blast2html: test-data/blast xml example3.xml annotate

annotate test-data/blast xml example3.xml @ 38:91008923c402

add repository dependency; add <stdio> tag; update version

author	Jan Kanis <jan.code@jankanis.nl>
date	Mon, 19 May 2014 14:41:55 +0200
parents	ce8f29efc0a1
children

rev	line source
25 b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1 <?xml version="1.0"?>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	2 <!DOCTYPE BlastOutput PUBLIC "-//NCBI//NCBI BlastOutput/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd">
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	3 <BlastOutput>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	4 <BlastOutput_program>blastn</BlastOutput_program>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	5 <BlastOutput_version>BLASTN 2.2.29+</BlastOutput_version>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	6 <BlastOutput_reference>Stephen F. Altschul, Thomas L. Madden, Alejandro A. Sch&auml;ffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.</BlastOutput_reference>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	7 <BlastOutput_db></BlastOutput_db>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	8 <BlastOutput_query-ID>Query_1</BlastOutput_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	9 <BlastOutput_query-def>Forward_Primer\|NOST-Spec_(Genetic_ID)</BlastOutput_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	10 <BlastOutput_query-len>20</BlastOutput_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	11 <BlastOutput_param>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	12 <Parameters>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	13 <Parameters_expect>0.001</Parameters_expect>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	14 <Parameters_sc-match>2</Parameters_sc-match>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	15 <Parameters_sc-mismatch>-3</Parameters_sc-mismatch>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	16 <Parameters_gap-open>5</Parameters_gap-open>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	17 <Parameters_gap-extend>2</Parameters_gap-extend>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	18 <Parameters_filter>L;m;</Parameters_filter>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	19 </Parameters>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	20 </BlastOutput_param>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	21 <BlastOutput_iterations>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	22 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	23 <Iteration_iter-num>1</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	24 <Iteration_query-ID>Query_1</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	25 <Iteration_query-def>Forward_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	26 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	27 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	28 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	29 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	30 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	31 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	32 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	33 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	34 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	35 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	36 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	37 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	38 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	39 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	40 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	41 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	42 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	43 <Iteration_iter-num>2</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	44 <Iteration_query-ID>Query_1</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	45 <Iteration_query-def>Forward_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	46 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	47 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	48 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	49 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	50 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	51 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	52 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	53 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	54 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	55 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	56 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	57 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	58 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	59 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	60 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	61 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	62 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	63 <Iteration_iter-num>3</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	64 <Iteration_query-ID>Query_1</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	65 <Iteration_query-def>Forward_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	66 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	67 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	68 <Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	69 <Hit_num>1</Hit_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	70 <Hit_id>Subject_3</Hit_id>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	71 <Hit_def>DJ437711\|GenBank\|insert_MIR604\|Corn_Event_MIR604,_Left_Border_region\|-5751164067366620000</Hit_def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	72 <Hit_accession>Subject_3</Hit_accession>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	73 <Hit_len>323</Hit_len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	74 <Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	75 <Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	76 <Hsp_num>1</Hsp_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	77 <Hsp_bit-score>37.3537</Hsp_bit-score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	78 <Hsp_score>40</Hsp_score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	79 <Hsp_evalue>7.01052e-08</Hsp_evalue>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	80 <Hsp_query-from>1</Hsp_query-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	81 <Hsp_query-to>20</Hsp_query-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	82 <Hsp_hit-from>200</Hsp_hit-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	83 <Hsp_hit-to>219</Hsp_hit-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	84 <Hsp_query-frame>1</Hsp_query-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	85 <Hsp_hit-frame>1</Hsp_hit-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	86 <Hsp_identity>20</Hsp_identity>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	87 <Hsp_positive>20</Hsp_positive>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	88 <Hsp_gaps>0</Hsp_gaps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	89 <Hsp_align-len>20</Hsp_align-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	90 <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	91 <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	92 <Hsp_midline>\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|</Hsp_midline>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	93 </Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	94 </Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	95 </Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	96 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	97 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	98 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	99 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	100 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	101 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	102 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	103 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	104 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	105 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	106 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	107 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	108 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	109 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	110 <Iteration_iter-num>4</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	111 <Iteration_query-ID>Query_1</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	112 <Iteration_query-def>Forward_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	113 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	114 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	115 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	116 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	117 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	118 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	119 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	120 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	121 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	122 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	123 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	124 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	125 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	126 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	127 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	128 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	129 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	130 <Iteration_iter-num>5</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	131 <Iteration_query-ID>Query_1</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	132 <Iteration_query-def>Forward_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	133 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	134 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	135 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	136 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	137 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	138 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	139 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	140 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	141 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	142 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	143 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	144 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	145 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	146 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	147 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	148 