Mercurial > repos > jankanis > blast2html
annotate test-data/blast xml example3b.html @ 120:2729c2326235
Fix for Rikilt issue 13
Hit e-value and identity% should be taken from the hsp with the highest
bit score. Previously each of these values was calculated independently.
Also use arrays for cover calculation instead of python lists and
refactor the hit_info() code a bit.
| author | Jan Kanis <jan.code@jankanis.nl> |
|---|---|
| date | Thu, 31 Jul 2014 16:14:36 +0200 |
| parents | 7f3f8c10f44b |
| children |
| rev | line source |
|---|---|
| 106 | 1 <!DOCTYPE html> |
| 2 <html> | |
| 3 <head> | |
| 4 <meta charset="UTF-8"> | |
| 5 <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> | |
| 6 | |
| 7 <title>Blast output</title> | |
| 8 | |
| 9 <style> | |
| 10 body { | |
| 11 color: #333333; | |
| 12 font-family: Arial,Sans-Serif; | |
| 13 } | |
| 14 | |
| 15 :link { | |
| 16 color: #336699; | |
| 17 } | |
| 18 | |
| 19 .right { | |
| 20 float: right; | |
| 21 } | |
| 22 | |
| 23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ | |
| 24 #strip_html_warning { | |
| 25 display: none; | |
| 26 } | |
| 27 | |
| 28 #content { | |
| 29 margin: 0 2em; | |
| 30 padding: 0.5em; | |
| 31 border: 1px solid #888888; | |
| 32 background-color: #d3dff5; | |
| 33 } | |
| 34 | |
| 35 h1, h2, h3, h4, h5, h6 { | |
| 36 color: #2A6979; | |
| 37 font-family: arial,verdana,sans-serif; | |
| 38 letter-spacing: -1px; | |
| 39 margin: 1.2em 0 0.3em; | |
| 40 } | |
| 41 | |
| 42 h1 { | |
| 114 | 43 font-size: 200%; |
| 106 | 44 } |
| 45 | |
| 46 h2 { | |
| 114 | 47 font-size: 150%; |
| 48 } | |
| 49 | |
| 50 h1, h2 { | |
| 51 border-bottom: 1px solid #CCCCCC; | |
| 52 padding-bottom: 0.1em; | |
| 53 } | |
| 54 | |
| 55 h3 { | |
| 106 | 56 font-size: 120%; |
| 57 font-weight: bold; | |
| 58 } | |
| 59 | |
| 114 | 60 h5.darkHeader { |
| 106 | 61 color: #4D4D4D; |
| 62 letter-spacing: 0; | |
| 63 font-weight: bold; | |
| 114 | 64 font-size: 108%; |
| 106 | 65 } |
| 66 | |
| 67 #nodata { | |
| 68 font-weight: bold; | |
| 69 } | |
| 70 | |
| 71 .index { | |
| 72 margin-bottom: 3em; | |
| 73 } | |
| 74 .index div.indexentry { | |
| 75 margin: 1.2em 1.6em; | |
| 76 font-weight: bold; | |
| 77 font-size: 100%; | |
| 78 } | |
| 79 | |
| 80 .headerdata { | |
| 81 font-size: 90%; | |
| 82 } | |
| 83 .headerdata .param { | |
| 84 font-weight: bold; | |
| 85 text-align: right; | |
| 86 padding: 0 1em; | |
| 87 } | |
| 88 | |
| 89 .grey { | |
| 90 background-color: #eeeeee; | |
| 91 border: 1px solid #cccccc; | |
| 92 padding: 1em; | |
| 93 } | |
| 94 | |
| 95 .white { | |
| 96 background-color: white; | |
| 97 border: 1px solid #cccccc; | |
| 98 padding: 1.5em 2%; | |
| 99 } | |
| 100 | |
| 101 .graphicrow { | |
| 102 clear: left; | |
| 103 width: 100%; | |
| 104 } | |
| 105 | |
| 106 .graphicitem { | |
| 107 float: left; | |
| 108 } | |
| 109 | |
| 110 | |
| 111 | |
| 112 .graphics .grey { | |
| 113 text-align: center; | |
| 114 } | |
| 115 | |
| 116 .graphic { | |
| 117 background-color: white; | |
| 118 border: 2px solid black; | |
| 119 padding: 1.5em; | |
| 120 margin: auto; | |
| 121 } | |
| 122 | |
| 123 .centered, .defline, div.legend, div.tablewrapper { | |
| 124 margin-left: auto; | |
| 125 margin-right: auto; | |
| 126 } | |
| 127 | |
| 128 .defline { | |
| 129 background-color: white; | |
| 130 border: 1px solid black; | |
| 131 margin: .5em auto; | |
| 132 padding-left: .2em; | |
| 133 padding-right: .2em; | |
| 134 max-width: 50em; | |
| 135 text-align: left; | |
| 136 height: 2.8em; | |
| 137 overflow: hidden; | |
| 138 } | |
| 139 | |
| 140 div.legend { | |
| 141 max-width: 40em; | |
| 142 } | |
| 143 div.legend div { | |
| 144 width: 100%; | |
| 145 color: white; | |
| 146 font-weight: bold; | |
| 147 border-spacing: 0; | |
| 148 } | |
| 149 div.legend div .graphicitem { | |
| 150 width: 20%; | |
| 151 padding: 0; | |
| 152 margin: 0; | |
| 153 border: none; | |
| 154 } | |
| 155 | |
| 156 div.tablewrapper { | |
| 157 width: 50%; | |
| 158 min-width: 60em; | |
| 159 } | |
| 160 | |
| 161 /* For small widths we give the graphic 100% */ | |
| 162 @media (max-width: 72.5em) { | |
| 163 div.tablewrapper { | |
| 164 width: 100%; | |
| 165 min-width: 0px; | |
| 166 } | |
| 167 } | |
| 168 | |
| 169 .scale { | |
| 170 width: 100%; | |
| 171 margin: .5em 0; | |
| 172 font-weight: bold; | |
| 173 } | |
| 174 .scale div { | |
| 175 color: red; | |
| 176 text-align: left; | |
| 177 } | |
| 178 .scale .graphicrow { | |
| 179 margin: .5em 0 .5em 0; | |
| 180 color: white; | |
| 181 } | |
| 182 .scale .graphicitem { | |
| 183 position: relative; | |
| 184 } | |
| 185 .scale .graphicitem div { | |
| 186 margin: 0 1px; | |
| 187 padding: 0 2px; | |
| 188 text-align: right; | |
| 189 background-color: red; | |
| 190 color: white; | |
| 191 } | |
| 192 .scale .graphicitem:first-child div { | |
| 193 margin-left: 0px; | |
| 194 } | |
| 195 .scale .graphicitem:last-child div { | |
| 196 margin-right: 0px; | |
| 197 } | |
| 198 .scale .graphicitem .lastlabel { | |
| 199 position: absolute; | |
| 200 top: 0px; | |
| 201 left: 100%; | |
| 202 background-color: transparent; | |
| 203 color: red; | |
| 204 } | |
| 205 | |
| 206 a.matchresult { | |
| 207 display: block; | |
| 208 margin: 0; | |
| 209 padding: 0; | |
| 210 } | |
| 211 div.matchrow { | |
| 212 margin-top: 4px; | |
| 213 } | |
| 214 div.matchrow, div.matchitem { | |
| 215 height: 4px; | |
| 216 } | |
| 217 | |
| 218 | |
| 219 table.descriptiontable { | |
| 220 font-size: 85%; | |
| 221 border: 1px solid #97b0c8; | |
| 222 border-spacing: 0; | |
| 223 color: #222222; | |
| 224 line-height: 1.3em; | |
| 225 background-color: white; | |
| 226 } | |
| 227 table.descriptiontable col:first-child { | |
| 228 width: 100%; | |
| 229 } | |
| 230 table.descriptiontable tr:hover { | |
| 231 background-color: #D5DEE3; | |
| 232 } | |
| 233 table.descriptiontable th { | |
| 234 color: #14376C; | |
| 235 font-weight: normal; | |
| 236 background-color: #F0F0F0; | |
| 237 background: linear-gradient(#FFFFFF, #F0F0F0); | |
| 238 border-bottom: 1px solid #D4DFE9; | |
| 239 border-right: 1px solid #CFCFCF; | |
| 240 border-left: 0px solid black; | |
| 241 border-top: 0px solid black; | |
| 242 } | |
| 243 table.descriptiontable td { | |
| 244 overflow: hidden; | |
| 245 text-align: center; | |
| 246 padding: .4em .8em; | |
| 247 } | |
| 248 table.descriptiontable td div { | |
| 249 width: 1em; | |
| 250 overflow: visible; | |
| 251 white-space: nowrap; | |
| 252 text-align: left; | |
| 253 } | |
| 254 | |
| 255 | |
| 256 | |
| 257 .alignments .white { | |
| 258 padding: 1.5em 1em; | |
| 259 } | |
| 260 | |
| 261 .alignment { | |
| 262 border-top: 1px solid black; | |
| 263 padding-left: 1em; | |
| 264 padding-right: 1em; | |
| 265 } | |
| 266 | |
| 267 div.linkheader { | |
| 268 padding-top: .2em; | |
| 269 font-size: 85%; | |
| 270 color: #14376C; | |
| 271 } | |
| 272 div.linkheader a.linkheader { | |
| 273 margin-right: 1em; | |
| 274 } | |
| 275 div.linkheader .right a { | |
| 276 text-decoration: none; | |
| 277 } | |
| 278 | |
| 279 .title .hittitle { | |
| 280 color: #222222; | |
| 281 margin-bottom: .3em; | |
| 282 } | |
| 283 .title .titleinfo { | |
| 284 font-size: 80%; | |
| 285 margin-top: 0; | |
| 286 margin-bottom: .3em; | |
| 287 } | |
| 288 .title .titleinfo .b { | |
| 289 color: #606060; | |
| 290 font-weight: bold; | |
| 291 font-size: 90%; | |
| 292 } | |
| 293 | |
| 294 .moretitles { | |
| 295 margin: 1.2em; | |
| 296 } | |
| 297 .moretitles .titleinfo { | |
| 298 margin: 0; | |
| 299 padding: 0; | |
| 300 } | |
| 301 .moretitles .hittitle { | |
| 302 margin: .4em 0 .2em 0; | |
| 303 padding: 0; | |
| 304 } | |
| 305 | |
| 306 a.showmoretitles { | |
| 307 font-size: 75%; | |
| 308 color: #336699; | |
| 309 font-weight: bold; | |
| 310 margin-top: 0; | |
| 311 } | |
| 312 a.showmoretitles:hover { | |
| 313 } | |
| 314 | |
| 315 .hotspot { | |
| 316 color: #606060; | |
| 317 font-family: verdana, arial, sans-serif; | |
| 318 margin-bottom: 2.5em; | |
| 319 } | |
| 320 | |
| 321 .hotspot p.range { | |
| 322 font-size: 70%; | |
| 323 margin-top: 0; | |
| 324 margin-top: 1em; | |
| 325 margin-bottom: .2em; | |
| 326 } | |
| 327 .hotspot p.range span.range { | |
| 328 font-weight: bold; | |
| 329 } | |
| 330 .hotspot p.range a.range { | |
| 331 margin-left: .5em; | |
| 332 } | |
| 333 | |
| 334 table.hotspotstable { | |
| 335 border-top: 1px solid; | |
| 336 border-bottom: 1px solid; | |
| 337 text-align: left; | |
| 338 border-collapse: collapse; | |
| 339 } | |
| 340 table.hotspotstable th, table.hotspotstable td { | |
| 341 padding: .1em 1em; | |
| 342 } | |
| 343 table.hotspotstable th { | |
| 344 font-size: 70%; | |
| 345 } | |
| 346 table.hotspotstable td { | |
| 347 min-width: 7em; | |
| 348 color: #222222; | |
| 349 font-size: 80%; | |
| 350 } | |
| 351 | |
| 352 pre.alignmentgraphic { | |
| 353 color: #222222; | |
| 354 } | |
| 355 | |
| 356 footer { | |
| 357 text-align: center; | |
| 358 color: #cccccc; | |
| 359 font-size: 70%; | |
| 360 margin-top: 1em; | |
| 361 } | |
| 362 footer :link { | |
| 363 color: #5588cc; | |
| 364 } | |
| 365 | |
| 366 </style> | |
| 367 | |
| 368 <script type="text/javascript"> | |
| 369 function toggle_visibility(id) { | |
| 370 var e = document.getElementById(id); | |
| 371 if(e.style.display != 'block') | |
| 372 e.style.display = 'block'; | |
| 373 else | |
| 374 e.style.display = 'none'; | |
| 375 } | |
| 376 </script> | |
| 377 | |
| 378 </head> | |
| 379 | |
| 380 | |
| 381 <body> | |
| 382 | |
| 383 <div id="strip_html_warning"> | |
| 384 <!-- This div should be hidden by the header css block. Galaxy | |
| 385 strips all css, breaking this page but making this warning | |
| 386 visible. This warning contains some ugly old skool tabular html | |
| 387 layout that is not stripped. --> | |
| 388 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> | |
| 389 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> | |
| 390 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. | |
| 391 </b></font></td></tr></table> | |
| 392 </div> | |
| 393 | |
| 394 <div id=content> | |
| 395 | |
| 114 | 396 <section class=header> |
| 397 | |
| 398 <h1>Nucleotide Blast results</h1> | |
| 399 | |
| 400 <table class=headerdata> | |
| 401 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 402 <tr><td class=param>Database:</td><td></td></tr> | |
| 403 </table> | |
| 404 | |
| 405 </section> | |
| 406 | |
| 106 | 407 |
| 408 <section class=index> | |
| 114 | 409 <h2>Queries</h2> |
| 106 | 410 |
| 411 <div class=indexentry><a href="#match1"> | |
| 412 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 413 (20 letters, 0 hits) | |
| 414 </a></div> | |
| 415 <div class=indexentry><a href="#match2"> | |
| 416 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 417 (20 letters, 0 hits) | |
| 418 </a></div> | |
| 419 <div class=indexentry><a href="#match3"> | |
| 420 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 421 (20 letters, 1 hits) | |
| 422 </a></div> | |
| 423 <div class=indexentry><a href="#match4"> | |
| 424 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 425 (20 letters, 0 hits) | |
| 426 </a></div> | |
| 427 <div class=indexentry><a href="#match5"> | |
| 428 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 429 (20 letters, 0 hits) | |
| 430 </a></div> | |
| 431 <div class=indexentry><a href="#match6"> | |
| 432 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 433 (20 letters, 1 hits) | |
| 434 </a></div> | |
| 435 <div class=indexentry><a href="#match7"> | |
| 436 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 437 (20 letters, 0 hits) | |
| 438 </a></div> | |
| 439 <div class=indexentry><a href="#match8"> | |
| 440 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 441 (20 letters, 0 hits) | |
| 442 </a></div> | |
| 443 <div class=indexentry><a href="#match9"> | |
| 444 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 445 (20 letters, 0 hits) | |
| 446 </a></div> | |
| 447 <div class=indexentry><a href="#match10"> | |
| 448 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 449 (20 letters, 0 hits) | |
| 450 </a></div> | |
| 451 <div class=indexentry><a href="#match11"> | |
| 452 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 453 (20 letters, 0 hits) | |
| 454 </a></div> | |
| 455 <div class=indexentry><a href="#match12"> | |
| 456 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 457 (20 letters, 0 hits) | |
| 458 </a></div> | |
| 459 <div class=indexentry><a href="#match13"> | |
| 460 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 461 (20 letters, 0 hits) | |
| 462 </a></div> | |
| 463 <div class=indexentry><a href="#match14"> | |
| 464 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 465 (20 letters, 0 hits) | |
| 466 </a></div> | |
| 467 <div class=indexentry><a href="#match15"> | |
| 468 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 469 (20 letters, 0 hits) | |
| 470 </a></div> | |
| 471 <div class=indexentry><a href="#match16"> | |
| 472 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 473 (20 letters, 0 hits) | |
| 474 </a></div> | |
| 475 <div class=indexentry><a href="#match17"> | |
| 476 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 477 (20 letters, 0 hits) | |
| 478 </a></div> | |
| 479 <div class=indexentry><a href="#match18"> | |
| 480 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 481 (20 letters, 1 hits) | |
| 482 </a></div> | |
| 483 <div class=indexentry><a href="#match19"> | |
| 484 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 485 (20 letters, 1 hits) | |
| 486 </a></div> | |
| 487 <div class=indexentry><a href="#match20"> | |
| 488 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 489 (20 letters, 0 hits) | |
| 490 </a></div> | |
| 491 <div class=indexentry><a href="#match21"> | |
| 492 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 493 (20 letters, 0 hits) | |
| 494 </a></div> | |
| 495 <div class=indexentry><a href="#match22"> | |
| 496 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 497 (20 letters, 1 hits) | |
| 498 </a></div> | |
| 499 <div class=indexentry><a href="#match23"> | |
| 500 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 501 (20 letters, 0 hits) | |
| 502 </a></div> | |
| 503 <div class=indexentry><a href="#match24"> | |
