Mercurial > repos > iuc > unicycler
comparison unicycler.xml @ 11:8f9f06995f98 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/unicycler commit c1cd9b717bce328b276f24d910e2e6858585b2cc
author | iuc |
---|---|
date | Tue, 19 Dec 2023 15:58:30 +0000 |
parents | d10bdad2fd17 |
children | 3e44ef016b45 |
comparison
equal
deleted
inserted
replaced
10:d10bdad2fd17 | 11:8f9f06995f98 |
---|---|
2 <description>pipeline for bacterial genomes</description> | 2 <description>pipeline for bacterial genomes</description> |
3 <macros> | 3 <macros> |
4 <token name="@TOOL_VERSION@">0.5.0</token> | 4 <token name="@TOOL_VERSION@">0.5.0</token> |
5 <token name="@VERSION_SUFFIX@">1</token> | 5 <token name="@VERSION_SUFFIX@">1</token> |
6 </macros> | 6 </macros> |
7 <xrefs> | |
8 <xref type="bio.tools">unicycler</xref> | |
9 </xrefs> | |
10 <edam_topics> | 7 <edam_topics> |
11 <edam_topic>topic_0196</edam_topic> | 8 <edam_topic>topic_0196</edam_topic> |
12 </edam_topics> | 9 </edam_topics> |
13 <edam_operations> | 10 <edam_operations> |
14 <edam_operation>operation_0525</edam_operation> | 11 <edam_operation>operation_0525</edam_operation> |
15 </edam_operations> | 12 </edam_operations> |
13 <xrefs> | |
14 <xref type="bio.tools">unicycler</xref> | |
15 </xrefs> | |
16 <requirements> | 16 <requirements> |
17 <requirement type="package" version="@TOOL_VERSION@">unicycler</requirement> | 17 <requirement type="package" version="@TOOL_VERSION@">unicycler</requirement> |
18 <requirement type="package" version="1.15.1">samtools</requirement> | 18 <requirement type="package" version="1.15.1">samtools</requirement> |
19 </requirements> | 19 </requirements> |
20 <command detect_errors="exit_code"><![CDATA[ | 20 <command detect_errors="exit_code"><![CDATA[ |
21 #for r in $reuse | |
22 ln -s $r.reuse_file ${r.reuse_step}.gfa && | |
23 #end for | |
24 | |
21 ## Preparing files | 25 ## Preparing files |
22 #set $uncompressed = ('fastqsanger','fastq') | 26 #set $uncompressed = ('fastqsanger','fastq') |
23 #set $compressed = ('fastqsanger.gz','fastq.gz') | 27 #set $compressed = ('fastqsanger.gz','fastq.gz') |
24 #if str( $paired_unpaired.fastq_input_selector ) == "paired" | 28 #if str( $paired_unpaired.fastq_input_selector ) == "paired" |
25 #if $paired_unpaired.fastq_input1.file_ext in $uncompressed | 29 #if $paired_unpaired.fastq_input1.file_ext in $uncompressed |
206 <param argument="--keep" type="select" label="Outputs to keep" help="Level of file retention. Default: 1"> | 210 <param argument="--keep" type="select" label="Outputs to keep" help="Level of file retention. Default: 1"> |
207 <option value="0">0: only keep final files</option> | 211 <option value="0">0: only keep final files</option> |
208 <option value="1" selected="true">1: save graphs at main checkpoints</option> | 212 <option value="1" selected="true">1: save graphs at main checkpoints</option> |
209 <option value="2">2: also keep SAM</option> | 213 <option value="2">2: also keep SAM</option> |
210 </param> | 214 </param> |
215 <repeat name="reuse" title="Reuse checkpoint files from earlier runs" max="1" help=""> | |
216 <param name="reuse_file" type="data" optional="false" format="gfa1" label="Checkpoint file"/> | |
217 <param name="reuse_step" type="select" label="Checkpoint"> | |
218 <option value="002_depth_filter">002_depth_filter</option> | |
219 <option value="003_overlaps_removed">003_overlaps_removed</option> | |
220 <option value="004_bridges_applied">004_bridges_applied</option> | |
221 </param> | |
222 </repeat> | |
211 </inputs> | 223 </inputs> |
212 <outputs> | 224 <outputs> |
213 <data name="assembly_graph" format="gfa1" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" /> | 225 <data name="assembly_graph" format="gfa1" from_work_dir="assembly.gfa" label="${tool.name} on ${on_string}: Final Assembly Graph" /> |
214 <data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/> | 226 <data name="assembly" format="fasta" from_work_dir="assembly.fasta" label="${tool.name} on ${on_string}: Final Assembly"/> |
215 <collection name="spades_collection" type="list" label="${tool.name} on ${on_string}: SPAdes graphs"> | 227 <collection name="spades_collection" type="list" label="${tool.name} on ${on_string}: SPAdes graphs"> |
