Mercurial > repos > iuc > trinity
changeset 2:de0af39266ef draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 77385ec02b79f527348aff01bd83a019e30f5f45
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/abundance_estimates_to_matrix.xml Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,206 @@ +<tool id="abundance_estimates_to_matrix" name="Build expression matrix" version="2.1.1"> + <description>for a de novo assembly of RNA-Seq data by Trinity</description> + <requirements> + <requirement type="package" version="2.1.1">trinity</requirement> + <requirement type="package" version="1.1.2">bowtie</requirement> + <requirement type="package" version="1.2">samtools</requirement> + <requirement type="package" version="3.12.0">edger</requirement> + <requirement type="package" version="3.12.0">bioconductor-edger</requirement> + <requirement type="package" version="1.2.28">rsem</requirement> + </requirements> + <stdio> + <exit_code range="1:"/> + </stdio> + <command><![CDATA[ + #for $entry in $samples: + ln -s "${entry.file}" "${entry.sample_name}.tsv" && + #end for + + abundance_estimates_to_matrix.pl + + --est_method ${est_method} + --cross_sample_norm ${additional_params.cross_sample_norm} + + #for $entry in $samples: + "${entry.sample_name}.tsv" + #end for + ]]></command> + <inputs> + <repeat name="samples" title="RSEM abundance estimates for samples"> + <param name="file" label="Add file" type="data" format="tabular"/> + <param name="sample_name" label="Sample name" type="text"> + <validator type="regex" message="Value must be a not empty string composed by alphanumeric characters and underscores">^\w+$</validator> + </param> + </repeat> + + <param type="select" name="est_method" label="Abundance estimation method"> + <option value="RSEM">RSEM</option> + <option value="eXpress">eXpress</option> + </param> + + <section name="additional_params" title="Additional Options" expanded="False"> + <param type="select" name="cross_sample_norm" label="Cross sample normalization"> + <option value="TMM">TMM</option> + <option value="UpperQuartile">UpperQuartile</option> + <option value="none">None</option> + </param> + </section> + </inputs> + <outputs> + <data format="tabular" name="trans_counts" label="${tool.name} on ${on_string}: estimated RNA-Seq fragment counts (raw counts)" from_work_dir="matrix.counts.matrix"/> + <data format="tabular" name="TPM_no_norm" label="${tool.name} on ${on_string}: matrix of TPM expression values (not cross-sample normalized)" from_work_dir="matrix.TPM.not_cross_norm"/> + <data format="tabular" name="norm" label="${tool.name} on ${on_string}: matrix of TMM-normalized expression values" from_work_dir="matrix.TMM.EXPR.matrix"> + <filter>additional_params['cross_sample_norm'] == "TMM"</filter> + </data> + <data format="tabular" name="norm" label="${tool.name} on ${on_string}: matrix of UpperQuartile-normalized expression values" from_work_dir="matrix.UpperQuartile.EXPR.matrix"> + <filter>additional_params['cross_sample_norm'] == "UpperQuartile"</filter> + </data> + </outputs> + <tests> + <test> + <param name="samples_0|file" value="count/rsem_bowtie/RSEM.genes.results"/> + <param name="samples_0|sample_name" value="sample_A"/> + <param name="samples_1|file" value="count/rsem_bowtie/RSEM.genes_B.results"/> + <param name="samples_1|sample_name" value="sample_B"/> + <param name="est_method" value="RSEM"/> + <param name="cross_sample_norm" value="TMM"/> + <output name="trans_counts"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + <output name="TPM_no_norm"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + <output name="norm"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + </test> + <test> + <param name="samples_0|file" value="count/rsem_bowtie2/RSEM.genes.results"/> + <param name="samples_0|sample_name" value="sample_A"/> + <param name="samples_1|file" value="count/rsem_bowtie2/RSEM.genes_B.results"/> + <param name="samples_1|sample_name" value="sample_B"/> + <param name="est_method" value="RSEM"/> + <param name="cross_sample_norm" value="TMM"/> + <output name="trans_counts"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + <output name="TPM_no_norm"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + <output name="norm"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + </test> + <test> + <param name="samples_0|file" value="count/express_bowtie/results.xprs.genes"/> + <param name="samples_0|sample_name" value="sample_A"/> + <param name="samples_1|file" value="count/express_bowtie/results_B.xprs.genes"/> + <param name="samples_1|sample_name" value="sample_B"/> + <param name="est_method" value="eXpress"/> + <param name="cross_sample_norm" value="TMM"/> + <output name="trans_counts"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + <output name="TPM_no_norm"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + <output name="norm"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + </test> + <test> + <param name="samples_0|file" value="count/rsem_bowtie/RSEM.genes.results"/> + <param name="samples_0|sample_name" value="sample_A"/> + <param name="samples_1|file" value="count/rsem_bowtie/RSEM.genes_B.results"/> + <param name="samples_1|sample_name" value="sample_B"/> + <param name="est_method" value="RSEM"/> + <param name="cross_sample_norm" value="UpperQuartile"/> + <output name="trans_counts"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + <output name="TPM_no_norm"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + <output name="norm" file="count/matrix_rsem_bowtie_UpperQuartile/matrix.UpperQuartile.EXPR.matrix" /> + </test> + <test> + <param name="samples_0|file" value="count/rsem_bowtie/RSEM.genes.results"/> + <param name="samples_0|sample_name" value="sample_A"/> + <param name="samples_1|file" value="count/rsem_bowtie/RSEM.genes_B.results"/> + <param name="samples_1|sample_name" value="sample_B"/> + <param name="est_method" value="RSEM"/> + <param name="cross_sample_norm" value="none"/> + <output name="trans_counts"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + <output name="TPM_no_norm"> + <assert_contents> + <has_line_matching expression="TRINITY_DN3_c0_g1	.*" /> + <has_n_columns n="3" /> + </assert_contents> + </output> + </test> + </tests> + <help> +<![CDATA[ +Trinity_ assembles transcript sequences from Illumina RNA-Seq data. +This tool will combine abundance estimations (produced by 'Align reads and estimate abundance on a de novo assembly of RNA-Seq data' tool) from multiple samples into a single tabular file. +This matrix can then be used by 'RNASeq samples quality check for transcript quantification' and 'Differential Expression Analysis using a Trinity assembly' tools. + +**Inputs** + +It takes as input multiple results from 'Align reads and estimate abundance on a de novo assembly of RNA-Seq data' tool/ +Each sample must have a name, that should be used in subsequent tools. + +**Output** + +This tool will produce a single matrix file. More details on this page: + +.. _Trinity manual: https://github.com/trinityrnaseq/trinityrnaseq/wiki/Trinity-Transcript-Quantification + + +.. _Trinity: http://trinityrnaseq.github.io +]]> + </help> + + <citations> + <citation type="doi">doi:10.1038/nbt.1883</citation> + </citations> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/align_and_estimate_abundance.xml Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,260 @@ +<tool id="align_and_estimate_abundance" name="Align reads and estimate abundance" version="2.1.1"> + <description>on a de novo assembly of RNA-Seq data</description> + <requirements> + <requirement type="package" version="2.1.1">trinity</requirement> + <requirement type="package" version="1.1.2">bowtie</requirement> + <requirement type="package" version="2.2.6">bowtie2</requirement> + <requirement type="package" version="1.2">samtools</requirement> + <requirement type="package" version="1.2.28">rsem</requirement> + <requirement type="package" version="1.5.1">express</requirement> + </requirements> + <stdio> + <exit_code range="1:"/> + </stdio> + <command><![CDATA[ + ln -s $transcripts input.fa + + && + + align_and_estimate_abundance.pl + + --transcripts input.fa + + --est_method $method.est_method + #if $method.est_method == "RSEM" or $method.est_method == "eXpress": + --aln_method $method.aln_method + #end if + + #if $inputs.paired_or_single == "paired": + --left $inputs.left_input --right $inputs.right_input + + #if $inputs.left_input.is_of_type('fasta'): + --seqType fa + #else: + --seqType fq + #end if + + #if $inputs.strand.is_strand_specific: + --SS_lib_type $inputs.strand.library_type + #end if + + #else: + --single $inputs.input + + #if $inputs.input.is_of_type('fasta'): + --seqType fa + #else: + --seqType fq + #end if + + #if $inputs.strand.is_strand_specific: + --SS_lib_type $inputs.strand.library_type + #end if + #end if + + --max_ins_size $inputs.paired_fragment_length + + ## Additional parameters. + #if $additional_params.gene_map.has_gene_map == "yes": + --gene_trans_map $additional_params.gene_map.gene_trans_map + #else + --trinity_mode + #end if + + --prep_reference + + --output_dir . + + ## CPU + --thread_count \${GALAXY_SLOTS:-4} + ]]></command> + <inputs> + <param format="fasta" name="transcripts" type="data" label="Transcripts" help="de novo assembly of RNA-Seq data"/> + <conditional name="inputs"> + <param name="paired_or_single" type="select" label="Paired or Single-end data?"