| 504 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 505 (20 letters, 0 hits) | |
| 506 </a></div> | |
| 507 <div class=indexentry><a href="#match25"> | |
| 508 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 509 (24 letters, 0 hits) | |
| 510 </a></div> | |
| 511 <div class=indexentry><a href="#match26"> | |
| 512 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 513 (24 letters, 0 hits) | |
| 514 </a></div> | |
| 515 <div class=indexentry><a href="#match27"> | |
| 516 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 517 (24 letters, 0 hits) | |
| 518 </a></div> | |
| 519 <div class=indexentry><a href="#match28"> | |
| 520 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 521 (24 letters, 0 hits) | |
| 522 </a></div> | |
| 523 <div class=indexentry><a href="#match29"> | |
| 524 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 525 (24 letters, 0 hits) | |
| 526 </a></div> | |
| 527 <div class=indexentry><a href="#match30"> | |
| 528 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 529 (24 letters, 0 hits) | |
| 530 </a></div> | |
| 531 <div class=indexentry><a href="#match31"> | |
| 532 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 533 (24 letters, 0 hits) | |
| 534 </a></div> | |
| 535 <div class=indexentry><a href="#match32"> | |
| 536 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 537 (24 letters, 0 hits) | |
| 538 </a></div> | |
| 539 <div class=indexentry><a href="#match33"> | |
| 540 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 541 (20 letters, 0 hits) | |
| 542 </a></div> | |
| 543 <div class=indexentry><a href="#match34"> | |
| 544 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 545 (20 letters, 0 hits) | |
| 546 </a></div> | |
| 547 <div class=indexentry><a href="#match35"> | |
| 548 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 549 (20 letters, 0 hits) | |
| 550 </a></div> | |
| 551 <div class=indexentry><a href="#match36"> | |
| 552 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 553 (20 letters, 0 hits) | |
| 554 </a></div> | |
| 555 <div class=indexentry><a href="#match37"> | |
| 556 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 557 (20 letters, 0 hits) | |
| 558 </a></div> | |
| 559 <div class=indexentry><a href="#match38"> | |
| 560 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 561 (20 letters, 0 hits) | |
| 562 </a></div> | |
| 563 <div class=indexentry><a href="#match39"> | |
| 564 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 565 (20 letters, 0 hits) | |
| 566 </a></div> | |
| 567 <div class=indexentry><a href="#match40"> | |
| 568 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 569 (20 letters, 0 hits) | |
| 570 </a></div> | |
| 571 <div class=indexentry><a href="#match41"> | |
| 572 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 573 (25 letters, 0 hits) | |
| 574 </a></div> | |
| 575 <div class=indexentry><a href="#match42"> | |
| 576 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 577 (25 letters, 0 hits) | |
| 578 </a></div> | |
| 579 <div class=indexentry><a href="#match43"> | |
| 580 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 581 (25 letters, 0 hits) | |
| 582 </a></div> | |
| 583 <div class=indexentry><a href="#match44"> | |
| 584 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 585 (25 letters, 0 hits) | |
| 586 </a></div> | |
| 587 <div class=indexentry><a href="#match45"> | |
| 588 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 589 (25 letters, 0 hits) | |
| 590 </a></div> | |
| 591 <div class=indexentry><a href="#match46"> | |
| 592 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 593 (25 letters, 0 hits) | |
| 594 </a></div> | |
| 595 <div class=indexentry><a href="#match47"> | |
| 596 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 597 (25 letters, 1 hits) | |
| 598 </a></div> | |
| 599 <div class=indexentry><a href="#match48"> | |
| 600 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 601 (25 letters, 1 hits) | |
| 602 </a></div> | |
| 603 <div class=indexentry><a href="#match49"> | |
| 604 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 605 (74 letters, 0 hits) | |
| 606 </a></div> | |
| 607 <div class=indexentry><a href="#match50"> | |
| 608 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 609 (74 letters, 0 hits) | |
| 610 </a></div> | |
| 611 <div class=indexentry><a href="#match51"> | |
| 612 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 613 (74 letters, 0 hits) | |
| 614 </a></div> | |
| 615 <div class=indexentry><a href="#match52"> | |
| 616 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 617 (74 letters, 0 hits) | |
| 618 </a></div> | |
| 619 <div class=indexentry><a href="#match53"> | |
| 620 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 621 (74 letters, 0 hits) | |
| 622 </a></div> | |
| 623 <div class=indexentry><a href="#match54"> | |
| 624 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 625 (74 letters, 0 hits) | |
| 626 </a></div> | |
| 627 <div class=indexentry><a href="#match55"> | |
| 628 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 629 (74 letters, 1 hits) | |
| 630 </a></div> | |
| 631 <div class=indexentry><a href="#match56"> | |
| 632 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 633 (74 letters, 1 hits) | |
| 634 </a></div> | |
| 635 | |
| 636 </section> | |
| 637 | |
| 638 | |
| 639 <section class=match id=match1> | |
| 640 | |
| 114 | 641 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 642 |
| 643 <section class=header> | |
| 644 | |
| 645 <table class=headerdata> | |
| 114 | 646 <tr><td class=param>Query number:</td><td>1</td></tr> |
| 106 | 647 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> |
| 114 | 648 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> |
| 649 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 650 </table> |
| 651 | |
| 652 </section> | |
| 653 | |
| 654 <section> | |
| 114 | 655 <h3>No Hits</h3> |
| 106 | 656 <div class=grey> |
| 657 <table class=headerdata> | |
| 658 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 659 </table> | |
| 660 </div> | |
| 661 </section> | |
| 662 </section> | |
| 663 | |
| 664 <section class=match id=match2> | |
| 665 | |
| 114 | 666 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 667 |
| 668 <section class=header> | |
| 669 | |
| 670 <table class=headerdata> | |
| 114 | 671 <tr><td class=param>Query number:</td><td>2</td></tr> |
| 106 | 672 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> |
| 114 | 673 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> |
| 674 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 675 </table> |
| 676 | |
| 677 </section> | |
| 678 | |
| 679 <section> | |
| 114 | 680 <h3>No Hits</h3> |
| 106 | 681 <div class=grey> |
| 682 <table class=headerdata> | |
| 683 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 684 </table> | |
| 685 </div> | |
| 686 </section> | |
| 687 </section> | |
| 688 | |
| 689 <section class=match id=match3> | |
| 690 | |
| 114 | 691 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 692 |
| 693 <section class=header> | |
| 694 | |
| 695 <table class=headerdata> | |
| 114 | 696 <tr><td class=param>Query number:</td><td>3</td></tr> |
| 106 | 697 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> |
| 114 | 698 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> |
| 699 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 700 </table> |
| 701 | |
| 702 </section> | |
| 703 | |
| 704 | |
| 705 <section class=graphics> | |
| 114 | 706 <h3>Graphic Summary</h3> |
| 106 | 707 |
| 708 <div class=grey> | |
| 114 | 709 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> |
| 106 | 710 |
| 711 <div class=defline id=defline3> | |
| 712 Mouse-over to show defline and scores, click to show alignments | |
| 713 </div> | |
| 714 | |
| 715 <div class=graphic> | |
| 114 | 716 <h5 class=darkHeader>Color key for alignment scores</h5> |
| 106 | 717 <div class=legend><div class=graphicrow> |
| 718 <div class=graphicitem style="background-color: black"><40</div> | |
| 719 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 720 <div class=graphicitem style="background-color: green">50–80</div> | |
| 721 <div class=graphicitem style="background-color: magenta">80–200</div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
722 <div class=graphicitem style="background-color: red">≥200</div> |
| 106 | 723 </div></div> |
| 724 <div style="clear: left"></div> | |
| 725 | |
| 726 <div class=tablewrapper> | |
| 727 | |
| 728 <div class=scale> | |
| 729 <div>query:</div> | |
| 730 <div class=graphicrow> | |
| 731 <div> | |
| 732 <div class=graphicitem style="width: 10%"> | |
| 733 <div>2</div> | |
| 734 </div> | |
| 735 <div class=graphicitem style="width: 10%"> | |
| 736 <div>4</div> | |
| 737 </div> | |
| 738 <div class=graphicitem style="width: 10%"> | |
| 739 <div>6</div> | |
| 740 </div> | |
| 741 <div class=graphicitem style="width: 10%"> | |
| 742 <div>8</div> | |
| 743 </div> | |
| 744 <div class=graphicitem style="width: 10%"> | |
| 745 <div>10</div> | |
| 746 </div> | |
| 747 <div class=graphicitem style="width: 10%"> | |
| 748 <div>12</div> | |
| 749 </div> | |
| 750 <div class=graphicitem style="width: 10%"> | |
| 751 <div>14</div> | |
| 752 </div> | |
| 753 <div class=graphicitem style="width: 10%"> | |
| 754 <div>16</div> | |
| 755 </div> | |
| 756 <div class=graphicitem style="width: 10%"> | |
| 757 <div>18</div> | |
| 758 </div> | |
| 759 <div class=graphicitem style="width: 10%"> | |
| 760 <div>20</div> | |
| 761 </div> | |
| 762 </div> | |
| 763 </div> | |
| 764 <div style="clear: left"></div> | |
| 765 </div> | |
| 766 | |
| 767 <a class=matchresult | |
| 768 href="#hit3-1" | |
| 769 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | |
| 770 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 771 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 772 <div class="matchrow graphicrow"> | |
| 773 <div class="matchitem graphicitem" | |
| 774 style="background-color: black; width: 100%"></div> | |
| 775 </div> | |
| 776 </a> | |
| 777 | |
| 778 </div> | |
| 779 </div> | |
| 780 </div> | |
| 781 </section> | |
| 782 | |
| 783 | |
| 784 | |
| 785 <section class=descriptions> | |
| 114 | 786 <h3>Descriptions</h3> |
| 106 | 787 |
| 788 <div class=grey><div class=white> | |
| 114 | 789 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
| 106 | 790 |
| 791 <table class=descriptiontable> | |
| 792 <col/><col/><col/><col/><col/><col/><col/> | |
| 793 <tr> | |
| 794 <th>Description</th> | |
| 795 <th>Max score</th> | |
| 796 <th>Total score</th> | |
| 797 <th>Query cover</th> | |
| 798 <th>E value</th> | |
| 799 <th>Ident</th> | |
| 800 <th>Accession</th> | |
| 801 </tr> | |
| 802 <tr> | |
| 803 <td><div><a href="#hit3-1" | |
| 804 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | |
| 805 id="description3-1"> | |
| 806 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | |
| 807 </a></div></td> | |
| 808 <td>37.4</td> | |
| 809 <td>37.4</td> | |
| 810 <td>100%</td> | |
| 811 <td>7.011e-08</td> | |
| 812 <td>100%</td> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
813 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td> |
| 106 | 814 </tr> |
| 815 </table> | |
| 816 | |
| 817 </div></div> | |
| 818 </section> | |
| 819 | |
| 820 | |
| 821 | |
| 822 <section class=alignments> | |
| 114 | 823 <h3>Alignments</h3> |
| 106 | 824 |
| 825 <div class=grey><div class=white> | |
| 826 <div class=alignment id=hit3-1> | |
| 827 | |
| 828 <div class=linkheader> | |
| 829 <div class=right><a href="#description3-1">Descriptions</a></div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
830 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a> |
| 106 | 831 </div> |
| 832 | |
| 833 <div class=title> | |
| 834 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 835 <p class=titleinfo> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
836 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a> |
| 106 | 837 <span class=b>Length:</span> 323 |
| 838 <span class=b>Number of Matches:</span> 1 | |
| 839 </p> | |
| 840 </div> | |
| 841 | |
| 842 | |
| 843 <div class=hotspot id=hotspot3-1-1> | |
| 844 <p class=range> | |
| 845 <span class=range>Range 1: 200 to 219</span> | |
| 846 </p> | |
| 847 | |
| 848 <table class=hotspotstable> | |
| 849 <tr> | |
| 850 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 851 </tr> | |
| 852 <tr> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
853 <td>37.3537 bits (40)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
854 <td>7.01052e-08</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
855 <td>20/20 (100%)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
856 <td>0/20 (0%)</td> |
| 106 | 857 <td>Plus/Plus</td> |
| 858 </tr> | |
| 859 </table> | |
| 860 | |
| 861 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 862 |||||||||||||||||||| | |
| 863 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> | |
| 864 </div> | |
| 865 | |
| 866 </div> | |
| 867 | |
| 868 </div></div> | |
| 869 </section> | |
| 870 </section> | |
| 871 | |
| 872 <section class=match id=match4> | |
| 873 | |
| 114 | 874 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 875 |
| 876 <section class=header> | |
| 877 | |
| 878 <table class=headerdata> | |
| 114 | 879 <tr><td class=param>Query number:</td><td>4</td></tr> |
| 106 | 880 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> |
| 114 | 881 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> |
| 882 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 883 </table> |
| 884 | |
| 885 </section> | |
| 886 | |
| 887 <section> | |
| 114 | 888 <h3>No Hits</h3> |
| 106 | 889 <div class=grey> |
| 890 <table class=headerdata> | |
| 891 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 892 </table> | |
| 893 </div> | |
| 894 </section> | |
| 895 </section> | |
| 896 | |
| 897 <section class=match id=match5> | |
| 898 | |
| 114 | 899 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 900 |
| 901 <section class=header> | |
| 902 | |
| 903 <table class=headerdata> | |
| 114 | 904 <tr><td class=param>Query number:</td><td>5</td></tr> |
| 106 | 905 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> |
| 114 | 906 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> |
| 907 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 908 </table> |
| 909 | |
