_velvet'] == "yes"</filter> </data> </outputs> @@ -132,12 +135,12 @@ </collection> </param> <param name="reads" value="demultiplexed/PopA_01.2.fq,demultiplexed/PopA_02.2.fq" ftype="fastqsanger" /> - <param name="velvet|use_velvet" value="true" /> + <param name="velvet|use_velvet" value="yes" /> <param name="velvet|contig_length" value="20" /> <output name="contigs"> <assert_contents> - <has_text text="TGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGA" /> + <has_text text="|NODE_" /> </assert_contents> </output> </test>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/denovo_map/popmap_cstacks.tsv Thu Apr 27 04:18:45 2017 -0400 @@ -0,0 +1,1 @@ +PopA_01 myPopA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/ustacks/ustacks.out Thu Apr 27 04:18:45 2017 -0400 @@ -0,0 +1,41 @@ +ustacks parameters selected: + Sample ID: 1 + Min depth of coverage to create a stack: 2 + Max distance allowed between stacks: 2 + Max distance allowed to align secondary reads: 4 + Max number of stacks allowed per de novo locus: 3 + Deleveraging algorithm: disabled + Removal algorithm: enabled + Model type: SNP + Alpha significance level for model: 0.05 + Gapped alignments: disabled +Parsing stacks_inputs/PopA_01.fq +Loading RAD-Tags...done +Loaded 66 RAD-Tags. + Inserted 7 elements into the RAD-Tags hash map. + 0 reads contained uncalled nucleotides that were modified. +4 initial stacks were populated; 3 stacks were set aside as secondary reads. +Initial coverage mean: 15.75; Std Dev: 7.46241; Max: 27 +Deleveraging trigger: 23; Removal trigger: 31 +Calculating distance for removing repetitive stacks. + Distance allowed between stacks: 1; searching with a k-mer length of 47 (48 k-mers per read); 1 k-mer hits required. +Removing repetitive stacks. + Removed 0 stacks. + 4 stacks remain for merging. +Post-Repeat Removal, coverage depth Mean: 15.75; Std Dev: 7.46241; Max: 27 +Calculating distance between stacks... + Distance allowed between stacks: 2; searching with a k-mer length of 31 (64 k-mers per read); 2 k-mer hits required. +Merging stacks, maximum allowed distance: 2 nucleotide(s) + 4 stacks merged into 3 loci; deleveraged 0 loci; blacklisted 0 loci. +After merging, coverage depth Mean: 21; Std Dev: 4.24264; Max: 27 +Merging remainder radtags + 3 remainder sequences left to merge. + Distance allowed between stacks: 4; searching with a k-mer length of 17 (78 k-mers per read); 10 k-mer hits required. + Matched 3 remainder reads; unable to match 0 remainder reads. +After remainders merged, coverage depth Mean: 22; Std Dev: 4.32049; Max: 28 +Calling final consensus sequences, invoking SNP-calling model... +Number of utilized reads: 66 +Writing loci, SNPs, and alleles to 'stacks_outputs/'... + Refetching sequencing IDs from stacks_inputs/PopA_01.fq... read 66 sequence IDs. +done. +ustacks is done.