> + <option value="paired">Paired</option> + <option value="single">Single</option> + </param> + <when value="paired"> + <param format="fasta,fastqsanger" name="left_input" type="data" label="Left/Forward strand reads" help=""/> + <param format="fasta,fastqsanger" name="right_input" type="data" label="Right/Reverse strand reads" help=""/> + <conditional name="strand"> + <param name="is_strand_specific" type="boolean" checked="false" label="Strand specific data"/> + <when value="false"> + </when> + <when value="true"> + <param name="library_type" type="select" label="Strand-specific Library Type"> + <option value="FR">Forward-Reverse</option> + <option value="RF">Reverse-Forward</option> + </param> + </when> + </conditional> + <param name="paired_fragment_length" type="integer" value="800" min="1" label="Maximum insert size" help="bowtie -X parameter"/> + </when> + <when value="single"> + <param format="fasta,fastqsanger" name="input" type="data" label="Single-end reads" help=""/> + <conditional name="strand"> + <param name="is_strand_specific" type="boolean" checked="false" label="Strand specific data"/> + <when value="false"> + </when> + <when value="true"> + <param name="library_type" type="select" label="Strand-specific Library Type"> + <option value="F">F</option> + <option value="R">R</option> + </param> + </when> + </conditional> + </when> + </conditional> + + <conditional name="method"> + <param type="select" name="est_method" label="Abundance estimation method"> + <option value="RSEM">RSEM</option> + <option value="eXpress">eXpress</option> + </param> + <when value="RSEM"> + <param type="select" name="aln_method" label="Alignment method"> + <option value="bowtie">Bowtie</option> + <option value="bowtie2">Bowtie2</option> + </param> + </when> + <when value="eXpress"> + <param type="select" name="aln_method" label="Alignment method"> + <option value="bowtie">Bowtie</option> + <option value="bowtie2">Bowtie2</option> + </param> + </when> + </conditional> + + <section name="additional_params" title="Additional Options" expanded="False"> + <conditional name="gene_map"> + <param name="has_gene_map" type="select" label="Trinity assembly?" help="If the transcripts were not assembled by trinity, additional information is needed"> + <option value="no">No</option> + <option value="yes">Yes</option> + </param> + <when value="no"> + </when> + <when value="yes"> + <param format="tabular" name="gene_trans_map" type="data" label="Gene to transcript correspondence ('gene(tab)transcript' lines)" /> + </when> + </conditional> + + </section> + </inputs> + <outputs> + <data format="tabular" name="isoforms_counts_rsem" label="${tool.name} on ${on_string}: isoforms counts" from_work_dir="RSEM.isoforms.results"> + <filter>method['est_method'] == "RSEM"</filter> + </data> + <data format="tabular" name="genes_counts_rsem" label="${tool.name} on ${on_string}: genes counts" from_work_dir="RSEM.genes.results"> + <filter>method['est_method'] == "RSEM"</filter> + </data> + + <data format="tabular" name="isoforms_counts_express" label="${tool.name} on ${on_string}: isoforms counts" from_work_dir="results.xprs"> + <filter>method['est_method'] == "eXpress"</filter> + </data> + <data format="tabular" name="genes_counts_express" label="${tool.name} on ${on_string}: genes counts" from_work_dir="results.xprs.genes"> + <filter>method['est_method'] == "eXpress"</filter> + </data> + </outputs> + <tests> + <test> + <param name="paired_or_single" value="paired"/> + <param name="left_input" value="reads.left.fq"/> + <param name="right_input" value="reads.right.fq"/> + <param name="transcripts" value="raw/Trinity.fasta"/> + <param name="library_type" value="RF"/> + <param name="est_method" value="RSEM"/> + <param name="aln_method" value="bowtie"/> + <param name="has_gene_map" value="no"/> + <output name="isoforms_counts_rsem"> + <assert_contents> + <has_line_matching expression="TRINITY_DN0_c0_g1_i1	.*" /> + <has_n_columns n="8" /> + </assert_contents> + </output> + <output name="genes_counts_rsem"> + <assert_contents> + <has_line_matching expression="TRINITY_DN0_c0_g1	.*" /> + <has_n_columns n="7" /> + </assert_contents> + </output> + </test> + <test> + <param name="paired_or_single" value="paired"/> + <param name="left_input" value="reads.left.fq"/> + <param name="right_input" value="reads.right.fq"/> + <param name="transcripts" value="raw/Trinity.fasta"/> + <param name="library_type" value="RF"/> + <param name="est_method" value="RSEM"/> + <param name="aln_method" value="bowtie2"/> + <param name="has_gene_map" value="no"/> + <output name="isoforms_counts_rsem"> + <assert_contents> + <has_line_matching expression="TRINITY_DN0_c0_g1_i1	.*" /> + <has_n_columns n="8" /> + </assert_contents> + </output> + <output name="genes_counts_rsem"> + <assert_contents> + <has_line_matching expression="TRINITY_DN0_c0_g1	.*" /> + <has_n_columns n="7" /> + </assert_contents> + </output> + </test> + <test> + <param name="paired_or_single" value="paired"/> + <param name="left_input" value="reads.left.fq"/> + <param name="right_input" value="reads.right.fq"/> + <param name="transcripts" value="raw/Trinity.fasta"/> + <param name="library_type" value="RF"/> + <param name="est_method" value="eXpress"/> + <param name="aln_method" value="bowtie"/> + <param name="has_gene_map" value="no"/> + <output name="isoforms_counts_express"> + <assert_contents> + <has_line_matching expression=".*	TRINITY_DN2_c3_g1_i1	.*" /> + <has_n_columns n="15" /> + </assert_contents> + </output> + <output name="genes_counts_express"> + <assert_contents> + <has_line_matching expression="NA	TRINITY_DN3_c0_g1.*" /> + <has_n_columns n="15" /> + </assert_contents> + </output> + </test> + </tests> + <help> +<![CDATA[ +Trinity_ assembles transcript sequences from Illumina RNA-Seq data. +This tool estimates the abundance of isoforms and genes of a transcriptome assembled with Trinity, using FastQ of a specific sample. + +**Inputs** + +It takes as input a transcriptome assembled with Trinity and the reads from a RNASeq sample. +You have to choose between several counting methods. + +If you dont align on a Trinity assembly, you need to provide a file of the following (tabular) format to map gene ids to transcript ids: + +=========== ================ +gene1 transcript1 +----------- ---------------- +gene2 transcript2 +=========== ================ + +**Output** + +This tool will produce 2 tabular files, with counts for isoforms and genes respectively. More details on this page: + +.. _Trinity manual: https://github.com/trinityrnaseq/trinityrnaseq/wiki/Trinity-Transcript-Quantification + + +.. _Trinity: http://trinityrnaseq.github.io +]]> + </help> + + <citations> + <citation type="doi">doi:10.1038/nbt.1883</citation> + </citations> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/run_DE_analysis.xml Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,146 @@ +<tool id="run_DE_analysis" name="Differential expression analysis" version="2.1.1"> + <description>using a Trinity assembly</description> + <requirements> + <requirement type="package" version="2.1.1">trinity</requirement> + <!-- odering is crucial, otherwise R will override the ENV variables from deseq2 --> + <requirement type="package" version="1.10.0">deseq2</requirement> + <requirement type="package" version="1.10.0">bioconductor-deseq2</requirement> + <requirement type="package" version="3.12.0">edger</requirement> + <requirement type="package" version="3.12.0">bioconductor-edger</requirement> + <requirement type="package" version="3.25.3">limma</requirement> + <requirement type="package" version="3.27.4">bioconductor-limma</requirement> + </requirements> + <stdio> + <exit_code range="1:"/> + </stdio> + <command><![CDATA[ + + ln -s "${matrix}" "input.matrix" + + && + + run_DE_analysis.pl + + --matrix "input.matrix" + + --samples_file "${samples}" + + --method ${method_choice.method} + + #if $method_choice.method == "edgeR": + --dispersion ${method_choice.edger_dispersion} + #end if + + #if $method_choice.method == "ROTS": + --ROTS_B ${method_choice.rots_b} + --ROTS_K ${method_choice.rots_k} + #end if + + --min_rowSum_counts ${additional_params.min_rowSum_counts} + + #if $additional_params.reference_sample: + --reference_sample ${additional_params.reference_sample} + #end if + + #if $additional_params.contrasts: + --contrasts ${additional_params.contrasts} + #end if + + --output results + + ]]></command> + <inputs> + <param format="tabular" name="matrix" type="data" label="Expression matrix" help="output of abundance_estimates_to_matrix tool"/> + <param format="tabular" name="samples" type="data" label="Sample description" help="file describing samples and replicates"/> + + <conditional name="method_choice"> + <param type="select" name="method" label="Differential analysis method"> + <option value="edgeR">edgeR</option> + <option value="DESeq2">DESeq2</option> + <option value="voom">voom</option> + <option value="ROTS">ROTS</option> + </param> + <when value="edgeR"> + <param name="edger_dispersion" type="float" value="0.1" label="edgeR dispersion value" help="Read edgeR manual to guide your value choice" /> + </when> + <when value="ROTS"> + <param name="rots_b" type="integer" value="500" label="number of bootstraps and permutation resampling" /> + <param name="rots_k" type="integer" value="5000" label="largest top genes size" /> + </when> + <when value="voom"> + </when> + <when value="DESeq2"> + </when> + </conditional> + + <section name="additional_params" title="Additional Options" expanded="False"> + <param name="min_rowSum_counts" type="integer" value="2" label="Minimum count" help="Only those rows of matrix meeting requirement will be tested"/> + <param name="reference_sample" type="text" optional="true" value="" label="Name of a sample to which all other samples should be compared" help="default is doing all pairwise-comparisons among samples"/> + <param format="tabular" name="contrasts" optional="true" type="data" label="Pairs of sample comparisons to perform" help="A 2-column tabular with lists of pairs of samples to compare"/> + </section> + </inputs> + <outputs> + <collection name="DE_results" type="list" label="Differential expression results on ${on_string}"> + <discover_datasets pattern="(?P<name>.