| 910 </section> | |
| 911 | |
| 912 <section> | |
| 114 | 913 <h3>No Hits</h3> |
| 106 | 914 <div class=grey> |
| 915 <table class=headerdata> | |
| 916 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 917 </table> | |
| 918 </div> | |
| 919 </section> | |
| 920 </section> | |
| 921 | |
| 922 <section class=match id=match6> | |
| 923 | |
| 114 | 924 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 925 |
| 926 <section class=header> | |
| 927 | |
| 928 <table class=headerdata> | |
| 114 | 929 <tr><td class=param>Query number:</td><td>6</td></tr> |
| 106 | 930 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> |
| 114 | 931 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> |
| 932 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 933 </table> |
| 934 | |
| 935 </section> | |
| 936 | |
| 937 | |
| 938 <section class=graphics> | |
| 114 | 939 <h3>Graphic Summary</h3> |
| 106 | 940 |
| 941 <div class=grey> | |
| 114 | 942 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> |
| 106 | 943 |
| 944 <div class=defline id=defline6> | |
| 945 Mouse-over to show defline and scores, click to show alignments | |
| 946 </div> | |
| 947 | |
| 948 <div class=graphic> | |
| 114 | 949 <h5 class=darkHeader>Color key for alignment scores</h5> |
| 106 | 950 <div class=legend><div class=graphicrow> |
| 951 <div class=graphicitem style="background-color: black"><40</div> | |
| 952 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 953 <div class=graphicitem style="background-color: green">50–80</div> | |
| 954 <div class=graphicitem style="background-color: magenta">80–200</div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
955 <div class=graphicitem style="background-color: red">≥200</div> |
| 106 | 956 </div></div> |
| 957 <div style="clear: left"></div> | |
| 958 | |
| 959 <div class=tablewrapper> | |
| 960 | |
| 961 <div class=scale> | |
| 962 <div>query:</div> | |
| 963 <div class=graphicrow> | |
| 964 <div> | |
| 965 <div class=graphicitem style="width: 10%"> | |
| 966 <div>2</div> | |
| 967 </div> | |
| 968 <div class=graphicitem style="width: 10%"> | |
| 969 <div>4</div> | |
| 970 </div> | |
| 971 <div class=graphicitem style="width: 10%"> | |
| 972 <div>6</div> | |
| 973 </div> | |
| 974 <div class=graphicitem style="width: 10%"> | |
| 975 <div>8</div> | |
| 976 </div> | |
| 977 <div class=graphicitem style="width: 10%"> | |
| 978 <div>10</div> | |
| 979 </div> | |
| 980 <div class=graphicitem style="width: 10%"> | |
| 981 <div>12</div> | |
| 982 </div> | |
| 983 <div class=graphicitem style="width: 10%"> | |
| 984 <div>14</div> | |
| 985 </div> | |
| 986 <div class=graphicitem style="width: 10%"> | |
| 987 <div>16</div> | |
| 988 </div> | |
| 989 <div class=graphicitem style="width: 10%"> | |
| 990 <div>18</div> | |
| 991 </div> | |
| 992 <div class=graphicitem style="width: 10%"> | |
| 993 <div>20</div> | |
| 994 </div> | |
| 995 </div> | |
| 996 </div> | |
| 997 <div style="clear: left"></div> | |
| 998 </div> | |
| 999 | |
| 1000 <a class=matchresult | |
| 1001 href="#hit6-1" | |
| 1002 onmouseover='document.getElementById("defline6").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | |
| 1003 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1004 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 1005 <div class="matchrow graphicrow"> | |
| 1006 <div class="matchitem graphicitem" | |
| 1007 style="background-color: black; width: 100%"></div> | |
| 1008 </div> | |
| 1009 </a> | |
| 1010 | |
| 1011 </div> | |
| 1012 </div> | |
| 1013 </div> | |
| 1014 </section> | |
| 1015 | |
| 1016 | |
| 1017 | |
| 1018 <section class=descriptions> | |
| 114 | 1019 <h3>Descriptions</h3> |
| 106 | 1020 |
| 1021 <div class=grey><div class=white> | |
| 114 | 1022 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
| 106 | 1023 |
| 1024 <table class=descriptiontable> | |
| 1025 <col/><col/><col/><col/><col/><col/><col/> | |
| 1026 <tr> | |
| 1027 <th>Description</th> | |
| 1028 <th>Max score</th> | |
| 1029 <th>Total score</th> | |
| 1030 <th>Query cover</th> | |
| 1031 <th>E value</th> | |
| 1032 <th>Ident</th> | |
| 1033 <th>Accession</th> | |
| 1034 </tr> | |
| 1035 <tr> | |
| 1036 <td><div><a href="#hit6-1" | |
| 1037 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | |
| 1038 id="description6-1"> | |
| 1039 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | |
| 1040 </a></div></td> | |
| 1041 <td>37.4</td> | |
| 1042 <td>37.4</td> | |
| 1043 <td>100%</td> | |
| 1044 <td>7.011e-08</td> | |
| 1045 <td>100%</td> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1046 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td> |
| 106 | 1047 </tr> |
| 1048 </table> | |
| 1049 | |
| 1050 </div></div> | |
| 1051 </section> | |
| 1052 | |
| 1053 | |
| 1054 | |
| 1055 <section class=alignments> | |
| 114 | 1056 <h3>Alignments</h3> |
| 106 | 1057 |
| 1058 <div class=grey><div class=white> | |
| 1059 <div class=alignment id=hit6-1> | |
| 1060 | |
| 1061 <div class=linkheader> | |
| 1062 <div class=right><a href="#description6-1">Descriptions</a></div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1063 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a> |
| 106 | 1064 </div> |
| 1065 | |
| 1066 <div class=title> | |
| 1067 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 1068 <p class=titleinfo> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1069 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a> |
| 106 | 1070 <span class=b>Length:</span> 2457 |
| 1071 <span class=b>Number of Matches:</span> 1 | |
| 1072 </p> | |
| 1073 </div> | |
| 1074 | |
| 1075 | |
| 1076 <div class=hotspot id=hotspot6-1-1> | |
| 1077 <p class=range> | |
| 1078 <span class=range>Range 1: 2119 to 2138</span> | |
| 1079 </p> | |
| 1080 | |
| 1081 <table class=hotspotstable> | |
| 1082 <tr> | |
| 1083 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1084 </tr> | |
| 1085 <tr> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1086 <td>37.3537 bits (40)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1087 <td>7.01052e-08</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1088 <td>20/20 (100%)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1089 <td>0/20 (0%)</td> |
| 106 | 1090 <td>Plus/Plus</td> |
| 1091 </tr> | |
| 1092 </table> | |
| 1093 | |
| 1094 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 1095 |||||||||||||||||||| | |
| 1096 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | |
| 1097 </div> | |
| 1098 | |
| 1099 </div> | |
| 1100 | |
| 1101 </div></div> | |
| 1102 </section> | |
| 1103 </section> | |
| 1104 | |
| 1105 <section class=match id=match7> | |
| 1106 | |
| 114 | 1107 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1108 |
| 1109 <section class=header> | |
| 1110 | |
| 1111 <table class=headerdata> | |
| 114 | 1112 <tr><td class=param>Query number:</td><td>7</td></tr> |
| 106 | 1113 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> |
| 114 | 1114 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> |
| 1115 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1116 </table> |
| 1117 | |
| 1118 </section> | |
| 1119 | |
| 1120 <section> | |
| 114 | 1121 <h3>No Hits</h3> |
| 106 | 1122 <div class=grey> |
| 1123 <table class=headerdata> | |
| 1124 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1125 </table> | |
| 1126 </div> | |
| 1127 </section> | |
| 1128 </section> | |
| 1129 | |
| 1130 <section class=match id=match8> | |
| 1131 | |
| 114 | 1132 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1133 |
| 1134 <section class=header> | |
| 1135 | |
| 1136 <table class=headerdata> | |
| 114 | 1137 <tr><td class=param>Query number:</td><td>8</td></tr> |
| 106 | 1138 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> |
| 114 | 1139 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> |
| 1140 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1141 </table> |
| 1142 | |
| 1143 </section> | |
| 1144 | |
| 1145 <section> | |
| 114 | 1146 <h3>No Hits</h3> |
| 106 | 1147 <div class=grey> |
| 1148 <table class=headerdata> | |
| 1149 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1150 </table> | |
| 1151 </div> | |
| 1152 </section> | |
| 1153 </section> | |
| 1154 | |
| 1155 <section class=match id=match9> | |
| 1156 | |
| 114 | 1157 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1158 |
| 1159 <section class=header> | |
| 1160 | |
| 1161 <table class=headerdata> | |
| 114 | 1162 <tr><td class=param>Query number:</td><td>9</td></tr> |
| 1163 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1164 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1165 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1166 </table> |
| 1167 | |
| 1168 </section> | |
| 1169 | |
| 1170 <section> | |
| 114 | 1171 <h3>No Hits</h3> |
| 106 | 1172 <div class=grey> |
| 1173 <table class=headerdata> | |
| 1174 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1175 </table> | |
| 1176 </div> | |
| 1177 </section> | |
| 1178 </section> | |
| 1179 | |
| 1180 <section class=match id=match10> | |
| 1181 | |
| 114 | 1182 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1183 |
| 1184 <section class=header> | |
| 1185 | |
| 1186 <table class=headerdata> | |
| 114 | 1187 <tr><td class=param>Query number:</td><td>10</td></tr> |
| 1188 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1189 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1190 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1191 </table> |
| 1192 | |
| 1193 </section> | |
| 1194 | |
| 1195 <section> | |
| 114 | 1196 <h3>No Hits</h3> |
| 106 | 1197 <div class=grey> |
| 1198 <table class=headerdata> | |
| 1199 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1200 </table> | |
| 1201 </div> | |
| 1202 </section> | |
| 1203 </section> | |
| 1204 | |
| 1205 <section class=match id=match11> | |
| 1206 | |
| 114 | 1207 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1208 |
| 1209 <section class=header> | |
| 1210 | |
| 1211 <table class=headerdata> | |
| 114 | 1212 <tr><td class=param>Query number:</td><td>11</td></tr> |
| 1213 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1214 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1215 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1216 </table> |
| 1217 | |
| 1218 </section> | |
| 1219 | |
| 1220 <section> | |
| 114 | 1221 <h3>No Hits</h3> |
| 106 | 1222 <div class=grey> |
| 1223 <table class=headerdata> | |
| 1224 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1225 </table> | |
| 1226 </div> | |
| 1227 </section> | |
| 1228 </section> | |
| 1229 | |
| 1230 <section class=match id=match12> | |
| 1231 | |
| 114 | 1232 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1233 |
| 1234 <section class=header> | |
| 1235 | |
| 1236 <table class=headerdata> | |
| 114 | 1237 <tr><td class=param>Query number:</td><td>12</td></tr> |
| 1238 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1239 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1240 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1241 </table> |
| 1242 | |
| 1243 </section> | |
| 1244 | |
| 1245 <section> | |
| 114 | 1246 <h3>No Hits</h3> |
| 106 | 1247 <div class=grey> |
| 1248 <table class=headerdata> | |
| 1249 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1250 </table> | |
| 1251 </div> | |
| 1252 </section> | |
| 1253 </section> | |
| 1254 | |
| 1255 <section class=match id=match13> | |
| 1256 | |
| 114 | 1257 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1258 |
| 1259 <section class=header> | |
| 1260 | |
| 1261 <table class=headerdata> | |
| 114 | 1262 <tr><td class=param>Query number:</td><td>13</td></tr> |
| 1263 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1264 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1265 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1266 </table> |
| 1267 | |
| 1268 </section> | |
| 1269 | |
| 1270 <section> | |
| 114 | 1271 <h3>No Hits</h3> |
| 106 | 1272 <div class=grey> |
| 1273 <table class=headerdata> | |
| 1274 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1275 </table> | |
| 1276 </div> | |
| 1277 </section> | |
| 1278 </section> | |
| 1279 | |
| 1280 <section class=match id=match14> | |
| 1281 | |
| 114 | 1282 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1283 |
| 1284 <section class=header> | |
| 1285 | |
| 1286 <table class=headerdata> | |
| 114 | 1287 <tr><td class=param>Query number:</td><td>14</td></tr> |
| 1288 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1289 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1290 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1291 </table> |
| 1292 | |
| 1293 </section> | |
| 1294 | |
| 1295 <section> | |
| 114 | 1296 <h3>No Hits</h3> |
| 106 | 1297 <div class=grey> |
| 1298 <table class=headerdata> | |
| 1299 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1300 </table> | |
| 1301 </div> | |
| 1302 </section> | |
| 1303 </section> | |
| 1304 | |
| 1305 <section class=match id=match15> | |
| 1306 | |
| 114 | 1307 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1308 |
| 1309 <section class=header> | |
| 1310 | |
| 1311 <table class=headerdata> | |
| 114 | 1312 <tr><td class=param>Query number:</td><td>15</td></tr> |
| 1313 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1314 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1315 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1316 </table> |
| 1317 | |
| 1318 </section> | |
| 1319 | |
| 1320 <section> | |
| 114 | 1321 <h3>No Hits</h3> |
| 106 | 1322 <div class=grey> |
| 1323 <table class=headerdata> | |
| 1324 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1325 </table> | |
| 1326 </div> | |
| 1327 </section> | |
| 1328 </section> | |
| 1329 | |
| 1330 <section class=match id=match16> | |
| 1331 | |
| 114 | 1332 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1333 |
| 1334 <section class=header> | |
| 1335 | |
| 1336 <table class=headerdata> | |
| 114 | 1337 <tr><td class=param>Query number:</td><td>16</td></tr> |
| 1338 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1339 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1340 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1341 </table> |
| 1342 | |
| 1343 </section> | |
| 1344 | |
| 1345 <section> | |
| 114 | 1346 <h3>No Hits</h3> |
| 106 | 1347 <div class=grey> |
| 1348 <table class=headerdata> | |
