Mercurial > repos > iuc > unicycler
comparison unicycler.xml @ 7:88c240872a65 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/unicycler commit 1f2e4636dbff27bc41f500f31b5500e12f0b56c8"
| author | iuc |
|---|---|
| date | Tue, 08 Oct 2019 02:47:44 -0400 |
| parents | 0a3a602cd1e3 |
| children | 9e3e80cc4ad4 |
comparison
equal
deleted
inserted
replaced
| 6:0a3a602cd1e3 | 7:88c240872a65 |
|---|---|
| 1 <tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0"> | 1 <tool id="unicycler" name="Create assemblies with Unicycler" version="@VERSION@.0"> |
| 2 <macros> | 2 <macros> |
| 3 <token name="@VERSION@">0.4.7</token> | 3 <token name="@VERSION@">0.4.8</token> |
| 4 </macros> | 4 </macros> |
| 5 <edam_topics> | |
| 6 <edam_topic>topic_0196</edam_topic> | |
| 7 </edam_topics> | |
| 8 <edam_operations> | |
| 9 <edam_operation>operation_0525</edam_operation> | |
| 10 </edam_operations> | |
| 5 <requirements> | 11 <requirements> |
| 6 <requirement type="package" version="@VERSION@">unicycler</requirement> | 12 <requirement type="package" version="@VERSION@">unicycler</requirement> |
| 7 </requirements> | 13 </requirements> |
| 8 <command detect_errors="exit_code"><![CDATA[ | 14 <command detect_errors="exit_code"><![CDATA[ |
| 9 ## Preparing files | 15 ## Preparing files |
| 86 #if str($spades.kmers) != '' | 92 #if str($spades.kmers) != '' |
| 87 --kmers '$spades.kmers' | 93 --kmers '$spades.kmers' |
| 88 #end if | 94 #end if |
| 89 --kmer_count '$spades.kmer_count' | 95 --kmer_count '$spades.kmer_count' |
| 90 --depth_filter '$spades.depth_filter' | 96 --depth_filter '$spades.depth_filter' |
| 97 #if $spades.largest_component | |
| 98 --largest_component | |
| 99 #end if | |
| 91 ## Rotation Options section | 100 ## Rotation Options section |
| 92 ## ---------------------------------------------------------- | 101 ## ---------------------------------------------------------- |
| 93 $rotation.no_rotate | 102 $rotation.no_rotate |
| 94 #if $rotation.start_genes | 103 #if $rotation.start_genes |
| 95 --start_genes '$rotation.start_genes' | 104 --start_genes '$rotation.start_genes' |
| 161 <validator type="regex" message="Kmers must be comma-separated odd integers (no repitition) without space in the range of 11 to 127 (inclusive)">^(\d*[13579],)*(\d*[13579])$</validator> | 170 <validator type="regex" message="Kmers must be comma-separated odd integers (no repitition) without space in the range of 11 to 127 (inclusive)">^(\d*[13579],)*(\d*[13579])$</validator> |
| 162 </param> | 171 </param> |
| 163 <param argument="--kmer_count" type="integer" min="0" value="10" label="Number of k-mer steps to use in SPAdes assembly"/> | 172 <param argument="--kmer_count" type="integer" min="0" value="10" label="Number of k-mer steps to use in SPAdes assembly"/> |
| 164 <param argument="--depth_filter" type="float" min="0" max="1" value="0.25" | 173 <param argument="--depth_filter" type="float" min="0" max="1" value="0.25" |
| 165 label="Filter out contigs lower than this fraction of the chromosomal depth" help="It is done if does not result in graph dead ends"/> | 174 label="Filter out contigs lower than this fraction of the chromosomal depth" help="It is done if does not result in graph dead ends"/> |
| 175 <param argument="--largest_component" type="boolean" checked="false" | |
| 176 label="Only keep the largest connected component of the assembly graph"/> | |
| 166 </section> | 177 </section> |
| 167 <section name="rotation" expanded="false" title="Rotation options" | 178 <section name="rotation" expanded="false" title="Rotation options" |