+)\.DE_results" ext="tabular" directory="results" visible="true" /> + </collection> + <collection name="PDF_results" type="list" label="Differential expression plots on ${on_string}"> + <discover_datasets pattern="(?P<name>.+)\.pdf" ext="pdf" directory="results" visible="true" /> + </collection> + </outputs> + <tests> + <test> + <param name="matrix" value="count/qcheck/matrix.counts.matrix"/> + <param name="samples" value="count/samples.txt"/> + <param name="method" value="DESeq2"/> + <output_collection name="DE_results"> + <element name="input.matrix.wt_37_vs_wt_ph8.DESeq2" compare="sim_size" file="count/exp_diff/matrix.counts.matrix.wt_37_vs_wt_GSNO.DESeq2.DE_results"/> + <element name="input.matrix.wt_37_vs_wt_ph8.DESeq2" compare="sim_size" file="count/exp_diff/matrix.counts.matrix.wt_37_vs_wt_ph8.DESeq2.DE_results"/> + <element name="input.matrix.wt_GSNO_vs_wt_ph8.DESeq2" compare="sim_size" file="count/exp_diff/matrix.counts.matrix.wt_GSNO_vs_wt_ph8.DESeq2.DE_results"/> + </output_collection> + <output_collection name="PDF_results"> + <element name="input.matrix.wt_37_vs_wt_ph8.DESeq2.DE_results.MA_n_Volcano" compare="sim_size" delta="100" file="count/exp_diff/matrix.counts.matrix.wt_37_vs_wt_GSNO.DESeq2.DE_results.MA_n_Volcano.pdf"/> + <element name="input.matrix.wt_37_vs_wt_ph8.DESeq2.DE_results.MA_n_Volcano" compare="sim_size" delta="100" file="count/exp_diff/matrix.counts.matrix.wt_37_vs_wt_ph8.DESeq2.DE_results.MA_n_Volcano.pdf"/> + <element name="input.matrix.wt_GSNO_vs_wt_ph8.DESeq2.DE_results.MA_n_Volcano" compare="sim_size" delta="100" file="count/exp_diff/matrix.counts.matrix.wt_GSNO_vs_wt_ph8.DESeq2.DE_results.MA_n_Volcano.pdf"/> + </output_collection> + </test> + </tests> + <help> +<![CDATA[ +Trinity_ assembles transcript sequences from Illumina RNA-Seq data. +This tool performs differential expression analyses on a transcriptome assembled with Trinity. + +**Inputs** + +This tool uses the matrix produced by 'Build expression matrix for a de novo assembly of RNA-Seq data by Trinity' tool. + +You must describe your samples and replicates with a tabular file looking like this: + +=========== ================ +ConditionA CondA_replicate1 +----------- ---------------- +ConditionA CondA_replicate2 +----------- ---------------- +ConditionB CondB_replicate1 +----------- ---------------- +ConditionB CondB_replicate2 +----------- ---------------- +ConditionC CondC_replicate1 +----------- ---------------- +ConditionC CondC_replicate2 +----------- ---------------- +ConditionC CondC_replicate3 +=========== ================ + +It will probably be the same file as used in the tool 'RNASeq samples quality check for transcript quantification'. +The names in column 2 must match the names given in the tool 'Build expression matrix for a de novo assembly of RNA-Seq data by Trinity'. + + +.. _Trinity: http://trinityrnaseq.github.io +]]> + </help> + + <citations> + <citation type="doi">doi:10.1038/nbt.1883</citation> + </citations> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/samples_qccheck.xml Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,114 @@ +<tool id="samples_qccheck" name="RNASeq samples quality check" version="2.1.1"> + <description>for transcript quantification</description> + <requirements> + <requirement type="package" version="2.1.1">trinity</requirement> + <requirement type="package" version="2.30.0">bioconductor-biobase</requirement> + <requirement type="package" version="2.2.2">bioconductor-qvalue</requirement> + </requirements> + <stdio> + <exit_code range="1:"/> + </stdio> + <command><![CDATA[ + + ln -s "${matrix}" "input.matrix" + + && + + PtR + --matrix "input.matrix" + + --samples "${samples}" + + --CPM --log2 --compare_replicates + + && + + PtR + --matrix "input.matrix" + + --samples "${samples}" + + --CPM --log2 --sample_cor_matrix + + && + + PtR + --matrix "input.matrix" + + --samples "${samples}" + + --CPM --log2 --prin_comp 3 + + && mkdir out_pdf + && mv *rep_compare.pdf out_pdf/ + && mv *sample_cor_matrix.pdf out_pdf/ + && mv *principal_components.pdf out_pdf/ + + ]]></command> + <inputs> + <param format="tabular" name="matrix" type="data" label="Expression matrix" help="output of abundance_estimates_to_matrix tool"/> + <param format="tabular" name="samples" type="data" label="Samples description" help="file describing samples and replicates"/> + </inputs> + <outputs> + <collection name="reports" type="list" label="Quality check result files on ${on_string}"> + <discover_datasets pattern="__name__" ext="pdf" directory="out_pdf" visible="true" /> + </collection> + </outputs> + <tests> + <test> + <param name="matrix" value="count/qcheck/matrix.counts.matrix"/> + <param name="samples" value="count/samples.txt"/> + <output_collection name="reports"> + <element name="wt_37.rep_compare.pdf" compare="sim_size" delta="100" file="count/qcheck/wt_37.rep_compare.pdf"/> + <element name="wt_GSNO.rep_compare.pdf" compare="sim_size" delta="100" file="count/qcheck/wt_GSNO.rep_compare.pdf"/> + <element name="wt_ph8.rep_compare.pdf" compare="sim_size" delta="100" file="count/qcheck/wt_ph8.rep_compare.pdf"/> + <element name="input.matrix.minCol10.minRow10.CPM.log2.principal_components.pdf" compare="sim_size" delta="100" file="count/qcheck/matrix.counts.matrix.minCol10.minRow10.CPM.log2.principal_components.pdf"/> + <element name="input.matrix.minCol10.minRow10.CPM.log2.sample_cor_matrix.pdf" compare="sim_size" delta="100" file="count/qcheck/matrix.counts.matrix.minCol10.minRow10.CPM.log2.sample_cor_matrix.pdf"/> + </output_collection> + </test> + </tests> + <help> +<![CDATA[ +Trinity_ assembles transcript sequences from Illumina RNA-Seq data. +This tool performs some Quality Checks on a RNASeq experiment, analysing the abundance estimation for different samples using a transcriptome assembled with Trinity. + +**Inputs** + +This tool uses the matrix produced by 'Build expression matrix for a de novo assembly of RNA-Seq data by Trinity' tool. + +You must describe your samples and replicates with a tabular file looking like this: + +=========== ================ +ConditionA CondA_replicate1 +----------- ---------------- +ConditionA CondA_replicate2 +----------- ---------------- +ConditionB CondB_replicate1 +----------- ---------------- +ConditionB CondB_replicate2 +----------- ---------------- +ConditionC CondC_replicate1 +----------- ---------------- +ConditionC CondC_replicate2 +----------- ---------------- +ConditionC CondC_replicate3 +=========== ================ + +The names in column 2 must match the names given in the tool 'Build expression matrix for a de novo assembly of RNA-Seq data by Trinity'. + +**Output** + +This tool will produce several PDF files, see the following page for more information: + +.. _Trinity manual: https://github.com/trinityrnaseq/trinityrnaseq/wiki/QC-Samples-and-Replicates + + +.. _Trinity: http://trinityrnaseq.github.io +]]> + </help> + + <citations> + <citation type="doi">doi:10.1038/nbt.1883</citation> + </citations> +</tool> +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/exp_diff/matrix.counts.matrix.wt_37_vs_wt_GSNO.DESeq2.DE_results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,39 @@ +id baseMeanA baseMeanB baseMean log2FoldChange lfcSE stat pvalue padj +TR4277|c0_g1_i1 3852.97388871986 161.116814813422 2007.04535176664 -4.57259674791206 0.121601866332754 -37.6030145409076 0 0 +TR131|c0_g1_i1 26.1866396538608 1340.30918254958 683.247911101723 5.67372481552909 0.187406695960058 30.274931140872 2.45144211418965e-201 4.04487948841292e-200 +TR4761|c0_g1_i1 1645.20640957447 193.196157329029 919.201283451752 -3.08847487551254 0.143642016580712 -21.5011940728159 1.51733402752078e-102 1.66906743027286e-101 +TR3091|c0_g1_i1 16.7444693227929 328.569936894811 172.657203108802 4.29039998257063 0.240421038467916 17.8453599980735 3.14072644239509e-71 2.59109931497595e-70 +TR3638|c0_g1_i1 583.00358519031 183.754416330029 383.37900076017 -1.66018915730897 0.144484444213305 -11.4904352945982 1.47367477630653e-30 9.72625352362312e-30 +TR2487|c0_g1_i1 342.210853400436 920.407318992504 631.30908619647 1.42690938766606 0.124693202553469 11.4433614539188 2.5385551583546e-30 1.39620533709503e-29 +TR3788|c0_g1_i1 19.5075441237117 134.95369713876 77.2306206312357 2.77038513264018 0.262760026053246 10.5434040871909 5.44900939296595e-26 2.56881871382681e-25 +TR1479|c0_g1_i1 129.593534475689 371.064629188207 250.329081831948 1.51441163103673 0.145431922863633 10.4131995315551 2.1584296431011e-25 8.90352227779205e-25 +TR2107|c1_g1_i1 48.9228907410258 7.40521775805688 28.1640542495414 -2.6949883047084 0.431525668867458 -6.24525607429428 4.23106352657394e-10 1.55138995974378e-09 +TR3854|c0_g1_i1 1573.69549271337 2374.56159860719 1974.12854566028 0.593513416954248 0.111306645736399 5.33223701987958 9.70102011419466e-08 3.20133663768424e-07 +TR2122|c0_g2_i2 119.534640490118 199.143666337033 159.339153413576 0.738656537188098 0.168436715892782 4.38536534788702 1.15791268060543e-05 