| 1349 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1350 </table> | |
| 1351 </div> | |
| 1352 </section> | |
| 1353 </section> | |
| 1354 | |
| 1355 <section class=match id=match17> | |
| 1356 | |
| 114 | 1357 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1358 |
| 1359 <section class=header> | |
| 1360 | |
| 1361 <table class=headerdata> | |
| 114 | 1362 <tr><td class=param>Query number:</td><td>17</td></tr> |
| 1363 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1364 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1365 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1366 </table> |
| 1367 | |
| 1368 </section> | |
| 1369 | |
| 1370 <section> | |
| 114 | 1371 <h3>No Hits</h3> |
| 106 | 1372 <div class=grey> |
| 1373 <table class=headerdata> | |
| 1374 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1375 </table> | |
| 1376 </div> | |
| 1377 </section> | |
| 1378 </section> | |
| 1379 | |
| 1380 <section class=match id=match18> | |
| 1381 | |
| 114 | 1382 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1383 |
| 1384 <section class=header> | |
| 1385 | |
| 1386 <table class=headerdata> | |
| 114 | 1387 <tr><td class=param>Query number:</td><td>18</td></tr> |
| 1388 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1389 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1390 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1391 </table> |
| 1392 | |
| 1393 </section> | |
| 1394 | |
| 1395 | |
| 1396 <section class=graphics> | |
| 114 | 1397 <h3>Graphic Summary</h3> |
| 106 | 1398 |
| 1399 <div class=grey> | |
| 114 | 1400 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> |
| 106 | 1401 |
| 1402 <div class=defline id=defline18> | |
| 1403 Mouse-over to show defline and scores, click to show alignments | |
| 1404 </div> | |
| 1405 | |
| 1406 <div class=graphic> | |
| 114 | 1407 <h5 class=darkHeader>Color key for alignment scores</h5> |
| 106 | 1408 <div class=legend><div class=graphicrow> |
| 1409 <div class=graphicitem style="background-color: black"><40</div> | |
| 1410 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1411 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1412 <div class=graphicitem style="background-color: magenta">80–200</div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1413 <div class=graphicitem style="background-color: red">≥200</div> |
| 106 | 1414 </div></div> |
| 1415 <div style="clear: left"></div> | |
| 1416 | |
| 1417 <div class=tablewrapper> | |
| 1418 | |
| 1419 <div class=scale> | |
| 1420 <div>query:</div> | |
| 1421 <div class=graphicrow> | |
| 1422 <div> | |
| 1423 <div class=graphicitem style="width: 10%"> | |
| 1424 <div>2</div> | |
| 1425 </div> | |
| 1426 <div class=graphicitem style="width: 10%"> | |
| 1427 <div>4</div> | |
| 1428 </div> | |
| 1429 <div class=graphicitem style="width: 10%"> | |
| 1430 <div>6</div> | |
| 1431 </div> | |
| 1432 <div class=graphicitem style="width: 10%"> | |
| 1433 <div>8</div> | |
| 1434 </div> | |
| 1435 <div class=graphicitem style="width: 10%"> | |
| 1436 <div>10</div> | |
| 1437 </div> | |
| 1438 <div class=graphicitem style="width: 10%"> | |
| 1439 <div>12</div> | |
| 1440 </div> | |
| 1441 <div class=graphicitem style="width: 10%"> | |
| 1442 <div>14</div> | |
| 1443 </div> | |
| 1444 <div class=graphicitem style="width: 10%"> | |
| 1445 <div>16</div> | |
| 1446 </div> | |
| 1447 <div class=graphicitem style="width: 10%"> | |
| 1448 <div>18</div> | |
| 1449 </div> | |
| 1450 <div class=graphicitem style="width: 10%"> | |
| 1451 <div>20</div> | |
| 1452 </div> | |
| 1453 </div> | |
| 1454 </div> | |
| 1455 <div style="clear: left"></div> | |
| 1456 </div> | |
| 1457 | |
| 1458 <a class=matchresult | |
| 1459 href="#hit18-1" | |
| 1460 onmouseover='document.getElementById("defline18").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' | |
| 1461 onmouseout='document.getElementById("defline18").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1462 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | |
| 1463 <div class="matchrow graphicrow"> | |
| 1464 <div class="matchitem graphicitem" | |
| 1465 style="background-color: transparent; width: 15%"></div> | |
| 1466 <div class="matchitem graphicitem" | |
| 1467 style="background-color: black; width: 85%"></div> | |
| 1468 </div> | |
| 1469 </a> | |
| 1470 | |
| 1471 </div> | |
| 1472 </div> | |
| 1473 </div> | |
| 1474 </section> | |
| 1475 | |
| 1476 | |
| 1477 | |
| 1478 <section class=descriptions> | |
| 114 | 1479 <h3>Descriptions</h3> |
| 106 | 1480 |
| 1481 <div class=grey><div class=white> | |
| 114 | 1482 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
| 106 | 1483 |
| 1484 <table class=descriptiontable> | |
| 1485 <col/><col/><col/><col/><col/><col/><col/> | |
| 1486 <tr> | |
| 1487 <th>Description</th> | |
| 1488 <th>Max score</th> | |
| 1489 <th>Total score</th> | |
| 1490 <th>Query cover</th> | |
| 1491 <th>E value</th> | |
| 1492 <th>Ident</th> | |
| 1493 <th>Accession</th> | |
| 1494 </tr> | |
| 1495 <tr> | |
| 1496 <td><div><a href="#hit18-1" | |
| 1497 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" | |
| 1498 id="description18-1"> | |
| 1499 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 | |
| 1500 </a></div></td> | |
| 1501 <td>31.9</td> | |
| 1502 <td>31.9</td> | |
| 1503 <td>85%</td> | |
| 1504 <td>2.981e-06</td> | |
| 1505 <td>100%</td> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1506 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_2">Subject_2</a></td> |
| 106 | 1507 </tr> |
| 1508 </table> | |
| 1509 | |
| 1510 </div></div> | |
| 1511 </section> | |
| 1512 | |
| 1513 | |
| 1514 | |
| 1515 <section class=alignments> | |
| 114 | 1516 <h3>Alignments</h3> |
| 106 | 1517 |
| 1518 <div class=grey><div class=white> | |
| 1519 <div class=alignment id=hit18-1> | |
| 1520 | |
| 1521 <div class=linkheader> | |
| 1522 <div class=right><a href="#description18-1">Descriptions</a></div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1523 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_2">Gene Bank</a> |
| 106 | 1524 </div> |
| 1525 | |
| 1526 <div class=title> | |
| 1527 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | |
| 1528 <p class=titleinfo> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1529 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_2">Subject_2</a> |
| 106 | 1530 <span class=b>Length:</span> 1045 |
| 1531 <span class=b>Number of Matches:</span> 1 | |
| 1532 </p> | |
| 1533 </div> | |
| 1534 | |
| 1535 | |
| 1536 <div class=hotspot id=hotspot18-1-1> | |
| 1537 <p class=range> | |
| 1538 <span class=range>Range 1: 2 to 18</span> | |
| 1539 </p> | |
| 1540 | |
| 1541 <table class=hotspotstable> | |
| 1542 <tr> | |
| 1543 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1544 </tr> | |
| 1545 <tr> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1546 <td>31.9436 bits (34)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1547 <td>2.98095e-06</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1548 <td>17/17 (100%)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1549 <td>0/17 (0%)</td> |
| 106 | 1550 <td>Plus/Plus</td> |
| 1551 </tr> | |
| 1552 </table> | |
| 1553 | |
| 1554 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | |
| 1555 ||||||||||||||||| | |
| 1556 Subject 2 GCGCGGTGTCATCTATG 18</pre> | |
| 1557 </div> | |
| 1558 | |
| 1559 </div> | |
| 1560 | |
| 1561 </div></div> | |
| 1562 </section> | |
| 1563 </section> | |
| 1564 | |
| 1565 <section class=match id=match19> | |
| 1566 | |
| 114 | 1567 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1568 |
| 1569 <section class=header> | |
| 1570 | |
| 1571 <table class=headerdata> | |
| 114 | 1572 <tr><td class=param>Query number:</td><td>19</td></tr> |
| 1573 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1574 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1575 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1576 </table> |
| 1577 | |
| 1578 </section> | |
| 1579 | |
| 1580 | |
| 1581 <section class=graphics> | |
| 114 | 1582 <h3>Graphic Summary</h3> |
| 106 | 1583 |
| 1584 <div class=grey> | |
| 114 | 1585 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> |
| 106 | 1586 |
| 1587 <div class=defline id=defline19> | |
| 1588 Mouse-over to show defline and scores, click to show alignments | |
| 1589 </div> | |
| 1590 | |
| 1591 <div class=graphic> | |
| 114 | 1592 <h5 class=darkHeader>Color key for alignment scores</h5> |
| 106 | 1593 <div class=legend><div class=graphicrow> |
| 1594 <div class=graphicitem style="background-color: black"><40</div> | |
| 1595 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1596 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1597 <div class=graphicitem style="background-color: magenta">80–200</div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1598 <div class=graphicitem style="background-color: red">≥200</div> |
| 106 | 1599 </div></div> |
| 1600 <div style="clear: left"></div> | |
| 1601 | |
| 1602 <div class=tablewrapper> | |
| 1603 | |
| 1604 <div class=scale> | |
| 1605 <div>query:</div> | |
| 1606 <div class=graphicrow> | |
| 1607 <div> | |
| 1608 <div class=graphicitem style="width: 10%"> | |
| 1609 <div>2</div> | |
| 1610 </div> | |
| 1611 <div class=graphicitem style="width: 10%"> | |
| 1612 <div>4</div> | |
| 1613 </div> | |
| 1614 <div class=graphicitem style="width: 10%"> | |
| 1615 <div>6</div> | |
| 1616 </div> | |
| 1617 <div class=graphicitem style="width: 10%"> | |
| 1618 <div>8</div> | |
| 1619 </div> | |
| 1620 <div class=graphicitem style="width: 10%"> | |
| 1621 <div>10</div> | |
| 1622 </div> | |
| 1623 <div class=graphicitem style="width: 10%"> | |
| 1624 <div>12</div> | |
| 1625 </div> | |
| 1626 <div class=graphicitem style="width: 10%"> | |
| 1627 <div>14</div> | |
| 1628 </div> | |
| 1629 <div class=graphicitem style="width: 10%"> | |
| 1630 <div>16</div> | |
| 1631 </div> | |
| 1632 <div class=graphicitem style="width: 10%"> | |
| 1633 <div>18</div> | |
| 1634 </div> | |
| 1635 <div class=graphicitem style="width: 10%"> | |
| 1636 <div>20</div> | |
| 1637 </div> | |
| 1638 </div> | |
| 1639 </div> | |
| 1640 <div style="clear: left"></div> | |
| 1641 </div> | |
| 1642 | |
| 1643 <a class=matchresult | |
| 1644 href="#hit19-1" | |
| 1645 onmouseover='document.getElementById("defline19").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | |
| 1646 onmouseout='document.getElementById("defline19").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1647 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 1648 <div class="matchrow graphicrow"> | |
| 1649 <div class="matchitem graphicitem" | |
| 1650 style="background-color: black; width: 100%"></div> | |
| 1651 </div> | |
| 1652 </a> | |
| 1653 | |
| 1654 </div> | |
| 1655 </div> | |
| 1656 </div> | |
| 1657 </section> | |
| 1658 | |
| 1659 | |
| 1660 | |
| 1661 <section class=descriptions> | |
| 114 | 1662 <h3>Descriptions</h3> |
| 106 | 1663 |
| 1664 <div class=grey><div class=white> | |
| 114 | 1665 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
| 106 | 1666 |
| 1667 <table class=descriptiontable> | |
| 1668 <col/><col/><col/><col/><col/><col/><col/> | |
| 1669 <tr> | |
| 1670 <th>Description</th> | |
| 1671 <th>Max score</th> | |
| 1672 <th>Total score</th> | |
| 1673 <th>Query cover</th> | |
| 1674 <th>E value</th> | |
| 1675 <th>Ident</th> | |
| 1676 <th>Accession</th> | |
| 1677 </tr> | |
| 1678 <tr> | |
| 1679 <td><div><a href="#hit19-1" | |
| 1680 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | |
| 1681 id="description19-1"> | |
| 1682 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | |
| 1683 </a></div></td> | |
| 1684 <td>37.4</td> | |
| 1685 <td>37.4</td> | |
| 1686 <td>100%</td> | |
| 1687 <td>7.011e-08</td> | |
| 1688 <td>100%</td> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1689 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td> |
| 106 | 1690 </tr> |
| 1691 </table> | |
| 1692 | |
| 1693 </div></div> | |
| 1694 </section> | |
| 1695 | |
| 1696 | |
| 1697 | |
| 1698 <section class=alignments> | |
| 114 | 1699 <h3>Alignments</h3> |
| 106 | 1700 |
| 1701 <div class=grey><div class=white> | |
| 1702 <div class=alignment id=hit19-1> | |
| 1703 | |
| 1704 <div class=linkheader> | |
| 1705 <div class=right><a href="#description19-1">Descriptions</a></div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1706 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a> |
| 106 | 1707 </div> |
| 1708 | |
| 1709 <div class=title> | |
| 1710 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 1711 <p class=titleinfo> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1712 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a> |
| 106 | 1713 <span class=b>Length:</span> 323 |
| 1714 <span class=b>Number of Matches:</span> 1 | |
| 1715 </p> | |
| 1716 </div> | |
| 1717 | |
| 1718 | |
| 1719 <div class=hotspot id=hotspot19-1-1> | |
| 1720 <p class=range> | |
| 1721 <span class=range>Range 1: 224 to 243</span> | |
| 1722 </p> | |
| 1723 | |
| 1724 <table class=hotspotstable> | |
| 1725 <tr> | |
| 1726 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1727 </tr> | |
| 1728 <tr> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1729 <td>37.3537 bits (40)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1730 <td>7.01052e-08</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1731 <td>20/20 (100%)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1732 <td>0/20 (0%)</td> |
| 106 | 1733 <td>Plus/Plus</td> |
| 1734 </tr> | |
| 1735 </table> | |
| 1736 | |
| 1737 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 1738 |||||||||||||||||||| | |
| 1739 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | |
| 1740 </div> | |
| 1741 | |
| 1742 </div> | |
| 1743 | |
| 1744 </div></div> | |
| 1745 </section> | |
| 1746 </section> | |
| 1747 | |
| 1748 <section class=match id=match20> | |
| 1749 | |
| 114 | 1750 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1751 |
| 1752 <section class=header> | |
| 1753 | |
| 1754 <table class=headerdata> | |
| 114 | 1755 <tr><td class=param>Query number:</td><td>20</td></tr> |
| 1756 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1757 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1758 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1759 </table> |
| 1760 | |