| 168 help="These options control the rotation of completed circular sequence near the end of the Unicycler pipeline. Use this ONLY if you know what you are doing!"> | 179 help="These options control the rotation of completed circular sequence near the end of the Unicycler pipeline. Use this ONLY if you know what you are doing!"> |
| 169 <param argument="--no_rotate" type="boolean" checked="false" truevalue="--no_rotate" falsevalue="" | 180 <param argument="--no_rotate" type="boolean" checked="false" truevalue="--no_rotate" falsevalue="" |
| 170 label="Do not rotate completed replicons to start at a standard gene." help="Unicycler uses TBLASTN to search for dnaA or repA alleles in each completed replicon. If one is found, the sequence is rotated and/or flipped so that it begins with that gene encoded on the forward strand. This provides consistently oriented assemblies and reduces the risk that a gene will be split across the start and end of the sequence."/> | 181 label="Do not rotate completed replicons to start at a standard gene." help="Unicycler uses TBLASTN to search for dnaA or repA alleles in each completed replicon. If one is found, the sequence is rotated and/or flipped so that it begins with that gene encoded on the forward strand. This provides consistently oriented assemblies and reduces the risk that a gene will be split across the start and end of the sequence."/> |
| 229 <section name="lr_align"> | 240 <section name="lr_align"> |
| 230 <param name="scores" value="3,-6,-5,-2"/> | 241 <param name="scores" value="3,-6,-5,-2"/> |
| 231 </section> | 242 </section> |
| 232 <output name="assembly_graph" ftype="tabular"> | 243 <output name="assembly_graph" ftype="tabular"> |
| 233 <assert_contents> | 244 <assert_contents> |
| 234 <has_text text="TACGGGGAAGGACGTC"/> | 245 <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC"/> |
| 235 </assert_contents> | 246 </assert_contents> |
| 236 </output> | 247 </output> |
| 237 <output name="assembly" ftype="fasta"> | 248 <output name="assembly" ftype="fasta"> |
| 238 <assert_contents> | 249 <assert_contents> |
| 239 <has_text text="length=5386" /> | 250 <has_text text="length=5386" /> |
| 284 <section name="lr_align"> | 295 <section name="lr_align"> |
| 285 <param name="scores" value="3,-6,-5,-2"/> | 296 <param name="scores" value="3,-6,-5,-2"/> |
| 286 </section> | 297 </section> |
| 287 <output name="assembly_graph" ftype="tabular"> | 298 <output name="assembly_graph" ftype="tabular"> |
| 288 <assert_contents> | 299 <assert_contents> |
| 289 <has_text text="TACGGGGAAGGACGTC" /> | 300 <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> |
| 290 </assert_contents> | 301 </assert_contents> |
| 291 </output> | 302 </output> |
| 292 <output name="assembly" ftype="fasta"> | 303 <output name="assembly" ftype="fasta"> |
| 293 <assert_contents> | 304 <assert_contents> |
| 294 <has_text text="length=5386" /> | 305 <has_text text="length=5386" /> |
| 331 <section name="lr_align"> | 342 <section name="lr_align"> |
| 332 <param name="scores" value="3,-6,-5,-2"/> | 343 <param name="scores" value="3,-6,-5,-2"/> |
| 333 </section> | 344 </section> |
| 334 <output name="assembly_graph" ftype="tabular"> | 345 <output name="assembly_graph" ftype="tabular"> |
| 335 <assert_contents> | 346 <assert_contents> |
| 336 <has_text text="TACGGGGAAGGACGTC" /> | 347 <has_text text="TATCTGTTACTGAGAAGTTAATGGATGAATTGGCAC" /> |
| 337 </assert_contents> | 348 </assert_contents> |
| 338 </output> | 349 </output> |
| 339 <output name="assembly" ftype="fasta"> | 350 <output name="assembly" ftype="fasta"> |
| 340 <assert_contents> | 351 <assert_contents> |
| 341 <has_text text="length=5386" /> | 352 <has_text text="length=5386" /> |