3.47373804181628e-05 +TR1449|c0_g1_i1 180.814952011467 104.755290736358 142.785121373912 -0.784194659361461 0.185749133486416 -4.2217944420118 2.42365089281258e-05 6.61949164163031e-05 +TR4163|c0_g1_i1 347.283468916919 232.772947466212 290.028208191566 -0.576744528291395 0.137147958253208 -4.20527243450891 2.60767852549073e-05 6.61949164163031e-05 +TR2672|c0_g1_i1 18.3155337236093 2.26581902751323 10.2906763755613 -2.88818323474529 0.724350842979802 -3.98727117216294 6.68376171815065e-05 0.000157545811927837 +TR127|c1_g1_i1 13.461799216177 1.21881296083961 7.34030608850831 -3.33218181130749 0.914685635912973 -3.64298036448506 0.000269499403689035 0.000576210779000196 +TR5055|c0_g2_i1 23.3590211688541 5.52768338415684 14.4433522765055 -2.04478780320925 0.562727305023446 -3.63370994255211 0.00027937492315161 0.000576210779000196 +TR2844|c0_g1_i1 158.206282615139 231.762548186068 194.984415400603 0.550641897280872 0.154759496937021 3.55804915484414 0.000373619406412113 0.000725261200682336 +TR5212|c0_g1_i1 65.7079302129484 107.875371765755 86.7916509893515 0.713884138135847 0.209708011296715 3.40418152707468 0.000663626354411326 0.00121664831642076 +TR1894|c2_g1_i1 13.3497721959996 2.96749216411516 8.15863218005739 -2.04982326482473 0.714661961266818 -2.8682417365424 0.00412760030232129 0.00716898999876856 +TR24|c0_g1_i1 69.9065207344592 41.2394742844514 55.5729975094553 -0.760369639593845 0.269117661787534 -2.8254170853868 0.00472191070589177 0.00779115266472142 +TR4669|c0_g2_i1 0 167.096667347181 83.5483336735905 4.37844609928899 2.00484514683835 2.18393231327309 0.0289672221614669 0.0455199205394479 +TR2779|c0_g1_i1 155.915506826481 205.619872596257 180.767689711369 0.402360429872658 0.188906223389576 2.12994798505331 0.0331759079102528 0.0497638618653791 +TR1492|c0_g1_i2 1640.89375005483 1435.64893261411 1538.27134133447 -0.192484740220531 0.101376439014472 -1.89871277874588 0.0576022504671541 0.0796285639028554 +TR3807|c0_g1_i1 3.48709246029019 0.350050334268211 1.9185713972792 -2.70461238638113 1.4262081182078 -1.89636586123194 0.0579116828384403 0.0796285639028554 +TR4084|c0_g1_i1 93.2264707954139 121.352438036668 107.289454416041 0.3802042378315 0.213056828958299 1.78452030704877 0.0743391580521785 0.0981276886288757 +TR1891|c0_g1_i1 107.628573623499 135.399287466928 121.513930545214 0.328806752550927 0.189034600977243 1.73939982866159 0.0819644583677276 0.104031812543654 +TR1837|c2_g1_i1 0.308903905435236 2.22601224010275 1.26745807276899 2.42365647560727 1.53486167088074 1.57907160077593 0.114319634794044 1 +TR5075|c0_g1_i1 15.8633018853512 9.23822794034992 12.5507649128506 -0.764079585128418 0.506894456921462 -1.50737411840904 0.131714788977897 0.158065100778825 +TR4859|c0_g1_i1 7.32690480813971 3.17910584569163 5.25300532691567 -1.18284590433612 0.789581441931072 -1.49806700299749 0.134115843085064 0.158065100778825 +TR939|c0_g1_i1 84.2568220960088 96.9171174594069 90.5869697777078 0.202696971338398 0.202184598546511 1.00253418309589 0.316085665578007 0.354180332604713 +TR2278|c0_g1_i1 486.5272515724 448.140178813055 467.333715192727 -0.118822731208233 0.119975347874694 -0.990392887481645 0.321982120549739 0.354180332604713 +TR2011|c5_g1_i1 5.60408627995835 7.88255079488408 6.74331853742122 0.488779860259128 0.689341019893534 0.70905378637502 0.478291099766969 0.509148590074515 +TR2182|c3_g2_i6 2.24974854180929 1.3031439398571 1.77644624083319 -0.780861388045469 1.28191780274725 -0.609135302101293 0.54243475986365 0.559385846109389 +TR3249|c0_g1_i1 1.12573841927462 2.128954842887 1.62734663108081 0.761533075632955 1.28978972955114 0.590431958159547 0.554901090261946 1 +TR1678|c0_g1_i1 0.595141051681226 0.700100668536423 0.647620860108824 0.247986780508542 1.73527723872539 0.142909026277954 0.886362029808798 1 +TR1122|c0_g1_i1 1.41370386226057 1.3031439398571 1.35842390105883 -0.16283641618004 1.43170451886811 -0.113736049606644 0.909447034479058 1 +TR1982|c2_g1_i1 5.73684100209948 5.71221669652109 5.72452884931028 0.0102126833240523 0.713573951255734 0.0143120181252136 0.988581051536513 0.988581051536513 +TR2090|c0_g1_i1 0 9.55638889228537 4.77819444614269 3.06235120305875 2.04796345977052 1.49531535264887 NA 1
Binary file test-data/count/exp_diff/matrix.counts.matrix.wt_37_vs_wt_GSNO.DESeq2.DE_results.MA_n_Volcano.pdf has changed
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/exp_diff/matrix.counts.matrix.wt_37_vs_wt_ph8.DESeq2.DE_results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,39 @@ +id baseMeanA baseMeanB baseMean log2FoldChange lfcSE stat pvalue padj +TR4277|c0_g1_i1 4705.34614971641 162.902721493704 2434.12443560506 -4.84860951090545 0.124597307945428 -38.9142397284305 0 0 +TR131|c0_g1_i1 32.0461070493257 1436.30905989883 734.177583474076 5.48367743370229 0.196017912869615 27.9753893581648 3.23827538807456e-172 6.15272323734167e-171 +TR4761|c0_g1_i1 2012.6141923276 384.620292965437 1198.61724264652 -2.38450946693381 0.143863830576436 -16.5747669680385 1.06073316501088e-61 1.34359534234711e-60 +TR3091|c0_g1_i1 20.4914097091341 321.651020117047 171.071214913091 3.96886910507283 0.256323110469072 15.4838519937191 4.45952081812589e-54 4.2365447772196e-53 +TR2779|c0_g1_i1 191.51955185349 1058.15934185376 624.839446853626 2.46616535412611 0.177102083131526 13.9251064161374 4.4587691300744e-44 3.38866453885655e-43 +TR1492|c0_g1_i2 2006.11782336441 890.823502721036 1448.47066304272 -1.17029110983798 0.12207086547883 -9.58698134274255 9.06997941755552e-22 5.74432029778516e-21 +TR5075|c0_g1_i1 19.3833722195684 136.98672801182 78.1850501156942 2.80049241151413 0.293976352213923 9.52625063350759 1.63066468983638e-21 8.85217974482605e-21 +TR1891|c0_g1_i1 131.416087212132 376.595292171713 254.005689691923 1.51493508389526 0.17090866237033 8.86400409952692 7.71909159725621e-19 3.6665685086967e-18 +TR2487|c0_g1_i1 418.818667162757 965.862817209246 692.340742186001 1.20547893236143 0.136832960243688 8.80985787499278 1.25304626500959e-18 5.29063978559604e-18 +TR3638|c0_g1_i1 713.131183384274 326.063958913919 519.597571149096 -1.1281436752687 0.141731779309567 -7.95970868893582 1.72444792020844e-15 6.55290209679206e-15 +TR2107|c1_g1_i1 59.5986596731862 1.89840873462066 30.7485342039034 -4.81058600791914 0.641850436461167 -7.49487066557473 6.63637683134955e-14 2.29256654173894e-13 +TR2122|c0_g2_i2 146.135958637131 360.821667264163 253.478812950647 1.30334955915215 0.177300500792357 7.35107658087526 1.96616724778278e-13 6.22619628464548e-13 +TR1479|c0_g1_i1 158.005105094407 334.827472148091 246.416288621249 1.07882286721986 0.173458235018578 6.2194963940704 4.98753084614221e-10 1.45789363194926e-09 +TR24|c0_g1_i1 85.6614643869141 199.923709280262 142.792586833588 1.22623657127381 0.213504266341901 5.74338205172044 9.2804014146814e-09 2.51896609827067e-08 +TR4163|c0_g1_i1 424.593720981574 227.471218917767 326.03246994967 -0.900786056392834 0.160721595544993 -5.60463609969988 2.08692952426197e-08 5.28688812813031e-08 +TR2278|c0_g1_i1 594.657329919233 348.341653317169 471.499491618201 -0.772446091346236 0.159105007190944 -4.85494520244241 1.20420038267752e-06 2.79113819122931e-06 +TR1449|c0_g1_i1 220.782434528097 117.26089394399 169.021664236043 -0.913694497348233 0.188477876305836 -4.84775462911953 1.24866708554995e-06 2.79113819122931e-06 +TR127|c1_g1_i1 16.3791628279609 1.58772512712498 8.98344397754296 -3.19771077466237 0.834376974262452 -3.83245328346816 0.00012687169720824 0.000267840249661839 +TR1894|c2_g1_i1 16.2826445742552 1.67571344127509 8.97917900776516 -3.15659686337855 0.834779400611257 -3.7813545244015 0.00015597736029041 0.000307529893573321 +TR5055|c0_g2_i1 28.6665933385886 6.05959103586122 17.3630921872249 -2.17768048931004 0.577307428800381 -3.77213314894485 0.000161857838722801 0.000307529893573321 +TR4084|c0_g1_i1 113.2594381118 173.837287636503 143.548362874151 0.609755827935052 0.219803235717165 2.7740985065373 0.00553549140639085 0.00984268771318224 +TR2090|c0_g1_i1 0 5.87877087384675 2.93938543692337 4.81114433617716 1.74023660764341 2.76464953963491 0.00569839814973709 0.00984268771318224 +TR1678|c0_g1_i1 0.738899982352077 7.85275634721875 4.29582816478541 3.12892233414853 1.14660116223239 2.72886722708063 0.00635522860739327 0.0104999429165628 +TR4859|c0_g1_i1 8.91205730249659 1.28188505334354 5.09697117792006 -2.61274053843141 0.973661400721484 -2.68341801009608 0.00728738414676855 0.0115383582323835 +TR2672|c0_g1_i1 22.3129914439134 7.89947501226409 15.1062332280887 -1.45907440559266 0.562189545530202 -2.59534247335852 0.0094496708578661 0.0143634997039565 +TR3807|c0_g1_i1 4.23896204531587 0.352255997713617 2.29560902151474 -3.05008419968594 1.43726100452922 -2.12215052803511 0.0338250994349076 0.0494366837894803 +TR3249|c0_g1_i1 1.36481976577862 4.37661229401476 2.87071602989669 1.51948727816201 1.15409756308282 1.31660210260141 0.187972033660362 0.255148785128113 +TR1859|c3_g1_i1 0.361569353912422 2.25550826604853 1.30853880998047 2.09887277242766 1.59427549709957 1.31650569568817 0.188004367989136 0.255148785128113 +TR1982|c2_g1_i1 7.00144976454503 11.520013112092 9.26073143831853 0.70490953188932 0.647715898283926 1.0883004937148 0.276462472665158 0.362261171078483 +TR3854|c0_g1_i1 1925.26464813324 2107.16376011081 2016.21420412203 0.130534071096341 0.124633726123269 1.04734147936199 0.29494211171073 0.373593341500258 +TR5212|c0_g1_i1 80.2050001877881 94.8352723753388 87.5201362815635 0.236773654582184 0.240888724170321 0.982917134862537 0.325648223857982 0.399181693761397 +TR1837|c2_g1_i1 0.377330628439655 1.67813520813222 1.02773291828594 1.63744709452968 1.70484764845029 0.960465350682869 0.336821061516539 0.39997501055089 +TR2844|c0_g1_i1 193.030766468894 213.82243412349 203.426600296192 0.144163413939115 0.182129405153131 0.791543868591151 0.428626687374099 0.493570124855023 +TR1122|c0_g1_i1 1.69354093201913 0.660517838352177 1.17702938518565 -1.10951489814723 1.57444243758247 -0.704703374135971 0.48099485111646 0.537582480659573 +TR2011|c5_g1_i1 6.84875389533898 4.81927837273561 5.8340161340373 -0.467994718304978 0.83497566164615 -0.560489053516039 0.575145904101733 0.62444412445331 +TR2182|c3_g2_i6 2.76248771922916 1.94482465855284 2.353656188891 -0.463555959442342 1.17585679724627 -0.394228243207794 0.69341253558072 0.731935454224094 +TR3788|c0_g1_i1 23.7579432209456 26.0024682525169 24.8802057367313 0.125242792795277 0.407913046833573 0.307033064442226 0.75881820512208 0.779326805260514 +TR939|c0_g1_i1 103.002135647151 102.820214322362 102.911174984756 -0.00127076378479059 0.216917077821033 -0.00585829293643274 0.995325785249569 0.995325785249569