| 1761 </section> | |
| 1762 | |
| 1763 <section> | |
| 114 | 1764 <h3>No Hits</h3> |
| 106 | 1765 <div class=grey> |
| 1766 <table class=headerdata> | |
| 1767 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1768 </table> | |
| 1769 </div> | |
| 1770 </section> | |
| 1771 </section> | |
| 1772 | |
| 1773 <section class=match id=match21> | |
| 1774 | |
| 114 | 1775 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1776 |
| 1777 <section class=header> | |
| 1778 | |
| 1779 <table class=headerdata> | |
| 114 | 1780 <tr><td class=param>Query number:</td><td>21</td></tr> |
| 1781 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1782 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1783 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1784 </table> |
| 1785 | |
| 1786 </section> | |
| 1787 | |
| 1788 <section> | |
| 114 | 1789 <h3>No Hits</h3> |
| 106 | 1790 <div class=grey> |
| 1791 <table class=headerdata> | |
| 1792 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1793 </table> | |
| 1794 </div> | |
| 1795 </section> | |
| 1796 </section> | |
| 1797 | |
| 1798 <section class=match id=match22> | |
| 1799 | |
| 114 | 1800 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1801 |
| 1802 <section class=header> | |
| 1803 | |
| 1804 <table class=headerdata> | |
| 114 | 1805 <tr><td class=param>Query number:</td><td>22</td></tr> |
| 1806 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1807 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1808 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1809 </table> |
| 1810 | |
| 1811 </section> | |
| 1812 | |
| 1813 | |
| 1814 <section class=graphics> | |
| 114 | 1815 <h3>Graphic Summary</h3> |
| 106 | 1816 |
| 1817 <div class=grey> | |
| 114 | 1818 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> |
| 106 | 1819 |
| 1820 <div class=defline id=defline22> | |
| 1821 Mouse-over to show defline and scores, click to show alignments | |
| 1822 </div> | |
| 1823 | |
| 1824 <div class=graphic> | |
| 114 | 1825 <h5 class=darkHeader>Color key for alignment scores</h5> |
| 106 | 1826 <div class=legend><div class=graphicrow> |
| 1827 <div class=graphicitem style="background-color: black"><40</div> | |
| 1828 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1829 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1830 <div class=graphicitem style="background-color: magenta">80–200</div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1831 <div class=graphicitem style="background-color: red">≥200</div> |
| 106 | 1832 </div></div> |
| 1833 <div style="clear: left"></div> | |
| 1834 | |
| 1835 <div class=tablewrapper> | |
| 1836 | |
| 1837 <div class=scale> | |
| 1838 <div>query:</div> | |
| 1839 <div class=graphicrow> | |
| 1840 <div> | |
| 1841 <div class=graphicitem style="width: 10%"> | |
| 1842 <div>2</div> | |
| 1843 </div> | |
| 1844 <div class=graphicitem style="width: 10%"> | |
| 1845 <div>4</div> | |
| 1846 </div> | |
| 1847 <div class=graphicitem style="width: 10%"> | |
| 1848 <div>6</div> | |
| 1849 </div> | |
| 1850 <div class=graphicitem style="width: 10%"> | |
| 1851 <div>8</div> | |
| 1852 </div> | |
| 1853 <div class=graphicitem style="width: 10%"> | |
| 1854 <div>10</div> | |
| 1855 </div> | |
| 1856 <div class=graphicitem style="width: 10%"> | |
| 1857 <div>12</div> | |
| 1858 </div> | |
| 1859 <div class=graphicitem style="width: 10%"> | |
| 1860 <div>14</div> | |
| 1861 </div> | |
| 1862 <div class=graphicitem style="width: 10%"> | |
| 1863 <div>16</div> | |
| 1864 </div> | |
| 1865 <div class=graphicitem style="width: 10%"> | |
| 1866 <div>18</div> | |
| 1867 </div> | |
| 1868 <div class=graphicitem style="width: 10%"> | |
| 1869 <div>20</div> | |
| 1870 </div> | |
| 1871 </div> | |
| 1872 </div> | |
| 1873 <div style="clear: left"></div> | |
| 1874 </div> | |
| 1875 | |
| 1876 <a class=matchresult | |
| 1877 href="#hit22-1" | |
| 1878 onmouseover='document.getElementById("defline22").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | |
| 1879 onmouseout='document.getElementById("defline22").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1880 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 1881 <div class="matchrow graphicrow"> | |
| 1882 <div class="matchitem graphicitem" | |
| 1883 style="background-color: black; width: 100%"></div> | |
| 1884 </div> | |
| 1885 </a> | |
| 1886 | |
| 1887 </div> | |
| 1888 </div> | |
| 1889 </div> | |
| 1890 </section> | |
| 1891 | |
| 1892 | |
| 1893 | |
| 1894 <section class=descriptions> | |
| 114 | 1895 <h3>Descriptions</h3> |
| 106 | 1896 |
| 1897 <div class=grey><div class=white> | |
| 114 | 1898 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
| 106 | 1899 |
| 1900 <table class=descriptiontable> | |
| 1901 <col/><col/><col/><col/><col/><col/><col/> | |
| 1902 <tr> | |
| 1903 <th>Description</th> | |
| 1904 <th>Max score</th> | |
| 1905 <th>Total score</th> | |
| 1906 <th>Query cover</th> | |
| 1907 <th>E value</th> | |
| 1908 <th>Ident</th> | |
| 1909 <th>Accession</th> | |
| 1910 </tr> | |
| 1911 <tr> | |
| 1912 <td><div><a href="#hit22-1" | |
| 1913 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | |
| 1914 id="description22-1"> | |
| 1915 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | |
| 1916 </a></div></td> | |
| 1917 <td>37.4</td> | |
| 1918 <td>37.4</td> | |
| 1919 <td>100%</td> | |
| 1920 <td>7.011e-08</td> | |
| 1921 <td>100%</td> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1922 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td> |
| 106 | 1923 </tr> |
| 1924 </table> | |
| 1925 | |
| 1926 </div></div> | |
| 1927 </section> | |
| 1928 | |
| 1929 | |
| 1930 | |
| 1931 <section class=alignments> | |
| 114 | 1932 <h3>Alignments</h3> |
| 106 | 1933 |
| 1934 <div class=grey><div class=white> | |
| 1935 <div class=alignment id=hit22-1> | |
| 1936 | |
| 1937 <div class=linkheader> | |
| 1938 <div class=right><a href="#description22-1">Descriptions</a></div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1939 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a> |
| 106 | 1940 </div> |
| 1941 | |
| 1942 <div class=title> | |
| 1943 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 1944 <p class=titleinfo> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1945 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a> |
| 106 | 1946 <span class=b>Length:</span> 2457 |
| 1947 <span class=b>Number of Matches:</span> 1 | |
| 1948 </p> | |
| 1949 </div> | |
| 1950 | |
| 1951 | |
| 1952 <div class=hotspot id=hotspot22-1-1> | |
| 1953 <p class=range> | |
| 1954 <span class=range>Range 1: 2143 to 2162</span> | |
| 1955 </p> | |
| 1956 | |
| 1957 <table class=hotspotstable> | |
| 1958 <tr> | |
| 1959 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1960 </tr> | |
| 1961 <tr> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1962 <td>37.3537 bits (40)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1963 <td>7.01052e-08</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1964 <td>20/20 (100%)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
1965 <td>0/20 (0%)</td> |
| 106 | 1966 <td>Plus/Plus</td> |
| 1967 </tr> | |
| 1968 </table> | |
| 1969 | |
| 1970 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 1971 |||||||||||||||||||| | |
| 1972 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | |
| 1973 </div> | |
| 1974 | |
| 1975 </div> | |
| 1976 | |
| 1977 </div></div> | |
| 1978 </section> | |
| 1979 </section> | |
| 1980 | |
| 1981 <section class=match id=match23> | |
| 1982 | |
| 114 | 1983 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 1984 |
| 1985 <section class=header> | |
| 1986 | |
| 1987 <table class=headerdata> | |
| 114 | 1988 <tr><td class=param>Query number:</td><td>23</td></tr> |
| 1989 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1990 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1991 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1992 </table> |
| 1993 | |
| 1994 </section> | |
| 1995 | |
| 1996 <section> | |
| 114 | 1997 <h3>No Hits</h3> |
| 106 | 1998 <div class=grey> |
| 1999 <table class=headerdata> | |
| 2000 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2001 </table> | |
| 2002 </div> | |
| 2003 </section> | |
| 2004 </section> | |
| 2005 | |
| 2006 <section class=match id=match24> | |
| 2007 | |
| 114 | 2008 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 2009 |
| 2010 <section class=header> | |
| 2011 | |
| 2012 <table class=headerdata> | |
| 114 | 2013 <tr><td class=param>Query number:</td><td>24</td></tr> |
| 2014 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 2015 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2016 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2017 </table> |
| 2018 | |
| 2019 </section> | |
| 2020 | |
| 2021 <section> | |
| 114 | 2022 <h3>No Hits</h3> |
| 106 | 2023 <div class=grey> |
| 2024 <table class=headerdata> | |
| 2025 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2026 </table> | |
| 2027 </div> | |
| 2028 </section> | |
| 2029 </section> | |
| 2030 | |
| 2031 <section class=match id=match25> | |
| 2032 | |
| 114 | 2033 <h2>Nucleotide Sequence (24 letters)</h2> |
| 106 | 2034 |
| 2035 <section class=header> | |
| 2036 | |
| 2037 <table class=headerdata> | |
| 114 | 2038 <tr><td class=param>Query number:</td><td>25</td></tr> |
| 2039 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2040 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2041 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2042 </table> |
| 2043 | |
| 2044 </section> | |
| 2045 | |
| 2046 <section> | |
| 114 | 2047 <h3>No Hits</h3> |
| 106 | 2048 <div class=grey> |
| 2049 <table class=headerdata> | |
| 2050 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2051 </table> | |
| 2052 </div> | |
| 2053 </section> | |
| 2054 </section> | |
| 2055 | |
| 2056 <section class=match id=match26> | |
| 2057 | |
| 114 | 2058 <h2>Nucleotide Sequence (24 letters)</h2> |
| 106 | 2059 |
| 2060 <section class=header> | |
| 2061 | |
| 2062 <table class=headerdata> | |
| 114 | 2063 <tr><td class=param>Query number:</td><td>26</td></tr> |
| 2064 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2065 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2066 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2067 </table> |
| 2068 | |
| 2069 </section> | |
| 2070 | |
| 2071 <section> | |
| 114 | 2072 <h3>No Hits</h3> |
| 106 | 2073 <div class=grey> |
| 2074 <table class=headerdata> | |
| 2075 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2076 </table> | |
| 2077 </div> | |
| 2078 </section> | |
| 2079 </section> | |
| 2080 | |
| 2081 <section class=match id=match27> | |
| 2082 | |
| 114 | 2083 <h2>Nucleotide Sequence (24 letters)</h2> |
| 106 | 2084 |
| 2085 <section class=header> | |
| 2086 | |
| 2087 <table class=headerdata> | |
| 114 | 2088 <tr><td class=param>Query number:</td><td>27</td></tr> |
| 2089 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2090 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2091 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2092 </table> |
| 2093 | |
| 2094 </section> | |
| 2095 | |
| 2096 <section> | |
| 114 | 2097 <h3>No Hits</h3> |
| 106 | 2098 <div class=grey> |
| 2099 <table class=headerdata> | |
| 2100 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2101 </table> | |
| 2102 </div> | |
| 2103 </section> | |
| 2104 </section> | |
| 2105 | |
| 2106 <section class=match id=match28> | |
| 2107 | |
| 114 | 2108 <h2>Nucleotide Sequence (24 letters)</h2> |
| 106 | 2109 |
| 2110 <section class=header> | |
| 2111 | |
| 2112 <table class=headerdata> | |
| 114 | 2113 <tr><td class=param>Query number:</td><td>28</td></tr> |
| 2114 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2115 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2116 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2117 </table> |
| 2118 | |
| 2119 </section> | |
| 2120 | |
| 2121 <section> | |
| 114 | 2122 <h3>No Hits</h3> |
| 106 | 2123 <div class=grey> |
| 2124 <table class=headerdata> | |
| 2125 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2126 </table> | |
| 2127 </div> | |
| 2128 </section> | |
| 2129 </section> | |
| 2130 | |
| 2131 <section class=match id=match29> | |
| 2132 | |
| 114 | 2133 <h2>Nucleotide Sequence (24 letters)</h2> |
| 106 | 2134 |
| 2135 <section class=header> | |
| 2136 | |
| 2137 <table class=headerdata> | |
| 114 | 2138 <tr><td class=param>Query number:</td><td>29</td></tr> |
| 2139 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2140 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2141 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2142 </table> |
| 2143 | |
| 2144 </section> | |
| 2145 | |
| 2146 <section> | |
| 114 | 2147 <h3>No Hits</h3> |
| 106 | 2148 <div class=grey> |
| 2149 <table class=headerdata> | |
| 2150 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2151 </table> | |
| 2152 </div> | |
| 2153 </section> | |
| 2154 </section> | |
| 2155 | |
| 2156 <section class=match id=match30> | |
| 2157 | |
| 114 | 2158 <h2>Nucleotide Sequence (24 letters)</h2> |
| 106 | 2159 |
| 2160 <section class=header> | |
| 2161 | |
| 2162 <table class=headerdata> | |
| 114 | 2163 <tr><td class=param>Query number:</td><td>30</td></tr> |
| 2164 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2165 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2166 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2167 </table> |
| 2168 | |
| 2169 </section> | |
| 2170 | |
| 2171 <section> | |
| 114 | 2172 <h3>No Hits</h3> |
| 106 | 2173 <div class=grey> |
| 2174 <table class=headerdata> | |
| 2175 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2176 </table> | |
| 2177 </div> | |
| 2178 </section> | |
| 2179 </section> | |
| 2180 | |
| 2181 <section class=match id=match31> | |
| 2182 | |
| 114 | 2183 <h2>Nucleotide Sequence (24 letters)</h2> |
| 106 | 2184 |
| 2185 <section class=header> | |
| 2186 | |
| 2187 <table class=headerdata> | |
| 114 | 2188 <tr><td class=param>Query number:</td><td>31</td></tr> |
| 2189 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2190 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2191 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2192 </table> |
| 2193 | |
| 2194 </section> | |
| 2195 | |
| 2196 <section> | |
| 114 | 2197 <h3>No Hits</h3> |
