annotate test-data/filtered/Trinity_filtered_hi_iso.fasta @ 14:be3f26533209 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 1b2ce625fad2514549bf2a675c26517c3d46ed81"
author iuc
date Sun, 19 Dec 2021 16:16:07 +0000
parents 570f2b1f3cd9
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
1
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
1 >TRINITY_DN1_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
2 CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
3 CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
4 AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
5 ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
6 GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
7 AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
8 TATATGGTACAGATGTAAAG
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
9 >TRINITY_DN0_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
10 AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
11 TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
12 ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
13 TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
14 >TRINITY_DN2_c0_g1_i1 len=279 path=[257:0-278] [-1, 257, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
15 TCCAGACCATCGACAACATTGTCTTCTTCCCAGCCACAAGCAAGAAGGAGGATGCAGAGA
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
16 ACTTAGCTGCAGCCCAGAGAGATGCAGTAGACTTCGATGTTCGAGTTGATACTCAAGACC
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
17 AAGGAATGTACCGCTTTTTAACATCACAACAACTGTTCAAGCTACTGGACTGCTTATTAG
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
18 AGTCGCATAGATTTGCAAAAGCATTTAATTCCAACAATGAACAGAGGACTGCTCTGTGGA
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
19 AAGCAGGCTTCAAAGGCAAGTCCAAGCCCAATCTTCTAA
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
20 >TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
21 GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTAT
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
22 TCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGA
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
23 TGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTT
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
24 TGAGTTGTCTTGTATCATCAATAGATGCAAATTAGATGTAAGAACCAGGGGCTTAACAGT
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
25 AATGTTTGAAATAATGAAAACATATGGCCACACTTATGAAAAACATTGGTGGCAGGACTT
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
26 ATTCAGAATTGTTTTCAGAATCTTTGACAACATGAAATTGCCAGAACAGCAGACAGAGAA
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
27 AGCTGAATGGATGACAACAACTTGTAACCATGTCCTTTATGCAATATGTGATGTATTCAC
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
28 CCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTG
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
29 GTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGT
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
30 G
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
31 >TRINITY_DN2_c2_g1_i1 len=240 path=[218:0-239] [-1, 218, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
32 ACAAGCAGCCTGGCGTGTGGGCTGCGCATTCTCTTCCGGATGTACATGGACGAGAGCAGA
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
33 GTCAGTGCCTGGGAAGAAGTCCAGCAGAGGCTTTTAAACGTCTGCAGGGAAGCGCTGAGC
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
34 TACTTCCTCACTCTAACATCCGAAAGTCACCGGGAAGCCTGGACTAACTTACTGTTACTG
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
35 TTCCTCACTAAAGTTCTGAAGATCAGTGACAGCAGGTTTAAAGCTCACGCATCATTCTAC
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
36 >TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
37 GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTC
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
38 AAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCC
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
39 CCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGAC
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
40 ATACATGATTCTATTCAACCAA
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
41 >TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
42 ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATG
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
43 CTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCT
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
44 ACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCA
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents:
diff changeset
45 TATGTAGACCAACATGACTTTTCAGGAAAAGACTTT