Binary file test-data/count/exp_diff/matrix.counts.matrix.wt_37_vs_wt_ph8.DESeq2.DE_results.MA_n_Volcano.pdf has changed
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/exp_diff/matrix.counts.matrix.wt_GSNO_vs_wt_ph8.DESeq2.DE_results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,40 @@ +id baseMeanA baseMeanB baseMean log2FoldChange lfcSE stat pvalue padj +TR2779|c0_g1_i1 195.849684476753 966.924129135581 581.386906806167 2.25621220756415 0.156114979193812 14.4522467940961 2.42639762934434e-47 5.82335431042642e-46 +TR1891|c0_g1_i1 128.246229498835 343.028289972482 235.637259735659 1.40479466067472 0.104376051709838 13.4589749052781 2.72672776456232e-41 3.27207331747478e-40 +TR4761|c0_g1_i1 184.029205648389 351.782300021135 267.905752834762 0.934185686537064 0.0945413616088594 9.88123791152932 5.0208774429335e-23 4.0167019543468e-22 +TR24|c0_g1_i1 39.3724575919554 183.288101009647 111.330279300801 2.11680322693425 0.240338854880295 8.80757806717753 1.27878744153922e-18 7.67272464923531e-18 +TR3638|c0_g1_i1 174.266398355818 297.555274221606 235.910836288712 0.75598517202537 0.0975355931355663 7.75086455848598 9.12689947000201e-15 3.81892706573808e-14 +TR2122|c0_g2_i2 190.673533226329 328.707071692642 259.690302459485 0.782528370953275 0.101034702024136 7.74514454218254 9.54731766434521e-15 3.81892706573808e-14 +TR2278|c0_g1_i1 426.804298570637 315.99710709695 371.400702833793 -0.429046906426044 0.106511998284025 -4.02815563822158 5.62161256784655e-05 0.000192741002326167 +TR4084|c0_g1_i1 115.544575735664 157.970364768418 136.757470252041 0.435378746345168 0.157905703989027 2.75720721510747 0.00582973950434901 0.017489218513047 +TR3788|c0_g1_i1 128.115824993653 24.010679388938 76.0632521912957 -1.20076602288383 0.555078500739638 -2.16323640941564 0.0305230012251409 0.0813946699337092 +TR1678|c0_g1_i1 0.695005959508731 7.10082184137838 3.89791390044355 1.13542782611345 0.54389306361848 2.08759387104432 0.0368344853417399 1 +TR1859|c3_g1_i1 0 2.05957798928713 1.02978899464357 1.08547672488113 0.52169423531112 2.08067609609255 0.0374635634690378 1 +TR1479|c0_g1_i1 353.92669362375 305.546165789569 329.736429706659 -0.210273055725041 0.101401657889395 -2.07366487000044 0.0381104459877385 0.0914650703705724 +TR1492|c0_g1_i2 1368.89238848897 813.514514376559 1091.20345143276 -0.673957173112486 0.33643480733027 -2.00323259790084 0.0451523282811554 0.0985141707952481 +TR2844|c0_g1_i1 220.566338218013 194.214843050373 207.390590634193 -0.1851823349888 0.101213323108161 -1.8296240979155 0.0673061677634479 0.134612335526896 +TR5075|c0_g1_i1 8.81552188359314 126.23137395943 67.5234479215117 0.86620707327725 0.498591364017662 1.73730861741634 0.0823327113057556 0.151998851641395 +TR2107|c1_g1_i1 7.08292121571621 1.78415791317121 4.43353956444371 -0.87765751535477 0.553196716703176 -1.58651974759584 0.112621456124343 1 +TR2672|c0_g1_i1 2.07518941673641 7.44710458698621 4.76114700186131 0.652733502871168 0.537764458916032 1.21379070715621 0.224827655823799 1 +TR4859|c0_g1_i1 3.10763825129944 1.1806627783491 2.14415051482427 -0.587630876626665 0.551071114588281 -1.06634309269812 0.28626857627862 1 +TR3091|c0_g1_i1 312.47018793986 293.531643106953 303.000915523406 -0.0879738435317154 0.0902971665647824 -0.97427025540829 0.329922369379669 0.501282895914669 +TR4163|c0_g1_i1 221.469120691076 207.118822998308 214.293971844692 -0.0959599050588562 0.0987561344325879 -0.97168551209707 0.331207026506115 0.501282895914669 +TR4669|c0_g2_i1 165.630009730314 0 82.8150048651569 -0.322459466822447 0.333908718519009 -0.965711432311973 0.334188597276446 0.501282895914669 +TR1894|c2_g1_i1 2.85762748931802 1.47338219762144 2.16550484346973 -0.426208431542948 0.551264679640795 -0.773146634064541 0.439435604855973 1 +TR3249|c0_g1_i1 2.06512931203634 4.15451161800812 3.10982046502223 0.3941103325595 0.539435464341514 0.730597742661558 0.465024891244583 1 +TR5212|c0_g1_i1 102.736339436612 86.4452993262187 94.5908193814151 -0.222704356323449 0.346653224187607 -0.642441324021618 0.520586675617895 0.734945894989969 +TR1122|c0_g1_i1 1.29006258579706 0.5946183773076 0.942340481552333 -0.302591524122929 0.512417527863229 -0.590517512905403 0.554843748171664 1 +TR2011|c5_g1_i1 7.597917075274 4.42090354598533 6.00941031062966 -0.246737820349972 0.517913150509813 -0.476407714511773 0.633783939711306 1 +TR1837|c2_g1_i1 2.16507864525674 1.46465683073113 1.81486773799393 -0.235474161889615 0.546181064177423 -0.431128388246582 0.666375020163124 1 +TR2182|c3_g2_i6 1.29006258579706 1.76655578876639 1.52830918728173 0.209843639881372 0.537581597903129 0.390347513195914 0.696279593847798 1 +TR1449|c0_g1_i1 98.9943307118646 106.843279101242 102.918804906553 0.100194141469895 0.276715374273995 0.362083753867198 0.717289443676285 0.9108498942696 +TR4277|c0_g1_i1 153.969096204861 149.159426886469 151.564261545665 -0.0459267760105497 0.128823197370029 -0.356510139075578 0.721458560376159 0.9108498942696 +TR1982|c2_g1_i1 5.5352448786851 10.687042573374 8.11114372602957 0.110416157924497 0.359967068804195 0.306739608962835 0.759041578558 0.9108498942696 +TR127|c1_g1_i1 1.20754470361908 1.49113571265046 1.34934020813477 0.142968860758062 0.541343527667515 0.26410006484066 0.791702813929264 1 +TR3854|c0_g1_i1 2260.55060252051 1927.46472630351 2094.00766441201 -0.135348942475858 0.546438760787258 -0.247692792291784 0.804372109047297 0.919282410339768 +TR2090|c0_g1_i1 9.46045896251181 5.6546754787973 7.55756722065455 -0.0586395744056909 0.302337767579782 -0.193953851267414 0.846212017000596 1 +TR3807|c0_g1_i1 0.347502979754365 0.292870809896544 0.320186894825454 -0.0640837282416973 0.445995787050203 -0.143686846608001 0.885747758296628 1 +TR131|c0_g1_i1 1275.67603302799 1312.2934796972 1293.9847563626 0.0343724958045096 0.405262489992082 0.0848153891695754 0.932408158838271 0.963782835492881 +TR5055|c0_g2_i1 5.17791343714095 5.60171771495863 5.38981557604979 0.043552763660028 0.53975688204026 0.0806895939805349 0.935688812631814 1 +TR939|c0_g1_i1 92.2508462008296 94.0990807885678 93.1749634946987 0.0253693962827489 0.353966153466169 0.0716718139130601 0.942863087697354 0.963782835492881 +TR2487|c0_g1_i1 875.181494043204 882.631049341941 878.906271692572 0.0115839334384507 0.255112918612705 0.0454070828770402 0.963782835492881 0.963782835492881
Binary file test-data/count/exp_diff/matrix.counts.matrix.wt_GSNO_vs_wt_ph8.DESeq2.DE_results.MA_n_Volcano.pdf has changed
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/express_bowtie/results.xprs Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +bundle_id target_id length eff_length tot_counts uniq_counts est_counts eff_counts ambig_distr_alpha ambig_distr_beta fpkm fpkm_conf_low fpkm_conf_high solvable tpm +1 TRINITY_DN2_c3_g1_i1 202 0.000000 0 0 0.000000 0.000000 0.000000e00 0.000000e00 0.000000e00 0.000000e00 0.000000e00 F 0.000000e+00 +2 TRINITY_DN1_c0_g1_i1 380 109.247050 5 5 5.000000 17.391774 0.000000e00 0.000000e00 4.160711e06 4.160711e06 4.160711e06 T 6.610131e+05 +3 TRINITY_DN2_c0_g1_i1 279 0.000000 0 0 0.000000 0.000000 0.000000e00 0.000000e00 0.000000e00 0.000000e00 0.000000e00 F 0.000000e+00 +4 TRINITY_DN0_c0_g1_i1 229 0.000000 0 0 0.000000 0.000000 0.000000e00 0.000000e00 0.000000e00 0.000000e00 0.000000e00 F 0.000000e+00 +5 TRINITY_DN2_c1_g1_i1 541 259.008053 5 5 5.000000 10.443691 0.000000e00 0.000000e00 1.754947e06 1.754947e06 1.754947e06 T 2.788088e+05 +6 TRINITY_DN2_c2_g1_i1 240 240.000000 1 1 1.000000 1.000000 0.000000e00 0.000000e00 3.787879e05 3.787879e05 3.787879e05 T 6.017811e+04 +7 TRINITY_DN3_c0_g1_i1 216 0.000000 0 0 0.000000 0.000000 0.000000e00 0.000000e00 0.000000e00 0.000000e00 0.000000e00 F 0.000000e+00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/express_bowtie/results.xprs.genes Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +bundle_id target_id length eff_length tot_counts uniq_counts est_counts eff_counts ambig_distr_alpha ambig_distr_beta fpkm fpkm_conf_low fpkm_conf_high solvable tpm +NA TRINITY_DN3_c0_g1 216.00 1.00 NA NA NA 0.00 NA NA 0.00 NA NA NA 0 +NA TRINITY_DN2_c2_g1 240.00 240.00 NA NA NA 1.00 NA NA 378787.90 NA NA NA 60178.11 +NA TRINITY_DN2_c3_g1 202.00 1.00 NA NA NA 0.00 NA NA 0.00 NA NA NA 0 +NA TRINITY_DN0_c0_g1 229.00 1.00 NA NA NA 0.00 NA NA 0.00 NA NA NA 0 +NA TRINITY_DN2_c0_g1 279.00 1.00 NA NA NA 0.00 NA NA 0.00 NA NA NA 0 +NA TRINITY_DN1_c0_g1 380.00 109.25 NA NA NA 17.39 NA NA 4160711.00 NA NA NA 661013.1 +NA TRINITY_DN2_c1_g1 541.00 259.01 NA NA NA 10.44 NA NA 1754947.00 NA NA NA 278808.8