| 106 | 2198 <div class=grey> |
| 2199 <table class=headerdata> | |
| 2200 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2201 </table> | |
| 2202 </div> | |
| 2203 </section> | |
| 2204 </section> | |
| 2205 | |
| 2206 <section class=match id=match32> | |
| 2207 | |
| 114 | 2208 <h2>Nucleotide Sequence (24 letters)</h2> |
| 106 | 2209 |
| 2210 <section class=header> | |
| 2211 | |
| 2212 <table class=headerdata> | |
| 114 | 2213 <tr><td class=param>Query number:</td><td>32</td></tr> |
| 2214 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2215 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2216 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2217 </table> |
| 2218 | |
| 2219 </section> | |
| 2220 | |
| 2221 <section> | |
| 114 | 2222 <h3>No Hits</h3> |
| 106 | 2223 <div class=grey> |
| 2224 <table class=headerdata> | |
| 2225 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2226 </table> | |
| 2227 </div> | |
| 2228 </section> | |
| 2229 </section> | |
| 2230 | |
| 2231 <section class=match id=match33> | |
| 2232 | |
| 114 | 2233 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 2234 |
| 2235 <section class=header> | |
| 2236 | |
| 2237 <table class=headerdata> | |
| 114 | 2238 <tr><td class=param>Query number:</td><td>33</td></tr> |
| 2239 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2240 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2241 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2242 </table> |
| 2243 | |
| 2244 </section> | |
| 2245 | |
| 2246 <section> | |
| 114 | 2247 <h3>No Hits</h3> |
| 106 | 2248 <div class=grey> |
| 2249 <table class=headerdata> | |
| 2250 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2251 </table> | |
| 2252 </div> | |
| 2253 </section> | |
| 2254 </section> | |
| 2255 | |
| 2256 <section class=match id=match34> | |
| 2257 | |
| 114 | 2258 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 2259 |
| 2260 <section class=header> | |
| 2261 | |
| 2262 <table class=headerdata> | |
| 114 | 2263 <tr><td class=param>Query number:</td><td>34</td></tr> |
| 2264 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2265 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2266 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2267 </table> |
| 2268 | |
| 2269 </section> | |
| 2270 | |
| 2271 <section> | |
| 114 | 2272 <h3>No Hits</h3> |
| 106 | 2273 <div class=grey> |
| 2274 <table class=headerdata> | |
| 2275 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2276 </table> | |
| 2277 </div> | |
| 2278 </section> | |
| 2279 </section> | |
| 2280 | |
| 2281 <section class=match id=match35> | |
| 2282 | |
| 114 | 2283 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 2284 |
| 2285 <section class=header> | |
| 2286 | |
| 2287 <table class=headerdata> | |
| 114 | 2288 <tr><td class=param>Query number:</td><td>35</td></tr> |
| 2289 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2290 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2291 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2292 </table> |
| 2293 | |
| 2294 </section> | |
| 2295 | |
| 2296 <section> | |
| 114 | 2297 <h3>No Hits</h3> |
| 106 | 2298 <div class=grey> |
| 2299 <table class=headerdata> | |
| 2300 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2301 </table> | |
| 2302 </div> | |
| 2303 </section> | |
| 2304 </section> | |
| 2305 | |
| 2306 <section class=match id=match36> | |
| 2307 | |
| 114 | 2308 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 2309 |
| 2310 <section class=header> | |
| 2311 | |
| 2312 <table class=headerdata> | |
| 114 | 2313 <tr><td class=param>Query number:</td><td>36</td></tr> |
| 2314 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2315 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2316 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2317 </table> |
| 2318 | |
| 2319 </section> | |
| 2320 | |
| 2321 <section> | |
| 114 | 2322 <h3>No Hits</h3> |
| 106 | 2323 <div class=grey> |
| 2324 <table class=headerdata> | |
| 2325 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2326 </table> | |
| 2327 </div> | |
| 2328 </section> | |
| 2329 </section> | |
| 2330 | |
| 2331 <section class=match id=match37> | |
| 2332 | |
| 114 | 2333 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 2334 |
| 2335 <section class=header> | |
| 2336 | |
| 2337 <table class=headerdata> | |
| 114 | 2338 <tr><td class=param>Query number:</td><td>37</td></tr> |
| 2339 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2340 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2341 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2342 </table> |
| 2343 | |
| 2344 </section> | |
| 2345 | |
| 2346 <section> | |
| 114 | 2347 <h3>No Hits</h3> |
| 106 | 2348 <div class=grey> |
| 2349 <table class=headerdata> | |
| 2350 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2351 </table> | |
| 2352 </div> | |
| 2353 </section> | |
| 2354 </section> | |
| 2355 | |
| 2356 <section class=match id=match38> | |
| 2357 | |
| 114 | 2358 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 2359 |
| 2360 <section class=header> | |
| 2361 | |
| 2362 <table class=headerdata> | |
| 114 | 2363 <tr><td class=param>Query number:</td><td>38</td></tr> |
| 2364 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2365 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2366 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2367 </table> |
| 2368 | |
| 2369 </section> | |
| 2370 | |
| 2371 <section> | |
| 114 | 2372 <h3>No Hits</h3> |
| 106 | 2373 <div class=grey> |
| 2374 <table class=headerdata> | |
| 2375 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2376 </table> | |
| 2377 </div> | |
| 2378 </section> | |
| 2379 </section> | |
| 2380 | |
| 2381 <section class=match id=match39> | |
| 2382 | |
| 114 | 2383 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 2384 |
| 2385 <section class=header> | |
| 2386 | |
| 2387 <table class=headerdata> | |
| 114 | 2388 <tr><td class=param>Query number:</td><td>39</td></tr> |
| 2389 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2390 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2391 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2392 </table> |
| 2393 | |
| 2394 </section> | |
| 2395 | |
| 2396 <section> | |
| 114 | 2397 <h3>No Hits</h3> |
| 106 | 2398 <div class=grey> |
| 2399 <table class=headerdata> | |
| 2400 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2401 </table> | |
| 2402 </div> | |
| 2403 </section> | |
| 2404 </section> | |
| 2405 | |
| 2406 <section class=match id=match40> | |
| 2407 | |
| 114 | 2408 <h2>Nucleotide Sequence (20 letters)</h2> |
| 106 | 2409 |
| 2410 <section class=header> | |
| 2411 | |
| 2412 <table class=headerdata> | |
| 114 | 2413 <tr><td class=param>Query number:</td><td>40</td></tr> |
| 2414 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2415 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2416 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2417 </table> |
| 2418 | |
| 2419 </section> | |
| 2420 | |
| 2421 <section> | |
| 114 | 2422 <h3>No Hits</h3> |
| 106 | 2423 <div class=grey> |
| 2424 <table class=headerdata> | |
| 2425 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2426 </table> | |
| 2427 </div> | |
| 2428 </section> | |
| 2429 </section> | |
| 2430 | |
| 2431 <section class=match id=match41> | |
| 2432 | |
| 114 | 2433 <h2>Nucleotide Sequence (25 letters)</h2> |
| 106 | 2434 |
| 2435 <section class=header> | |
| 2436 | |
| 2437 <table class=headerdata> | |
| 114 | 2438 <tr><td class=param>Query number:</td><td>41</td></tr> |
| 2439 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2440 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2441 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2442 </table> |
| 2443 | |
| 2444 </section> | |
| 2445 | |
| 2446 <section> | |
| 114 | 2447 <h3>No Hits</h3> |
| 106 | 2448 <div class=grey> |
| 2449 <table class=headerdata> | |
| 2450 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2451 </table> | |
| 2452 </div> | |
| 2453 </section> | |
| 2454 </section> | |
| 2455 | |
| 2456 <section class=match id=match42> | |
| 2457 | |
| 114 | 2458 <h2>Nucleotide Sequence (25 letters)</h2> |
| 106 | 2459 |
| 2460 <section class=header> | |
| 2461 | |
| 2462 <table class=headerdata> | |
| 114 | 2463 <tr><td class=param>Query number:</td><td>42</td></tr> |
| 2464 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2465 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2466 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2467 </table> |
| 2468 | |
| 2469 </section> | |
| 2470 | |
| 2471 <section> | |
| 114 | 2472 <h3>No Hits</h3> |
| 106 | 2473 <div class=grey> |
| 2474 <table class=headerdata> | |
| 2475 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2476 </table> | |
| 2477 </div> | |
| 2478 </section> | |
| 2479 </section> | |
| 2480 | |
| 2481 <section class=match id=match43> | |
| 2482 | |
| 114 | 2483 <h2>Nucleotide Sequence (25 letters)</h2> |
| 106 | 2484 |
| 2485 <section class=header> | |
| 2486 | |
| 2487 <table class=headerdata> | |
| 114 | 2488 <tr><td class=param>Query number:</td><td>43</td></tr> |
| 2489 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2490 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2491 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2492 </table> |
| 2493 | |
| 2494 </section> | |
| 2495 | |
| 2496 <section> | |
| 114 | 2497 <h3>No Hits</h3> |
| 106 | 2498 <div class=grey> |
| 2499 <table class=headerdata> | |
| 2500 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2501 </table> | |
| 2502 </div> | |
| 2503 </section> | |
| 2504 </section> | |
| 2505 | |
| 2506 <section class=match id=match44> | |
| 2507 | |
| 114 | 2508 <h2>Nucleotide Sequence (25 letters)</h2> |
| 106 | 2509 |
| 2510 <section class=header> | |
| 2511 | |
| 2512 <table class=headerdata> | |
| 114 | 2513 <tr><td class=param>Query number:</td><td>44</td></tr> |
| 2514 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2515 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2516 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2517 </table> |
| 2518 | |
| 2519 </section> | |
| 2520 | |
| 2521 <section> | |
| 114 | 2522 <h3>No Hits</h3> |
| 106 | 2523 <div class=grey> |
| 2524 <table class=headerdata> | |
| 2525 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2526 </table> | |
| 2527 </div> | |
| 2528 </section> | |
| 2529 </section> | |
| 2530 | |
| 2531 <section class=match id=match45> | |
| 2532 | |
| 114 | 2533 <h2>Nucleotide Sequence (25 letters)</h2> |
| 106 | 2534 |
| 2535 <section class=header> | |
| 2536 | |
| 2537 <table class=headerdata> | |
| 114 | 2538 <tr><td class=param>Query number:</td><td>45</td></tr> |
| 2539 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2540 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2541 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2542 </table> |
| 2543 | |
| 2544 </section> | |
| 2545 | |
| 2546 <section> | |
| 114 | 2547 <h3>No Hits</h3> |
| 106 | 2548 <div class=grey> |
| 2549 <table class=headerdata> | |
| 2550 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2551 </table> | |
| 2552 </div> | |
| 2553 </section> | |
| 2554 </section> | |
| 2555 | |
| 2556 <section class=match id=match46> | |
| 2557 | |
| 114 | 2558 <h2>Nucleotide Sequence (25 letters)</h2> |
| 106 | 2559 |
| 2560 <section class=header> | |
| 2561 | |
| 2562 <table class=headerdata> | |
| 114 | 2563 <tr><td class=param>Query number:</td><td>46</td></tr> |
| 2564 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2565 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2566 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2567 </table> |
| 2568 | |
| 2569 </section> | |
| 2570 | |
| 2571 <section> | |
| 114 | 2572 <h3>No Hits</h3> |
| 106 | 2573 <div class=grey> |
| 2574 <table class=headerdata> | |
| 2575 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2576 </table> | |
| 2577 </div> | |
| 2578 </section> | |
| 2579 </section> | |
| 2580 | |
| 2581 <section class=match id=match47> | |
| 2582 | |
| 114 | 2583 <h2>Nucleotide Sequence (25 letters)</h2> |
| 106 | 2584 |
| 2585 <section class=header> | |
| 2586 | |
| 2587 <table class=headerdata> | |
| 114 | 2588 <tr><td class=param>Query number:</td><td>47</td></tr> |
| 2589 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2590 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2591 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2592 </table> |
| 2593 | |
| 2594 </section> | |
| 2595 | |
| 2596 | |
| 2597 <section class=graphics> | |
| 114 | 2598 <h3>Graphic Summary</h3> |
| 106 | 2599 |
| 2600 <div class=grey> | |
| 114 | 2601 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> |
| 106 | 2602 |
| 2603 <div class=defline id=defline47> | |
| 2604 Mouse-over to show defline and scores, click to show alignments | |
| 2605 </div> | |
| 2606 | |
| 2607 <div class=graphic> | |
| 114 | 2608 <h5 class=darkHeader>Color key for alignment scores</h5> |
| 106 | 2609 <div class=legend><div class=graphicrow> |
| 2610 <div class=graphicitem style="background-color: black"><40</div> | |
| 2611 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 2612 <div class=graphicitem style="background-color: green">50–80</div> | |
| 2613 <div class=graphicitem style="background-color: magenta">80–200</div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2614 <div class=graphicitem style="background-color: red">≥200</div> |
| 106 | 2615 </div></div> |
| 2616 <div style="clear: left"></div> | |
| 2617 | |
| 2618 <div class=tablewrapper> | |
| 2619 | |
| 2620 <div class=scale> | |
| 2621 <div>query:</div> | |
| 2622 <div class=graphicrow> | |
| 2623 <div> | |
| 2624 <div class=graphicitem style="width: 12%"> | |
| 2625 <div>3</div> | |
| 2626 </div> | |
| 2627 <div class=graphicitem style="width: 12%"> | |
| 2628 <div>6</div> | |
| 2629 </div> | |
| 2630 <div class=graphicitem style="width: 12%"> | |
| 2631 <div>9</div> | |
| 2632 </div> | |
| 2633 <div class=graphicitem style="width: 12%"> | |
| 2634 <div>12</div> | |
| 2635 </div> | |
| 2636 <div class=graphicitem style="width: 12%"> | |
| 2637 <div>15</div> | |
| 2638 </div> | |
| 2639 <div class=graphicitem style="width: 12%"> | |
| 2640 <div>18</div> | |
| 2641 </div> | |
| 2642 <div class=graphicitem style="width: 12%"> | |