216 <discover_datasets pattern="__designation_and_ext__" format="gfa1" directory="spades_graphs"/> | 228 <discover_datasets pattern="(?P<designation>.*)\.gfa" format="gfa1" directory="spades_graphs"/> |
217 <filter>keep != "0"</filter> | 229 <filter>keep != "0"</filter> |
218 </collection> | 230 </collection> |
219 <data name="bam_file" format="bam" from_work_dir="read_alignment/long_read_alignments.bam" label="${tool.name} on ${on_string}: Long read alignments BAM"> | 231 <data name="bam_file" format="bam" from_work_dir="read_alignment/long_read_alignments.bam" label="${tool.name} on ${on_string}: Long read alignments BAM"> |
220 <filter>keep == "2" and long</filter> | 232 <filter>keep == "2" and long</filter> |
221 </data> | 233 </data> |
373 <assert_contents> | 385 <assert_contents> |
374 <has_text text=">1" /> | 386 <has_text text=">1" /> |
375 </assert_contents> | 387 </assert_contents> |
376 </output> | 388 </output> |
377 </test> | 389 </test> |
390 <!-- test checkpoint graph reuse | |
391 TODO more precise test and check difference to call wo reuse --> | |
392 <test expect_num_outputs="2"> | |
393 <conditional name="paired_unpaired"> | |
394 <param name="fastq_input_selector" value="paired_collection"/> | |
395 <param name="fastq_input1"> | |
396 <collection type="paired"> | |
397 <element name="forward" value="phix_f.fq.gz" ftype="fastqsanger" /> | |
398 <element name="reverse" value="phix_r.fq.gz" ftype="fastqsanger" /> | |
399 </collection> | |
400 </param> | |
401 </conditional> | |
402 <param name="long" value="only_long.fasta" ftype="fasta" /> | |
403 <repeat name="reuse"> | |
404 <param name="reuse_file" value="phix__spades_graph.gfa1"/> | |
405 <param name="reuse_step" value="002_depth_filter"/> | |
406 </repeat> | |
407 <param name="keep" value="0"/> | |
408 <output name="assembly_graph" ftype="gfa1"> | |
409 <assert_contents> | |
410 <has_text text="S" /> | |
411 </assert_contents> | |
412 </output> | |
413 <output name="assembly" ftype="fasta"> | |
414 <assert_contents> | |
415 <has_text text=">1" /> | |
416 </assert_contents> | |
417 </output> | |
418 </test> | |
378 <!-- Test keep value = 1 --> | 419 <!-- Test keep value = 1 --> |
379 <test expect_num_outputs="3"> | 420 <test expect_num_outputs="3"> |
380 <conditional name="paired_unpaired"> | 421 <conditional name="paired_unpaired"> |
381 <param name="fastq_input_selector" value="paired" /> | 422 <param name="fastq_input_selector" value="paired" /> |
382 <param name="fastq_input1" value="phix_f.fq.gz" ftype="fastqsanger" /> | 423 <param name="fastq_input1" value="phix_f.fq.gz" ftype="fastqsanger" /> |
426 <element name="001_spades_graph_k027"> | 467 <element name="001_spades_graph_k027"> |
427 <assert_contents> | 468 <assert_contents> |
428 <has_text text="TTGAATGCCACCGGAGGCGGCTTTTTGACCGCCTCCAAAC"/> | 469 <has_text text="TTGAATGCCACCGGAGGCGGCTTTTTGACCGCCTCCAAAC"/> |
429 </assert_contents> | 470 </assert_contents> |
430 </element> | 471 </element> |
472 <!-- there are gfa files for more k that are not tested explicily | |
473 Aim of testing these is to be sure about the names of the graphs, | |
474 since they are used for reuse. Hence if there is a change here | |
475 update reuse accordingly--> | |
476 <element name="001_spades_graph_k127"> | |
477 <assert_contents> | |
478 <has_line_matching expression="^S.*"/> | |
479 </assert_contents> | |
480 </element> | |
481 <element name="002_depth_filter"> | |
482 <assert_contents> | |
483 <has_line_matching expression="^S.*"/> | |
484 </assert_contents> | |
485 </element> | |
486 <element name="003_overlaps_removed"> | |
487 <assert_contents> | |
488 <has_line_matching expression="^S.*"/> | |
489 </assert_contents> | |
490 </element> | |
491 <element name="004_bridges_applied"> | |
492 <assert_contents> | |
493 <has_line_matching expression="^S.*"/> | |
494 </assert_contents> | |
495 </element> | |
496 <element name="005_final_clean"> | |
497 <assert_contents> | |
498 <has_line_matching expression="^S.*"/> | |
499 </assert_contents> | |
500 </element> | |
431 </output_collection> | 501 </output_collection> |
432 <output name="bam_file" ftype="bam"> | 502 <output name="bam_file" ftype="bam"> |
433 <assert_contents> | 503 <assert_contents> |
434 <has_size value="2084" delta="100"/> | 504 <has_size value="2084" delta="100"/> |
435 </assert_contents> | 505 </assert_contents> |