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/express_bowtie/results_B.xprs Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +bundle_id target_id length eff_length tot_counts uniq_counts est_counts eff_counts ambig_distr_alpha ambig_distr_beta fpkm fpkm_conf_low fpkm_conf_high solvable tpm +1 TRINITY_DN0_c0_g1_i1 380 109.247050 5 5 5.000000 17.391774 0.000000e+00 0.000000e+00 4.160711e+06 4.160711e+06 4.160711e+06 T 6.610131e+05 +2 TRINITY_DN2_c0_g1_i1 279 0.000000 0 0 0.000000 0.000000 0.000000e+00 0.000000e+00 0.000000e+00 0.000000e+00 0.000000e+00 F 0.000000e+00 +3 TRINITY_DN2_c1_g1_i1 240 240.000000 1 1 1.000000 1.000000 0.000000e+00 0.000000e+00 3.787879e+05 3.787879e+05 3.787879e+05 T 6.017811e+04 +4 TRINITY_DN1_c0_g1_i1 229 0.000000 0 0 0.000000 0.000000 0.000000e+00 0.000000e+00 0.000000e+00 0.000000e+00 0.000000e+00 F 0.000000e+00 +5 TRINITY_DN3_c0_g1_i1 216 0.000000 0 0 0.000000 0.000000 0.000000e+00 0.000000e+00 0.000000e+00 0.000000e+00 0.000000e+00 F 0.000000e+00 +6 TRINITY_DN2_c3_g1_i1 202 0.000000 0 0 0.000000 0.000000 0.000000e+00 0.000000e+00 0.000000e+00 0.000000e+00 0.000000e+00 F 0.000000e+00 +7 TRINITY_DN2_c2_g1_i1 541 259.008053 5 5 5.000000 10.443691 0.000000e+00 0.000000e+00 1.754947e+06 1.754947e+06 1.754947e+06 T 2.788088e+05
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/express_bowtie/results_B.xprs.genes Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +bundle_id target_id length eff_length tot_counts uniq_counts est_counts eff_counts ambig_distr_alpha ambig_distr_beta fpkm fpkm_conf_low fpkm_conf_high solvable tpm +NA TRINITY_DN3_c0_g1 216.00 1.00 NA NA NA 0.00 NA NA 0.00 NA NA NA 0 +NA TRINITY_DN2_c1_g1 240.00 240.00 NA NA NA 1.00 NA NA 378787.90 NA NA NA 60178.11 +NA TRINITY_DN2_c3_g1 202.00 1.00 NA NA NA 0.00 NA NA 0.00 NA NA NA 0 +NA TRINITY_DN0_c0_g1 380.00 109.25 NA NA NA 17.39 NA NA 4160711.00 NA NA NA 661013.1 +NA TRINITY_DN1_c0_g1 229.00 1.00 NA NA NA 0.00 NA NA 0.00 NA NA NA 0 +NA TRINITY_DN2_c0_g1 279.00 1.00 NA NA NA 0.00 NA NA 0.00 NA NA NA 0 +NA TRINITY_DN2_c2_g1 541.00 259.01 NA NA NA 10.44 NA NA 1754947.00 NA NA NA 278808.8
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_express_bowtie/matrix.TMM.EXPR.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN2_c1_g1_i1 278808.8 60178.11 +TRINITY_DN1_c0_g1_i1 0 0 +TRINITY_DN2_c2_g1_i1 60178.11 278808.8 +TRINITY_DN2_c0_g1_i1 0 0 +TRINITY_DN3_c0_g1_i1 0 0 +TRINITY_DN2_c3_g1_i1 0 0 +TRINITY_DN0_c0_g1_i1 661013.1 661013.1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_express_bowtie/matrix.TPM.not_cross_norm Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN2_c1_g1_i1 278808.8 60178.11 +TRINITY_DN1_c0_g1_i1 0 0 +TRINITY_DN2_c2_g1_i1 60178.11 278808.8 +TRINITY_DN2_c0_g1_i1 0 0 +TRINITY_DN3_c0_g1_i1 0 0 +TRINITY_DN2_c3_g1_i1 0 0 +TRINITY_DN0_c0_g1_i1 661013.1 661013.1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_express_bowtie/matrix.counts.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN2_c1_g1_i1 10.443691 1.000000 +TRINITY_DN1_c0_g1_i1 0.000000 0.000000 +TRINITY_DN2_c2_g1_i1 1.000000 10.443691 +TRINITY_DN2_c0_g1_i1 0.000000 0.000000 +TRINITY_DN3_c0_g1_i1 0.000000 0.000000 +TRINITY_DN2_c3_g1_i1 0.000000 0.000000 +TRINITY_DN0_c0_g1_i1 17.391774 17.391774
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie/matrix.TMM.EXPR.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0 0 +TRINITY_DN4_c0_g1 0 0 +TRINITY_DN0_c0_g1 331152.79 331152.79 +TRINITY_DN2_c0_g1 0 0 +TRINITY_DN3_c2_g1 524034.76 144812.45 +TRINITY_DN3_c1_g1 144812.45 524034.76 +TRINITY_DN3_c3_g1 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie/matrix.TPM.not_cross_norm Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0 0 +TRINITY_DN4_c0_g1 0 0 +TRINITY_DN0_c0_g1 331152.79 331152.79 +TRINITY_DN2_c0_g1 0 0 +TRINITY_DN3_c2_g1 524034.76 144812.45 +TRINITY_DN3_c1_g1 144812.45 524034.76 +TRINITY_DN3_c3_g1 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie/matrix.counts.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0.00 0.00 +TRINITY_DN4_c0_g1 0.00 0.00 +TRINITY_DN0_c0_g1 5.00 5.00 +TRINITY_DN2_c0_g1 0.00 0.00 +TRINITY_DN3_c2_g1 1.00 5.00 +TRINITY_DN3_c1_g1 5.00 1.00 +TRINITY_DN3_c3_g1 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie2/matrix.TMM.EXPR.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0 0 +TRINITY_DN2_c2_g1 529174.03 161779.66 +TRINITY_DN2_c3_g1 0 0 +TRINITY_DN0_c0_g1 309046.31 309046.31 +TRINITY_DN2_c0_g1 0 0 +TRINITY_DN1_c0_g1 0 0 +TRINITY_DN2_c1_g1 161779.66 529174.03
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie2/matrix.TPM.not_cross_norm Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0 0 +TRINITY_DN2_c2_g1 529174.03 161779.66 +TRINITY_DN2_c3_g1 0 0 +TRINITY_DN0_c0_g1 309046.31 309046.31 +TRINITY_DN2_c0_g1 0 0 +TRINITY_DN1_c0_g1 0 0 +TRINITY_DN2_c1_g1 161779.66 529174.03
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie2/matrix.counts.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0.00 0.00 +TRINITY_DN2_c2_g1 1.00 6.00 +TRINITY_DN2_c3_g1 0.00 0.00 +TRINITY_DN0_c0_g1 5.00 5.00 +TRINITY_DN2_c0_g1 0.00 0.00 +TRINITY_DN1_c0_g1 0.00 0.00 +TRINITY_DN2_c1_g1 6.00 1.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie_UpperQuartile/matrix.TPM.not_cross_norm Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0 0 +TRINITY_DN4_c0_g1 0 0 +TRINITY_DN0_c0_g1 331152.79 331152.79 +TRINITY_DN2_c0_g1 0 0 +TRINITY_DN3_c2_g1 524034.76 144812.45 +TRINITY_DN3_c1_g1 144812.45 524034.76 +TRINITY_DN3_c3_g1 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie_UpperQuartile/matrix.TPM.not_cross_norm.upper_quartile_norm.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +RSEM RSEM.isoforms_B.results +TRINITY_DN3_c2_g1_i1 524034.76 144812.45 +TRINITY_DN4_c0_g1_i1 0 0 +TRINITY_DN3_c3_g1_i1 0 0 +TRINITY_DN3_c1_g1_i1 144812.45 524034.76 +TRINITY_DN2_c0_g1_i1 0 0 +TRINITY_DN3_c0_g1_i1 0 0 +TRINITY_DN0_c0_g1_i1 331152.79 331152.79
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie_UpperQuartile/matrix.counts.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0.00 0.00 +TRINITY_DN4_c0_g1 0.00 0.00 +TRINITY_DN0_c0_g1 5.00 5.00 +TRINITY_DN2_c0_g1 0.00 0.00 +TRINITY_DN3_c2_g1 1.00 5.00 +TRINITY_DN3_c1_g1 5.00 1.00 +TRINITY_DN3_c3_g1 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie_none/matrix.TPM.not_cross_norm Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0 0 +TRINITY_DN4_c0_g1 0 0 +TRINITY_DN0_c0_g1 331152.79 331152.79 +TRINITY_DN2_c0_g1 0 0 +TRINITY_DN3_c2_g1 524034.76 144812.45 +TRINITY_DN3_c1_g1 144812.45 524034.76 +TRINITY_DN3_c3_g1 0 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/matrix_rsem_bowtie_none/matrix.counts.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ + sample_A.tsv sample_B.tsv +TRINITY_DN3_c0_g1 0.00 0.00 +TRINITY_DN4_c0_g1 0.00 0.00 +TRINITY_DN0_c0_g1 5.00 5.00 +TRINITY_DN2_c0_g1 0.00 0.00 +TRINITY_DN3_c2_g1 1.00 5.00 +TRINITY_DN3_c1_g1 5.00 1.00 +TRINITY_DN3_c3_g1 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/qcheck/matrix.counts.matrix Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,41 @@ + wt_37_2 wt_37_3 wt_37_1 wt_GSNO_3 wt_GSNO_1 wt_GSNO_2 wt_ph8_3 wt_ph8_1 wt_ph8_2 +TR24|c0_g1_i1 90.00 67.00 85.00 36.00 35.00 34.00 222.00 196.00 201.00 +TR2779|c0_g1_i1 186.00 137.00 217.00 147.00 186.00 197.00 1088.00 1094.00 1086.00 +TR127|c1_g1_i1 9.00 23.00 16.00 2.00 0.00 1.00 3.00 1.00 1.00 +TR2107|c1_g1_i1 59.00 65.00 47.00 6.00 6.00 7.00 3.00 1.00 2.00 +TR2011|c5_g1_i1 11.00 4.00 4.00 8.00 5.00 7.00 3.00 4.00 8.00 +TR4163|c0_g1_i1 368.00 422.00 425.00 172.00 216.00 210.00 234.00 254.00 212.00 +TR5055|c0_g2_i1 36.00 17.00 27.00 4.00 7.00 3.00 4.00 4.00 11.00 +TR1449|c0_g1_i1 196.00 230.00 207.00 66.00 113.00 91.00 124.00 130.00 107.00 +TR1982|c2_g1_i1 7.00 7.00 6.00 4.00 3.00 8.00 16.00 9.00 11.00 +TR1859|c3_g1_i1 0.00 0.00 1.00 0.00 0.00 0.00 1.00 2.00 4.00 +TR1492|c0_g1_i2 1895.00 1906.00 1921.00 1104.00 1263.00 1319.00 899.00 929.00 922.00 +TR1122|c0_g1_i1 2.00 3.00 0.00 3.00 0.00 0.00 1.00 1.00 0.00 +TR2278|c0_g1_i1 497.00 610.00 598.00 333.00 406.00 413.00 323.00 409.00 337.00 +TR4084|c0_g1_i1 95.00 148.00 86.00 77.00 111.00 127.00 175.00 201.00 158.00 +TR4761|c0_g1_i1 2089.00 1746.00 1875.00 155.00 174.00 165.00 394.00 389.00 406.00 +TR3638|c0_g1_i1 647.00 676.00 712.00 117.00 184.00 174.00 324.00 344.00 338.00 +TR2090|c0_g1_i1 0.00 0.00 0.00 22.00 0.00 0.02 10.33 0.00 9.09 +TR3854|c0_g1_i1 1878.00 1734.00 1864.00 1775.00 2173.00 2151.00 2216.00 2142.00 2155.00 +TR131|c0_g1_i1 32.00 28.00 31.00 1001.00 1233.00 1208.00 1486.00 1492.00 1457.00 +TR5075|c0_g1_i1 13.00 22.00 21.00 6.00 8.00 10.00 163.00 121.00 142.00 +TR2182|c3_g2_i6 1.44 2.70 3.84 3.35 0.00 0.00 1.22 2.18 2.63 +TR3788|c0_g1_i1 17.00 30.00 22.00 91.00 132.00 125.00 32.00 22.00 27.00 +TR4859|c0_g1_i1 6.00 12.00 8.00 4.00 1.00 3.00 1.00 1.00 2.00 +TR2487|c0_g1_i1 386.00 383.00 424.00 689.00 866.00 806.00 963.00 989.00 1032.00 +TR2122|c0_g2_i2 145.00 135.00 136.00 155.00 157.00 201.00 369.00 398.00 344.00 +TR4277|c0_g1_i1 4466.00 4701.00 4284.00 118.00 134.00 164.00 172.00 162.00 170.00 +TR4669|c0_g2_i1 0.00 0.00 0.00 209.00 0.00 217.50 0.14 0.06 0.18 +TR3091|c0_g1_i1 22.00 17.00 19.00 250.00 308.00 284.00 333.00 343.00 316.00 +TR2130|c1_g3_i1 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 +TR3807|c0_g1_i1 6.00 4.00 2.00 0.00 0.00 1.00 0.00 1.00 0.00 +TR1894|c2_g1_i1 21.00 14.00 11.00 1.00 2.00 5.00 1.00 3.00 1.00 +TR5212|c0_g1_i1 64.00 89.00 78.00 73.00 98.00 108.00 103.00 105.00 84.00 +TR939|c0_g1_i1 96.00 99.00 99.00 72.00 89.00 88.00 107.00 103.00 108.00 +TR1891|c0_g1_i1 115.00 137.96 124.00 96.53 139.00 110.94 364.77 411.00 384.00 +TR2672|c0_g1_i1 14.00 29.00 22.00 0.00 4.00 2.00 14.00 4.00 7.00 +TR2844|c0_g1_i1 166.00 211.00 178.00 161.00 214.00 223.00 199.00 245.00 213.00 +TR1837|c2_g1_i1 1.00 0.00 0.00 1.00 1.00 4.00 0.00 3.00 2.00 +TR1678|c0_g1_i1 1.00 0.00 1.00 0.00 0.00 2.00 8.00 10.00 6.00 +TR3249|c0_g1_i1 1.00 2.00 1.00 4.00 1.00 0.00 6.00 1.00 7.00 +TR1479|c0_g1_i1 136.00 178.00 141.00 277.00 324.00 354.00 367.00 363.00 302.00