| 2643 <div>21</div> | |
| 2644 </div> | |
| 2645 <div class=graphicitem style="width: 12%"> | |
| 2646 <div>24</div> | |
| 2647 </div> | |
| 2648 <div class=graphicitem style="width: 4%"> | |
| 2649 <div>25</div> | |
| 2650 </div> | |
| 2651 </div> | |
| 2652 </div> | |
| 2653 <div style="clear: left"></div> | |
| 2654 </div> | |
| 2655 | |
| 2656 <a class=matchresult | |
| 2657 href="#hit47-1" | |
| 2658 onmouseover='document.getElementById("defline47").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | |
| 2659 onmouseout='document.getElementById("defline47").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 2660 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 2661 <div class="matchrow graphicrow"> | |
| 2662 <div class="matchitem graphicitem" | |
| 2663 style="background-color: black; width: 100%"></div> | |
| 2664 </div> | |
| 2665 </a> | |
| 2666 | |
| 2667 </div> | |
| 2668 </div> | |
| 2669 </div> | |
| 2670 </section> | |
| 2671 | |
| 2672 | |
| 2673 | |
| 2674 <section class=descriptions> | |
| 114 | 2675 <h3>Descriptions</h3> |
| 106 | 2676 |
| 2677 <div class=grey><div class=white> | |
| 114 | 2678 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
| 106 | 2679 |
| 2680 <table class=descriptiontable> | |
| 2681 <col/><col/><col/><col/><col/><col/><col/> | |
| 2682 <tr> | |
| 2683 <th>Description</th> | |
| 2684 <th>Max score</th> | |
| 2685 <th>Total score</th> | |
| 2686 <th>Query cover</th> | |
| 2687 <th>E value</th> | |
| 2688 <th>Ident</th> | |
| 2689 <th>Accession</th> | |
| 2690 </tr> | |
| 2691 <tr> | |
| 2692 <td><div><a href="#hit47-1" | |
| 2693 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | |
| 2694 id="description47-1"> | |
| 2695 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | |
| 2696 </a></div></td> | |
| 2697 <td>37.4</td> | |
| 2698 <td>37.4</td> | |
| 2699 <td>100%</td> | |
| 2700 <td>9.338e-08</td> | |
| 2701 <td>92%</td> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2702 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td> |
| 106 | 2703 </tr> |
| 2704 </table> | |
| 2705 | |
| 2706 </div></div> | |
| 2707 </section> | |
| 2708 | |
| 2709 | |
| 2710 | |
| 2711 <section class=alignments> | |
| 114 | 2712 <h3>Alignments</h3> |
| 106 | 2713 |
| 2714 <div class=grey><div class=white> | |
| 2715 <div class=alignment id=hit47-1> | |
| 2716 | |
| 2717 <div class=linkheader> | |
| 2718 <div class=right><a href="#description47-1">Descriptions</a></div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2719 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a> |
| 106 | 2720 </div> |
| 2721 | |
| 2722 <div class=title> | |
| 2723 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 2724 <p class=titleinfo> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2725 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a> |
| 106 | 2726 <span class=b>Length:</span> 4180 |
| 2727 <span class=b>Number of Matches:</span> 1 | |
| 2728 </p> | |
| 2729 </div> | |
| 2730 | |
| 2731 | |
| 2732 <div class=hotspot id=hotspot47-1-1> | |
| 2733 <p class=range> | |
| 2734 <span class=range>Range 1: 1541 to 1565</span> | |
| 2735 </p> | |
| 2736 | |
| 2737 <table class=hotspotstable> | |
| 2738 <tr> | |
| 2739 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 2740 </tr> | |
| 2741 <tr> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2742 <td>37.3537 bits (40)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2743 <td>9.33825e-08</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2744 <td>23/25 (92%)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2745 <td>0/25 (0%)</td> |
| 106 | 2746 <td>Plus/Plus</td> |
| 2747 </tr> | |
| 2748 </table> | |
| 2749 | |
| 2750 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | |
| 2751 |||||||||||||| ||||||| || | |
| 2752 Subject 1541 ACATGAACAGCGCCCTGACCACCGC 1565</pre> | |
| 2753 </div> | |
| 2754 | |
| 2755 </div> | |
| 2756 | |
| 2757 </div></div> | |
| 2758 </section> | |
| 2759 </section> | |
| 2760 | |
| 2761 <section class=match id=match48> | |
| 2762 | |
| 114 | 2763 <h2>Nucleotide Sequence (25 letters)</h2> |
| 106 | 2764 |
| 2765 <section class=header> | |
| 2766 | |
| 2767 <table class=headerdata> | |
| 114 | 2768 <tr><td class=param>Query number:</td><td>48</td></tr> |
| 2769 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2770 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2771 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2772 </table> |
| 2773 | |
| 2774 </section> | |
| 2775 | |
| 2776 | |
| 2777 <section class=graphics> | |
| 114 | 2778 <h3>Graphic Summary</h3> |
| 106 | 2779 |
| 2780 <div class=grey> | |
| 114 | 2781 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> |
| 106 | 2782 |
| 2783 <div class=defline id=defline48> | |
| 2784 Mouse-over to show defline and scores, click to show alignments | |
| 2785 </div> | |
| 2786 | |
| 2787 <div class=graphic> | |
| 114 | 2788 <h5 class=darkHeader>Color key for alignment scores</h5> |
| 106 | 2789 <div class=legend><div class=graphicrow> |
| 2790 <div class=graphicitem style="background-color: black"><40</div> | |
| 2791 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 2792 <div class=graphicitem style="background-color: green">50–80</div> | |
| 2793 <div class=graphicitem style="background-color: magenta">80–200</div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2794 <div class=graphicitem style="background-color: red">≥200</div> |
| 106 | 2795 </div></div> |
| 2796 <div style="clear: left"></div> | |
| 2797 | |
| 2798 <div class=tablewrapper> | |
| 2799 | |
| 2800 <div class=scale> | |
| 2801 <div>query:</div> | |
| 2802 <div class=graphicrow> | |
| 2803 <div> | |
| 2804 <div class=graphicitem style="width: 12%"> | |
| 2805 <div>3</div> | |
| 2806 </div> | |
| 2807 <div class=graphicitem style="width: 12%"> | |
| 2808 <div>6</div> | |
| 2809 </div> | |
| 2810 <div class=graphicitem style="width: 12%"> | |
| 2811 <div>9</div> | |
| 2812 </div> | |
| 2813 <div class=graphicitem style="width: 12%"> | |
| 2814 <div>12</div> | |
| 2815 </div> | |
| 2816 <div class=graphicitem style="width: 12%"> | |
| 2817 <div>15</div> | |
| 2818 </div> | |
| 2819 <div class=graphicitem style="width: 12%"> | |
| 2820 <div>18</div> | |
| 2821 </div> | |
| 2822 <div class=graphicitem style="width: 12%"> | |
| 2823 <div>21</div> | |
| 2824 </div> | |
| 2825 <div class=graphicitem style="width: 12%"> | |
| 2826 <div>24</div> | |
| 2827 </div> | |
| 2828 <div class=graphicitem style="width: 4%"> | |
| 2829 <div>25</div> | |
| 2830 </div> | |
| 2831 </div> | |
| 2832 </div> | |
| 2833 <div style="clear: left"></div> | |
| 2834 </div> | |
| 2835 | |
| 2836 <a class=matchresult | |
| 2837 href="#hit48-1" | |
| 2838 onmouseover='document.getElementById("defline48").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | |
| 2839 onmouseout='document.getElementById("defline48").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 2840 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 2841 <div class="matchrow graphicrow"> | |
| 2842 <div class="matchitem graphicitem" | |
| 2843 style="background-color: black; width: 100%"></div> | |
| 2844 </div> | |
| 2845 </a> | |
| 2846 | |
| 2847 </div> | |
| 2848 </div> | |
| 2849 </div> | |
| 2850 </section> | |
| 2851 | |
| 2852 | |
| 2853 | |
| 2854 <section class=descriptions> | |
| 114 | 2855 <h3>Descriptions</h3> |
| 106 | 2856 |
| 2857 <div class=grey><div class=white> | |
| 114 | 2858 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
| 106 | 2859 |
| 2860 <table class=descriptiontable> | |
| 2861 <col/><col/><col/><col/><col/><col/><col/> | |
| 2862 <tr> | |
| 2863 <th>Description</th> | |
| 2864 <th>Max score</th> | |
| 2865 <th>Total score</th> | |
| 2866 <th>Query cover</th> | |
| 2867 <th>E value</th> | |
| 2868 <th>Ident</th> | |
| 2869 <th>Accession</th> | |
| 2870 </tr> | |
| 2871 <tr> | |
| 2872 <td><div><a href="#hit48-1" | |
| 2873 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | |
| 2874 id="description48-1"> | |
| 2875 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | |
| 2876 </a></div></td> | |
| 2877 <td>37.4</td> | |
| 2878 <td>37.4</td> | |
| 2879 <td>100%</td> | |
| 2880 <td>9.338e-08</td> | |
| 2881 <td>92%</td> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2882 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td> |
| 106 | 2883 </tr> |
| 2884 </table> | |
| 2885 | |
| 2886 </div></div> | |
| 2887 </section> | |
| 2888 | |
| 2889 | |
| 2890 | |
| 2891 <section class=alignments> | |
| 114 | 2892 <h3>Alignments</h3> |
| 106 | 2893 |
| 2894 <div class=grey><div class=white> | |
| 2895 <div class=alignment id=hit48-1> | |
| 2896 | |
| 2897 <div class=linkheader> | |
| 2898 <div class=right><a href="#description48-1">Descriptions</a></div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2899 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a> |
| 106 | 2900 </div> |
| 2901 | |
| 2902 <div class=title> | |
| 2903 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 2904 <p class=titleinfo> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2905 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a> |
| 106 | 2906 <span class=b>Length:</span> 4983 |
| 2907 <span class=b>Number of Matches:</span> 1 | |
| 2908 </p> | |
| 2909 </div> | |
| 2910 | |
| 2911 | |
| 2912 <div class=hotspot id=hotspot48-1-1> | |
| 2913 <p class=range> | |
| 2914 <span class=range>Range 1: 2344 to 2368</span> | |
| 2915 </p> | |
| 2916 | |
| 2917 <table class=hotspotstable> | |
| 2918 <tr> | |
| 2919 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 2920 </tr> | |
| 2921 <tr> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2922 <td>37.3537 bits (40)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2923 <td>9.33825e-08</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2924 <td>23/25 (92%)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
2925 <td>0/25 (0%)</td> |
| 106 | 2926 <td>Plus/Plus</td> |
| 2927 </tr> | |
| 2928 </table> | |
| 2929 | |
| 2930 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | |
| 2931 |||||||||||||| ||||||| || | |
| 2932 Subject 2344 ACATGAACAGCGCCCTGACCACCGC 2368</pre> | |
| 2933 </div> | |
| 2934 | |
| 2935 </div> | |
| 2936 | |
| 2937 </div></div> | |
| 2938 </section> | |
| 2939 </section> | |
| 2940 | |
| 2941 <section class=match id=match49> | |
| 2942 | |
| 114 | 2943 <h2>Nucleotide Sequence (74 letters)</h2> |
| 106 | 2944 |
| 2945 <section class=header> | |
| 2946 | |
| 2947 <table class=headerdata> | |
| 114 | 2948 <tr><td class=param>Query number:</td><td>49</td></tr> |
| 2949 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 2950 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2951 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 2952 </table> |
| 2953 | |
| 2954 </section> | |
| 2955 | |
| 2956 <section> | |
| 114 | 2957 <h3>No Hits</h3> |
| 106 | 2958 <div class=grey> |
| 2959 <table class=headerdata> | |
| 2960 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2961 </table> | |
| 2962 </div> | |
| 2963 </section> | |
| 2964 </section> | |
| 2965 | |
| 2966 <section class=match id=match50> | |
| 2967 | |
| 114 | 2968 <h2>Nucleotide Sequence (74 letters)</h2> |
| 106 | 2969 |
| 2970 <section class=header> | |
| 2971 | |
| 2972 <table class=headerdata> | |
| 114 | 2973 <tr><td class=param>Query number:</td><td>50</td></tr> |
| 2974 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 2975 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2976 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 2977 </table> |
| 2978 | |
| 2979 </section> | |
| 2980 | |
| 2981 <section> | |
| 114 | 2982 <h3>No Hits</h3> |
| 106 | 2983 <div class=grey> |
| 2984 <table class=headerdata> | |
| 2985 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2986 </table> | |
| 2987 </div> | |
| 2988 </section> | |
| 2989 </section> | |
| 2990 | |
| 2991 <section class=match id=match51> | |
| 2992 | |
| 114 | 2993 <h2>Nucleotide Sequence (74 letters)</h2> |
| 106 | 2994 |
| 2995 <section class=header> | |
| 2996 | |
| 2997 <table class=headerdata> | |
| 114 | 2998 <tr><td class=param>Query number:</td><td>51</td></tr> |
| 2999 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3000 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3001 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3002 </table> |
| 3003 | |
| 3004 </section> | |
| 3005 | |
| 3006 <section> | |
| 114 | 3007 <h3>No Hits</h3> |
| 106 | 3008 <div class=grey> |
| 3009 <table class=headerdata> | |
| 3010 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3011 </table> | |
| 3012 </div> | |
| 3013 </section> | |
| 3014 </section> | |
| 3015 | |
| 3016 <section class=match id=match52> | |
| 3017 | |
| 114 | 3018 <h2>Nucleotide Sequence (74 letters)</h2> |
| 106 | 3019 |
| 3020 <section class=header> | |
| 3021 | |
| 3022 <table class=headerdata> | |
| 114 | 3023 <tr><td class=param>Query number:</td><td>52</td></tr> |
| 3024 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3025 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3026 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3027 </table> |
| 3028 | |
| 3029 </section> | |
| 3030 | |
| 3031 <section> | |
| 114 | 3032 <h3>No Hits</h3> |
| 106 | 3033 <div class=grey> |
| 3034 <table class=headerdata> | |
| 3035 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3036 </table> | |
| 3037 </div> | |
| 3038 </section> | |
| 3039 </section> | |
| 3040 | |
| 3041 <section class=match id=match53> | |
| 3042 | |
| 114 | 3043 <h2>Nucleotide Sequence (74 letters)</h2> |
| 106 | 3044 |
| 3045 <section class=header> | |
| 3046 | |
| 3047 <table class=headerdata> | |
| 114 | 3048 <tr><td class=param>Query number:</td><td>53</td></tr> |
| 3049 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3050 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3051 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3052 </table> |
| 3053 | |
| 3054 </section> | |
| 3055 | |
| 3056 <section> | |
| 114 | 3057 <h3>No Hits</h3> |
| 106 | 3058 <div class=grey> |
| 3059 <table class=headerdata> | |
| 3060 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3061 </table> | |
| 3062 </div> | |
| 3063 </section> | |
| 3064 </section> | |
| 3065 | |
| 3066 <section class=match id=match54> | |
| 3067 | |
| 114 | 3068 <h2>Nucleotide Sequence (74 letters)</h2> |
