comparison test-data/filtered/Trinity_filtered_hi_iso.fasta @ 1:570f2b1f3cd9 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
author iuc
date Fri, 31 Mar 2017 11:37:12 -0400
parents
children
comparison
equal deleted inserted replaced
0:1e8a2c87461a 1:570f2b1f3cd9
1 >TRINITY_DN1_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
2 CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG
3 CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC
4 AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT
5 ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG
6 GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG
7 AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG
8 TATATGGTACAGATGTAAAG
9 >TRINITY_DN0_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
10 AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT
11 TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT
12 ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA
13 TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC
14 >TRINITY_DN2_c0_g1_i1 len=279 path=[257:0-278] [-1, 257, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
15 TCCAGACCATCGACAACATTGTCTTCTTCCCAGCCACAAGCAAGAAGGAGGATGCAGAGA
16 ACTTAGCTGCAGCCCAGAGAGATGCAGTAGACTTCGATGTTCGAGTTGATACTCAAGACC
17 AAGGAATGTACCGCTTTTTAACATCACAACAACTGTTCAAGCTACTGGACTGCTTATTAG
18 AGTCGCATAGATTTGCAAAAGCATTTAATTCCAACAATGAACAGAGGACTGCTCTGTGGA
19 AAGCAGGCTTCAAAGGCAAGTCCAAGCCCAATCTTCTAA
20 >TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
21 GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTAT
22 TCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGA
23 TGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTT
24 TGAGTTGTCTTGTATCATCAATAGATGCAAATTAGATGTAAGAACCAGGGGCTTAACAGT
25 AATGTTTGAAATAATGAAAACATATGGCCACACTTATGAAAAACATTGGTGGCAGGACTT
26 ATTCAGAATTGTTTTCAGAATCTTTGACAACATGAAATTGCCAGAACAGCAGACAGAGAA
27 AGCTGAATGGATGACAACAACTTGTAACCATGTCCTTTATGCAATATGTGATGTATTCAC
28 CCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTG
29 GTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGT
30 G
31 >TRINITY_DN2_c2_g1_i1 len=240 path=[218:0-239] [-1, 218, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
32 ACAAGCAGCCTGGCGTGTGGGCTGCGCATTCTCTTCCGGATGTACATGGACGAGAGCAGA
33 GTCAGTGCCTGGGAAGAAGTCCAGCAGAGGCTTTTAAACGTCTGCAGGGAAGCGCTGAGC
34 TACTTCCTCACTCTAACATCCGAAAGTCACCGGGAAGCCTGGACTAACTTACTGTTACTG
35 TTCCTCACTAAAGTTCTGAAGATCAGTGACAGCAGGTTTAAAGCTCACGCATCATTCTAC
36 >TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
37 GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTC
38 AAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCC
39 CCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGAC
40 ATACATGATTCTATTCAACCAA
41 >TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
42 ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATG
43 CTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCT
44 ACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCA
45 TATGTAGACCAACATGACTTTTCAGGAAAAGACTTT