Binary file test-data/count/qcheck/matrix.counts.matrix.minCol10.minRow10.CPM.log2.principal_components.pdf has changed
Binary file test-data/count/qcheck/matrix.counts.matrix.minCol10.minRow10.CPM.log2.sample_cor_matrix.pdf has changed
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/rsem_bowtie/RSEM.genes.results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +gene_id transcript_id(s) length effective_length expected_count TPM FPKM +TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i1 229.00 11.55 0.00 0.00 0.00 +TRINITY_DN1_c0_g1 TRINITY_DN1_c0_g1_i1 380.00 123.91 5.00 329523.81 3668378.58 +TRINITY_DN2_c0_g1 TRINITY_DN2_c0_g1_i1 279.00 35.45 0.00 0.00 0.00 +TRINITY_DN2_c1_g1 TRINITY_DN2_c1_g1_i1 541.00 281.27 5.00 145165.14 1616031.03 +TRINITY_DN2_c2_g1 TRINITY_DN2_c2_g1_i1 240.00 15.55 1.00 525311.05 5847953.22 +TRINITY_DN2_c3_g1 TRINITY_DN2_c3_g1_i1 202.00 3.45 0.00 0.00 0.00 +TRINITY_DN3_c0_g1 TRINITY_DN3_c0_g1_i1 216.00 6.82 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/rsem_bowtie/RSEM.genes_B.results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +gene_id transcript_id(s) length effective_length expected_count TPM FPKM +TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i1 229.00 11.55 0.00 0.00 0.00 +TRINITY_DN1_c0_g1 TRINITY_DN1_c0_g1_i1 380.00 123.91 5.00 329523.81 3668378.58 +TRINITY_DN2_c0_g1 TRINITY_DN2_c0_g1_i1 279.00 35.45 0.00 0.00 0.00 +TRINITY_DN2_c2_g1 TRINITY_DN2_c2_g1_i1 541.00 281.27 5.00 145165.14 1616031.03 +TRINITY_DN2_c1_g1 TRINITY_DN2_c1_g1_i1 240.00 15.55 1.00 525311.05 5847953.22 +TRINITY_DN2_c3_g1 TRINITY_DN2_c3_g1_i1 202.00 3.45 0.00 0.00 0.00 +TRINITY_DN3_c0_g1 TRINITY_DN3_c0_g1_i1 216.00 6.82 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/rsem_bowtie/RSEM.isoforms.results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +transcript_id gene_id length effective_length expected_count TPM FPKM IsoPct +TRINITY_DN0_c0_g1_i1 TRINITY_DN0_c0_g1 229 11.55 0.00 0.00 0.00 0.00 +TRINITY_DN1_c0_g1_i1 TRINITY_DN1_c0_g1 380 123.91 5.00 329523.81 3668378.58 100.00 +TRINITY_DN2_c0_g1_i1 TRINITY_DN2_c0_g1 279 35.45 0.00 0.00 0.00 0.00 +TRINITY_DN2_c1_g1_i1 TRINITY_DN2_c1_g1 541 281.27 5.00 145165.14 1616031.03 100.00 +TRINITY_DN2_c2_g1_i1 TRINITY_DN2_c2_g1 240 15.55 1.00 525311.05 5847953.22 100.00 +TRINITY_DN2_c3_g1_i1 TRINITY_DN2_c3_g1 202 3.45 0.00 0.00 0.00 0.00 +TRINITY_DN3_c0_g1_i1 TRINITY_DN3_c0_g1 216 6.82 0.00 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/rsem_bowtie/RSEM.isoforms_B.results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +transcript_id gene_id length effective_length expected_count TPM FPKM IsoPct +TRINITY_DN0_c0_g1_i1 TRINITY_DN0_c0_g1 229 11.55 0.00 0.00 0.00 0.00 +TRINITY_DN1_c0_g1_i1 TRINITY_DN1_c0_g1 380 123.91 5.00 329523.81 3668378.58 100.00 +TRINITY_DN2_c0_g1_i1 TRINITY_DN2_c0_g1 279 35.45 0.00 0.00 0.00 0.00 +TRINITY_DN2_c2_g1_i1 TRINITY_DN2_c2_g1 541 281.27 5.00 145165.14 1616031.03 100.00 +TRINITY_DN2_c1_g1_i1 TRINITY_DN2_c1_g1 240 15.55 1.00 525311.05 5847953.22 100.00 +TRINITY_DN2_c3_g1_i1 TRINITY_DN2_c3_g1 202 3.45 0.00 0.00 0.00 0.00 +TRINITY_DN3_c0_g1_i1 TRINITY_DN3_c0_g1 216 6.82 0.00 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/rsem_bowtie2/RSEM.genes.results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +gene_id transcript_id(s) length effective_length expected_count TPM FPKM +TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i1 229.00 10.58 0.00 0.00 0.00 +TRINITY_DN1_c0_g1 TRINITY_DN1_c0_g1_i1 380.00 122.00 5.00 309046.31 3415300.55 +TRINITY_DN2_c0_g1 TRINITY_DN2_c0_g1_i1 279.00 32.50 0.00 0.00 0.00 +TRINITY_DN2_c1_g1 TRINITY_DN2_c1_g1_i1 541.00 279.67 6.00 161779.66 1787842.67 +TRINITY_DN2_c2_g1 TRINITY_DN2_c2_g1_i1 240.00 14.25 1.00 529174.03 5847953.22 +TRINITY_DN2_c3_g1 TRINITY_DN2_c3_g1_i1 202.00 3.17 0.00 0.00 0.00 +TRINITY_DN3_c0_g1 TRINITY_DN3_c0_g1_i1 216.00 6.25 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/rsem_bowtie2/RSEM.genes_B.results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +gene_id transcript_id(s) length effective_length expected_count TPM FPKM +TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i1 380.00 122.00 5.00 309046.31 3415300.55 +TRINITY_DN1_c0_g1 TRINITY_DN1_c0_g1_i1 229.00 10.58 0.00 0.00 0.00 +TRINITY_DN2_c0_g1 TRINITY_DN2_c0_g1_i1 279.00 32.50 0.00 0.00 0.00 +TRINITY_DN2_c2_g1 TRINITY_DN2_c2_g1_i1 541.00 279.67 6.00 161779.66 1787842.67 +TRINITY_DN2_c1_g1 TRINITY_DN2_c1_g1_i1 240.00 14.25 1.00 529174.03 5847953.22 +TRINITY_DN2_c3_g1 TRINITY_DN2_c3_g1_i1 202.00 3.17 0.00 0.00 0.00 +TRINITY_DN3_c0_g1 TRINITY_DN3_c0_g1_i1 216.00 6.25 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/rsem_bowtie2/RSEM.isoforms.results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +transcript_id gene_id length effective_length expected_count TPM FPKM IsoPct +TRINITY_DN0_c0_g1_i1 TRINITY_DN0_c0_g1 229 10.58 0.00 0.00 0.00 0.00 +TRINITY_DN1_c0_g1_i1 TRINITY_DN1_c0_g1 380 122.00 5.00 309046.31 3415300.55 100.00 +TRINITY_DN2_c0_g1_i1 TRINITY_DN2_c0_g1 279 32.50 0.00 0.00 0.00 0.00 +TRINITY_DN2_c1_g1_i1 TRINITY_DN2_c1_g1 541 279.67 6.00 161779.66 1787842.67 100.00 +TRINITY_DN2_c2_g1_i1 TRINITY_DN2_c2_g1 240 14.25 1.00 529174.03 5847953.22 100.00 +TRINITY_DN2_c3_g1_i1 TRINITY_DN2_c3_g1 202 3.17 0.00 0.00 0.00 0.00 +TRINITY_DN3_c0_g1_i1 TRINITY_DN3_c0_g1 216 6.25 0.00 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/rsem_bowtie2/RSEM.isoforms_B.results Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,8 @@ +transcript_id gene_id length effective_length expected_count TPM FPKM IsoPct +TRINITY_DN0_c0_g1_i1 TRINITY_DN0_c0_g1 380 122.00 5.00 309046.31 3415300.55 100.00 +TRINITY_DN1_c0_g1_i1 TRINITY_DN1_c0_g1 229 10.58 0.00 0.00 0.00 0.00 +TRINITY_DN2_c0_g1_i1 TRINITY_DN2_c0_g1 279 32.50 0.00 0.00 0.00 0.00 +TRINITY_DN2_c2_g1_i1 TRINITY_DN2_c2_g1 541 279.67 6.00 161779.66 1787842.67 100.00 +TRINITY_DN2_c1_g1_i1 TRINITY_DN2_c1_g1 240 14.25 1.00 529174.03 5847953.22 100.00 +TRINITY_DN2_c3_g1_i1 TRINITY_DN2_c3_g1 202 3.17 0.00 0.00 0.00 0.00 +TRINITY_DN3_c0_g1_i1 TRINITY_DN3_c0_g1 216 6.25 0.00 0.00 0.00 0.00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/count/samples.txt Mon Apr 25 10:02:37 2016 -0400 @@ -0,0 +1,9 @@ +wt_37 wt_37_1 /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_37_1-SRX707647-SRR1582649_1.fastq /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_37_1-SRX707647-SRR1582649_2.fastq +wt_37 wt_37_2 /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_37_2-SRX707648-SRR1582650_1.fastq /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_37_2-SRX707648-SRR1582650_2.fastq +wt_37 wt_37_3 /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_37_3-SRX707649-SRR1582651_1.fastq /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_37_3-SRX707649-SRR1582651_2.fastq +wt_GSNO wt_GSNO_1 /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_GSNO_1-SRX707644-SRR1582646_1.fastq /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_GSNO_1-SRX707644-SRR1582646_2.fastq +wt_GSNO wt_GSNO_2 /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_GSNO_2-SRX707645-SRR1582647_1.fastq /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_GSNO_2-SRX707645-SRR1582647_2.fastq +wt_GSNO wt_GSNO_3 /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_GSNO_3-SRX707646-SRR1582648_1.fastq /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_GSNO_3-SRX707646-SRR1582648_2.fastq +wt_ph8 wt_ph8_1 /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_ph8_1-SRX707641-SRR1582643_1.fastq /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_ph8_1-SRX707641-SRR1582643_2.fastq +wt_ph8 wt_ph8_2 /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_ph8_2-SRX707642-SRR1582644_1.fastq /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_ph8_2-SRX707642-SRR1582644_2.fastq +wt_ph8 wt_ph8_3 /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_ph8_3-SRX707643-SRR1582645_1.fastq /broad/hptmp/bhaas/candida/FASTQ/2M/2M.wt_ph8_3-SRX707643-SRR1582645_2.fastq