| 106 | 3069 |
| 3070 <section class=header> | |
| 3071 | |
| 3072 <table class=headerdata> | |
| 114 | 3073 <tr><td class=param>Query number:</td><td>54</td></tr> |
| 3074 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3075 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3076 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3077 </table> |
| 3078 | |
| 3079 </section> | |
| 3080 | |
| 3081 <section> | |
| 114 | 3082 <h3>No Hits</h3> |
| 106 | 3083 <div class=grey> |
| 3084 <table class=headerdata> | |
| 3085 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3086 </table> | |
| 3087 </div> | |
| 3088 </section> | |
| 3089 </section> | |
| 3090 | |
| 3091 <section class=match id=match55> | |
| 3092 | |
| 114 | 3093 <h2>Nucleotide Sequence (74 letters)</h2> |
| 106 | 3094 |
| 3095 <section class=header> | |
| 3096 | |
| 3097 <table class=headerdata> | |
| 114 | 3098 <tr><td class=param>Query number:</td><td>55</td></tr> |
| 3099 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3100 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3101 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3102 </table> |
| 3103 | |
| 3104 </section> | |
| 3105 | |
| 3106 | |
| 3107 <section class=graphics> | |
| 114 | 3108 <h3>Graphic Summary</h3> |
| 106 | 3109 |
| 3110 <div class=grey> | |
| 114 | 3111 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> |
| 106 | 3112 |
| 3113 <div class=defline id=defline55> | |
| 3114 Mouse-over to show defline and scores, click to show alignments | |
| 3115 </div> | |
| 3116 | |
| 3117 <div class=graphic> | |
| 114 | 3118 <h5 class=darkHeader>Color key for alignment scores</h5> |
| 106 | 3119 <div class=legend><div class=graphicrow> |
| 3120 <div class=graphicitem style="background-color: black"><40</div> | |
| 3121 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 3122 <div class=graphicitem style="background-color: green">50–80</div> | |
| 3123 <div class=graphicitem style="background-color: magenta">80–200</div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3124 <div class=graphicitem style="background-color: red">≥200</div> |
| 106 | 3125 </div></div> |
| 3126 <div style="clear: left"></div> | |
| 3127 | |
| 3128 <div class=tablewrapper> | |
| 3129 | |
| 3130 <div class=scale> | |
| 3131 <div>query:</div> | |
| 3132 <div class=graphicrow> | |
| 3133 <div> | |
| 3134 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3135 <div>8</div> | |
| 3136 </div> | |
| 3137 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3138 <div>16</div> | |
| 3139 </div> | |
| 3140 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3141 <div>24</div> | |
| 3142 </div> | |
| 3143 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3144 <div>32</div> | |
| 3145 </div> | |
| 3146 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3147 <div>40</div> | |
| 3148 </div> | |
| 3149 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3150 <div>48</div> | |
| 3151 </div> | |
| 3152 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3153 <div>56</div> | |
| 3154 </div> | |
| 3155 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3156 <div>64</div> | |
| 3157 </div> | |
| 3158 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3159 <div>72</div> | |
| 3160 </div> | |
| 3161 <div class=graphicitem style="width: 2.7027027027%"> | |
| 3162 <div> </div> | |
| 3163 <div class=lastlabel>74</div> | |
| 3164 </div> | |
| 3165 </div> | |
| 3166 </div> | |
| 3167 <div style="clear: left"></div> | |
| 3168 </div> | |
| 3169 | |
| 3170 <a class=matchresult | |
| 3171 href="#hit55-1" | |
| 3172 onmouseover='document.getElementById("defline55").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | |
| 3173 onmouseout='document.getElementById("defline55").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 3174 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 3175 <div class="matchrow graphicrow"> | |
| 3176 <div class="matchitem graphicitem" | |
| 3177 style="background-color: green; width: 100%"></div> | |
| 3178 </div> | |
| 3179 </a> | |
| 3180 | |
| 3181 </div> | |
| 3182 </div> | |
| 3183 </div> | |
| 3184 </section> | |
| 3185 | |
| 3186 | |
| 3187 | |
| 3188 <section class=descriptions> | |
| 114 | 3189 <h3>Descriptions</h3> |
| 106 | 3190 |
| 3191 <div class=grey><div class=white> | |
| 114 | 3192 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
| 106 | 3193 |
| 3194 <table class=descriptiontable> | |
| 3195 <col/><col/><col/><col/><col/><col/><col/> | |
| 3196 <tr> | |
| 3197 <th>Description</th> | |
| 3198 <th>Max score</th> | |
| 3199 <th>Total score</th> | |
| 3200 <th>Query cover</th> | |
| 3201 <th>E value</th> | |
| 3202 <th>Ident</th> | |
| 3203 <th>Accession</th> | |
| 3204 </tr> | |
| 3205 <tr> | |
| 3206 <td><div><a href="#hit55-1" | |
| 3207 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | |
| 3208 id="description55-1"> | |
| 3209 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | |
| 3210 </a></div></td> | |
| 3211 <td>89.7</td> | |
| 3212 <td>89.7</td> | |
| 3213 <td>100%</td> | |
| 3214 <td>6.629e-23</td> | |
| 3215 <td>86%</td> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3216 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td> |
| 106 | 3217 </tr> |
| 3218 </table> | |
| 3219 | |
| 3220 </div></div> | |
| 3221 </section> | |
| 3222 | |
| 3223 | |
| 3224 | |
| 3225 <section class=alignments> | |
| 114 | 3226 <h3>Alignments</h3> |
| 106 | 3227 |
| 3228 <div class=grey><div class=white> | |
| 3229 <div class=alignment id=hit55-1> | |
| 3230 | |
| 3231 <div class=linkheader> | |
| 3232 <div class=right><a href="#description55-1">Descriptions</a></div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3233 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a> |
| 106 | 3234 </div> |
| 3235 | |
| 3236 <div class=title> | |
| 3237 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 3238 <p class=titleinfo> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3239 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a> |
| 106 | 3240 <span class=b>Length:</span> 4180 |
| 3241 <span class=b>Number of Matches:</span> 1 | |
| 3242 </p> | |
| 3243 </div> | |
| 3244 | |
| 3245 | |
| 3246 <div class=hotspot id=hotspot55-1-1> | |
| 3247 <p class=range> | |
| 3248 <span class=range>Range 1: 1516 to 1589</span> | |
| 3249 </p> | |
| 3250 | |
| 3251 <table class=hotspotstable> | |
| 3252 <tr> | |
| 3253 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 3254 </tr> | |
| 3255 <tr> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3256 <td>89.6514 bits (98)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3257 <td>6.62923e-23</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3258 <td>64/74 (86%)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3259 <td>0/74 (0%)</td> |
| 106 | 3260 <td>Plus/Plus</td> |
| 3261 </tr> | |
| 3262 </table> | |
| 3263 | |
| 3264 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | |
| 3265 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | | |
| 3266 Subject 1516 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1575</pre> | |
| 3267 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 | |
| 3268 ||||| |||||||| | |
| 3269 Subject 1576 TTCGCCGTCCAGAA 1589</pre> | |
| 3270 </div> | |
| 3271 | |
| 3272 </div> | |
| 3273 | |
| 3274 </div></div> | |
| 3275 </section> | |
| 3276 </section> | |
| 3277 | |
| 3278 <section class=match id=match56> | |
| 3279 | |
| 114 | 3280 <h2>Nucleotide Sequence (74 letters)</h2> |
| 106 | 3281 |
| 3282 <section class=header> | |
| 3283 | |
| 3284 <table class=headerdata> | |
| 114 | 3285 <tr><td class=param>Query number:</td><td>56</td></tr> |
| 3286 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3287 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3288 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3289 </table> |
| 3290 | |
| 3291 </section> | |
| 3292 | |
| 3293 | |
| 3294 <section class=graphics> | |
| 114 | 3295 <h3>Graphic Summary</h3> |
| 106 | 3296 |
| 3297 <div class=grey> | |
| 114 | 3298 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> |
| 106 | 3299 |
| 3300 <div class=defline id=defline56> | |
| 3301 Mouse-over to show defline and scores, click to show alignments | |
| 3302 </div> | |
| 3303 | |
| 3304 <div class=graphic> | |
| 114 | 3305 <h5 class=darkHeader>Color key for alignment scores</h5> |
| 106 | 3306 <div class=legend><div class=graphicrow> |
| 3307 <div class=graphicitem style="background-color: black"><40</div> | |
| 3308 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 3309 <div class=graphicitem style="background-color: green">50–80</div> | |
| 3310 <div class=graphicitem style="background-color: magenta">80–200</div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3311 <div class=graphicitem style="background-color: red">≥200</div> |
| 106 | 3312 </div></div> |
| 3313 <div style="clear: left"></div> | |
| 3314 | |
| 3315 <div class=tablewrapper> | |
| 3316 | |
| 3317 <div class=scale> | |
| 3318 <div>query:</div> | |
| 3319 <div class=graphicrow> | |
| 3320 <div> | |
| 3321 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3322 <div>8</div> | |
| 3323 </div> | |
| 3324 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3325 <div>16</div> | |
| 3326 </div> | |
| 3327 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3328 <div>24</div> | |
| 3329 </div> | |
| 3330 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3331 <div>32</div> | |
| 3332 </div> | |
| 3333 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3334 <div>40</div> | |
| 3335 </div> | |
| 3336 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3337 <div>48</div> | |
| 3338 </div> | |
| 3339 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3340 <div>56</div> | |
| 3341 </div> | |
| 3342 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3343 <div>64</div> | |
| 3344 </div> | |
| 3345 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3346 <div>72</div> | |
| 3347 </div> | |
| 3348 <div class=graphicitem style="width: 2.7027027027%"> | |
| 3349 <div> </div> | |
| 3350 <div class=lastlabel>74</div> | |
| 3351 </div> | |
| 3352 </div> | |
| 3353 </div> | |
| 3354 <div style="clear: left"></div> | |
| 3355 </div> | |
| 3356 | |
| 3357 <a class=matchresult | |
| 3358 href="#hit56-1" | |
| 3359 onmouseover='document.getElementById("defline56").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | |
| 3360 onmouseout='document.getElementById("defline56").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 3361 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 3362 <div class="matchrow graphicrow"> | |
| 3363 <div class="matchitem graphicitem" | |
| 3364 style="background-color: green; width: 100%"></div> | |
| 3365 </div> | |
| 3366 </a> | |
| 3367 | |
| 3368 </div> | |
| 3369 </div> | |
| 3370 </div> | |
| 3371 </section> | |
| 3372 | |
| 3373 | |
| 3374 | |
| 3375 <section class=descriptions> | |
| 114 | 3376 <h3>Descriptions</h3> |
| 106 | 3377 |
| 3378 <div class=grey><div class=white> | |
| 114 | 3379 <h5 class=darkHeader>Sequences producing significant alignments:</h5> |
| 106 | 3380 |
| 3381 <table class=descriptiontable> | |
| 3382 <col/><col/><col/><col/><col/><col/><col/> | |
| 3383 <tr> | |
| 3384 <th>Description</th> | |
| 3385 <th>Max score</th> | |
| 3386 <th>Total score</th> | |
| 3387 <th>Query cover</th> | |
| 3388 <th>E value</th> | |
| 3389 <th>Ident</th> | |
| 3390 <th>Accession</th> | |
| 3391 </tr> | |
| 3392 <tr> | |
| 3393 <td><div><a href="#hit56-1" | |
| 3394 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | |
| 3395 id="description56-1"> | |
| 3396 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | |
| 3397 </a></div></td> | |
| 3398 <td>89.7</td> | |
| 3399 <td>89.7</td> | |
| 3400 <td>100%</td> | |
| 3401 <td>6.629e-23</td> | |
| 3402 <td>86%</td> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3403 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td> |
| 106 | 3404 </tr> |
| 3405 </table> | |
| 3406 | |
| 3407 </div></div> | |
| 3408 </section> | |
| 3409 | |
| 3410 | |
| 3411 | |
| 3412 <section class=alignments> | |
| 114 | 3413 <h3>Alignments</h3> |
| 106 | 3414 |
| 3415 <div class=grey><div class=white> | |
| 3416 <div class=alignment id=hit56-1> | |
| 3417 | |
| 3418 <div class=linkheader> | |
| 3419 <div class=right><a href="#description56-1">Descriptions</a></div> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3420 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a> |
| 106 | 3421 </div> |
| 3422 | |
| 3423 <div class=title> | |
| 3424 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 3425 <p class=titleinfo> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3426 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a> |
| 106 | 3427 <span class=b>Length:</span> 4983 |
| 3428 <span class=b>Number of Matches:</span> 1 | |
| 3429 </p> | |
| 3430 </div> | |
| 3431 | |
| 3432 | |
| 3433 <div class=hotspot id=hotspot56-1-1> | |
| 3434 <p class=range> | |
| 3435 <span class=range>Range 1: 2319 to 2392</span> | |
| 3436 </p> | |
| 3437 | |
| 3438 <table class=hotspotstable> | |
| 3439 <tr> | |
| 3440 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 3441 </tr> | |
| 3442 <tr> | |
|
118
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3443 <td>89.6514 bits (98)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3444 <td>6.62923e-23</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3445 <td>64/74 (86%)</td> |
|
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
Jan Kanis <jan.code@jankanis.nl>
parents:
114
diff
changeset
|
3446 <td>0/74 (0%)</td> |
| 106 | 3447 <td>Plus/Plus</td> |
| 3448 </tr> | |
| 3449 </table> | |
| 3450 | |
| 3451 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | |
| 3452 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | | |
| 3453 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre> | |
| 3454 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 | |
| 3455 ||||| |||||||| | |
| 3456 Subject 2379 TTCGCCGTCCAGAA 2392</pre> | |
| 3457 </div> | |
| 3458 | |
| 3459 </div> | |
| 3460 | |
| 3461 </div></div> | |
| 3462 </section> | |
| 3463 </section> | |
| 3464 | |
| 3465 </div> | |
| 3466 | |
| 3467 <footer> | |
| 3468 This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. | |
| 3469 </footer> | |
| 3470 </body> | |
| 3471 </html> | |
| 3472 |