--- a/test-data/norm/Trinity.fasta Wed Dec 09 07:19:52 2015 -0500 +++ b/test-data/norm/Trinity.fasta Mon Apr 25 10:02:37 2016 -0400 @@ -1,10 +1,23 @@ ->TR1|c0_g1_i1 len=279 path=[257:0-278] [-1, 257, -2] +>TRINITY_DN1_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] +AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT +TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT +ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA +TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC +>TRINITY_DN0_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] +CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG +CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC +AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT +ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG +GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG +AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG +TATATGGTACAGATGTAAAG +>TRINITY_DN2_c0_g1_i1 len=279 path=[257:0-278] [-1, 257, -2] TCCAGACCATCGACAACATTGTCTTCTTCCCAGCCACAAGCAAGAAGGAGGATGCAGAGA ACTTAGCTGCAGCCCAGAGAGATGCAGTAGACTTCGATGTTCGAGTTGATACTCAAGACC AAGGAATGTACCGCTTTTTAACATCACAACAACTGTTCAAGCTACTGGACTGCTTATTAG AGTCGCATAGATTTGCAAAAGCATTTAATTCCAACAATGAACAGAGGACTGCTCTGTGGA AAGCAGGCTTCAAAGGCAAGTCCAAGCCCAATCTTCTAA ->TR1|c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] +>TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTAT TCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGA TGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTT @@ -15,21 +28,19 @@ CCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTG GTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGT G ->TR1|c2_g1_i1 len=240 path=[218:0-239] [-1, 218, -2] +>TRINITY_DN2_c2_g1_i1 len=240 path=[218:0-239] [-1, 218, -2] ACAAGCAGCCTGGCGTGTGGGCTGCGCATTCTCTTCCGGATGTACATGGACGAGAGCAGA GTCAGTGCCTGGGAAGAAGTCCAGCAGAGGCTTTTAAACGTCTGCAGGGAAGCGCTGAGC TACTTCCTCACTCTAACATCCGAAAGTCACCGGGAAGCCTGGACTAACTTACTGTTACTG TTCCTCACTAAAGTTCTGAAGATCAGTGACAGCAGGTTTAAAGCTCACGCATCATTCTAC ->TR2|c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] -CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG -CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC -AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT -ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG -GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG -AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG -TATATGGTACAGATGTAAAG ->TR3|c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] -AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT -TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT -ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA -TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC +>TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2] +GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTC +AAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCC +CCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGAC +ATACATGATTCTATTCAACCAA +>TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2] +ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATG +CTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCT +ACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCA +TATGTAGACCAACATGACTTTTCAGGAAAAGACTTT +
--- a/test-data/raw/Trinity.fasta Wed Dec 09 07:19:52 2015 -0500 +++ b/test-data/raw/Trinity.fasta Mon Apr 25 10:02:37 2016 -0400 @@ -1,10 +1,23 @@ ->TR1|c0_g1_i1 len=279 path=[257:0-278] [-1, 257, -2] +>TRINITY_DN1_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] +CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG +CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC +AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT +ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG +GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG +AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG +TATATGGTACAGATGTAAAG +>TRINITY_DN0_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] +AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT +TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT +ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA +TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC +>TRINITY_DN2_c0_g1_i1 len=279 path=[257:0-278] [-1, 257, -2] TCCAGACCATCGACAACATTGTCTTCTTCCCAGCCACAAGCAAGAAGGAGGATGCAGAGA ACTTAGCTGCAGCCCAGAGAGATGCAGTAGACTTCGATGTTCGAGTTGATACTCAAGACC AAGGAATGTACCGCTTTTTAACATCACAACAACTGTTCAAGCTACTGGACTGCTTATTAG AGTCGCATAGATTTGCAAAAGCATTTAATTCCAACAATGAACAGAGGACTGCTCTGTGGA AAGCAGGCTTCAAAGGCAAGTCCAAGCCCAATCTTCTAA ->TR1|c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] +>TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTAT TCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGA TGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTT @@ -15,21 +28,19 @@ CCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTG GTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGT G ->TR1|c2_g1_i1 len=240 path=[218:0-239] [-1, 218, -2] +>TRINITY_DN2_c2_g1_i1 len=240 path=[218:0-239] [-1, 218, -2] ACAAGCAGCCTGGCGTGTGGGCTGCGCATTCTCTTCCGGATGTACATGGACGAGAGCAGA GTCAGTGCCTGGGAAGAAGTCCAGCAGAGGCTTTTAAACGTCTGCAGGGAAGCGCTGAGC TACTTCCTCACTCTAACATCCGAAAGTCACCGGGAAGCCTGGACTAACTTACTGTTACTG TTCCTCACTAAAGTTCTGAAGATCAGTGACAGCAGGTTTAAAGCTCACGCATCATTCTAC ->TR2|c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] -CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG -CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC -AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT -ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG -GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG -AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG -TATATGGTACAGATGTAAAG ->TR3|c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] -AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT -TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT -ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA -TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC +>TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2] +GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTC +AAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCC +CCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGAC +ATACATGATTCTATTCAACCAA +>TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2] +ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATG +CTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCT +ACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCA +TATGTAGACCAACATGACTTTTCAGGAAAAGACTTT +
--- a/tool_dependencies.xml Wed Dec 09 07:19:52 2015 -0500 +++ b/tool_dependencies.xml Mon Apr 25 10:02:37 2016 -0400 @@ -1,14 +1,32 @@ <?xml version="1.0"?> <tool_dependency> - <package name="trinity" version="2.0.6"> - <repository changeset_revision="e65cf857feb6" name="package_trinity_2_0_6" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + <package name="trinity" version="2.1.1"> + <repository changeset_revision="b66b28a11557" name="package_trinity_2_1_1" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> <package name="bowtie" version="1.1.2"> <repository changeset_revision="a1c1a92e13a6" name="package_bowtie_1_1_2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> + <package name="bowtie2" version="2.2.6"> + <repository changeset_revision="0d9cd7487cc9" name="package_bowtie_2_2_6" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> <package name="samtools" version="1.2"> <repository changeset_revision="f6ae3ba3f3c1" name="package_samtools_1_2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> + <package name="edger" version="3.12.0"> + <repository changeset_revision="5c1431123155" name="package_r_edger_3_12_0" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> + <package name="rsem" version="1.2.28"> + <repository changeset_revision="4567331d510a" name="package_rsem_1_2_28" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> + <package name="express" version="1.5.1"> + <repository changeset_revision="93017e8743e5" name="package_express_1_5_1" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> + <package name="limma" version="3.27.4"> + <repository changeset_revision="7c305aa20292" name="package_r_limma_3_27_4" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> + <package name="deseq2" version="1.10.0"> + <repository changeset_revision="362a2224b1d2" name="package_deseq2_1_10_0" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> <set_environment version="1.0"> <environment_variable action="set_to" name="TRINITY_MEM_OPTIONS">--max_memory 30G --bflyHeapSpaceMax 30G</environment_variable> </set_environment>
--- a/trinity.xml Wed Dec 09 07:19:52 2015 -0500 +++ b/trinity.xml Mon Apr 25 10:02:37 2016 -0400 @@ -1,7 +1,7 @@ -<tool id="trinity" name="Trinity" version="2.0.6.1"> +<tool id="trinity" name="Trinity" version="2.1.1"> <description>de novo assembly of RNA-Seq data</description> <requirements> - <requirement type="package" version="2.0.6">trinity</requirement> + <requirement type="package" version="2.1.1">trinity</requirement> <requirement type="package" version="1.1.2">bowtie</requirement> <requirement type="package" version="1.2">samtools</requirement> <requirement type="set_environment">TRINITY_MEM_OPTIONS</requirement> @@ -62,9 +62,9 @@ #end if ## CPU and butterfly options. - --CPU \${GALAXY_SLOTS:-4} \${TRINITY_MEM_OPTIONS} --bfly_opts "-V 10 --stderr" + --CPU \${GALAXY_SLOTS:-4} \${TRINITY_MEM_OPTIONS:---max_memory 1G} --bfly_opts "-V 10 --stderr" - > $trinity_log 2>&1 + ## > $trinity_log 2>&1 ]]></command> <inputs> @@ -87,11 +87,10 @@ </param> </when> </conditional> - <param name="paired_fragment_length" type="integer" value="300" min="1" label="Paired Fragment Length" help="Maximum length expected between fragment pairs"/> <param name="jaccard_clip" type="boolean" truevalue="--jaccard_clip" falsevalue="" checked="false" label="Jaccard Clip options" help="set if you expect high gene density with UTR overlap"/> </when> <when value="single"> - <param format="fasta,fastq" name="input" type="data" label="Single-end reads" help=""/> + <param format="fasta,fastqsanger" name="input" type="data" label="Single-end reads" help=""/> <conditional name="strand"> <param name="is_strand_specific" type="boolean" checked="false" label="Strand specific data"/> <when value="false"> @@ -130,7 +129,7 @@ </section> </inputs> <outputs> - <data format="txt" name="trinity_log" label="${tool.name} on ${on_string}: log" /> + <!--data format="txt" name="trinity_log" label="${tool.name} on ${on_string}: log" /--> <data format="fasta" name="assembled_transcripts" label="${tool.name} on ${on_string}: Assembled Transcripts" from_work_dir="trinity_out_dir/Trinity.fasta"/> </outputs> <tests>