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	149 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	150 <Iteration_iter-num>6</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	151 <Iteration_query-ID>Query_1</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	152 <Iteration_query-def>Forward_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	153 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	154 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	155 <Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	156 <Hit_num>1</Hit_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	157 <Hit_id>Subject_6</Hit_id>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	158 <Hit_def>AB209952.1\|GenBank\|insert_GTS-40-3-2\|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds\|-9105899556052450000</Hit_def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	159 <Hit_accession>Subject_6</Hit_accession>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	160 <Hit_len>2457</Hit_len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	161 <Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	162 <Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	163 <Hsp_num>1</Hsp_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	164 <Hsp_bit-score>37.3537</Hsp_bit-score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	165 <Hsp_score>40</Hsp_score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	166 <Hsp_evalue>7.01052e-08</Hsp_evalue>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	167 <Hsp_query-from>1</Hsp_query-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	168 <Hsp_query-to>20</Hsp_query-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	169 <Hsp_hit-from>2119</Hsp_hit-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	170 <Hsp_hit-to>2138</Hsp_hit-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	171 <Hsp_query-frame>1</Hsp_query-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	172 <Hsp_hit-frame>1</Hsp_hit-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	173 <Hsp_identity>20</Hsp_identity>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	174 <Hsp_positive>20</Hsp_positive>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	175 <Hsp_gaps>0</Hsp_gaps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	176 <Hsp_align-len>20</Hsp_align-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	177 <Hsp_qseq>AGCGCGCAAACTAGGATAAA</Hsp_qseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	178 <Hsp_hseq>AGCGCGCAAACTAGGATAAA</Hsp_hseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	179 <Hsp_midline>\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|</Hsp_midline>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	180 </Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	181 </Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	182 </Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	183 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	184 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	185 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	186 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	187 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	188 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	189 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	190 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	191 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	192 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	193 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	194 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	195 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	196 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	197 <Iteration_iter-num>7</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	198 <Iteration_query-ID>Query_1</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	199 <Iteration_query-def>Forward_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	200 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	201 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	202 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	203 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	204 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	205 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	206 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	207 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	208 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	209 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	210 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	211 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	212 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	213 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	214 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	215 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	216 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	217 <Iteration_iter-num>8</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	218 <Iteration_query-ID>Query_1</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	219 <Iteration_query-def>Forward_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	220 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	221 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	222 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	223 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	224 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	225 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	226 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	227 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	228 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	229 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	230 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	231 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	232 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	233 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	234 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	235 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	236 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	237 <Iteration_iter-num>9</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	238 <Iteration_query-ID>Query_2</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	239 <Iteration_query-def>Reverse_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	240 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	241 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	242 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	243 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	244 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	245 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	246 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	247 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	248 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	249 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	250 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	251 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	252 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	253 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	254 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	255 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	256 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	257 <Iteration_iter-num>10</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	258 <Iteration_query-ID>Query_2</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	259 <Iteration_query-def>Reverse_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	260 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	261 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	262 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	263 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	264 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	265 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	266 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	267 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	268 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	269 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	270 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	271 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	272 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	273 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	274 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	275 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	276 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	277 <Iteration_iter-num>11</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	278 <Iteration_query-ID>Query_2</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	279 <Iteration_query-def>Reverse_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	280 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	281 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	282 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	283 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	284 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	285 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	286 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	287 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	288 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	289 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	290 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	291 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	292 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	293 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	294 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	295 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	296 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	297 <Iteration_iter-num>12</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	298 <Iteration_query-ID>Query_2</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	299 <Iteration_query-def>Reverse_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	300 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	301 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	302 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	303 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	304 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	305 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	306 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	307 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	308 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	309 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	310 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	311 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	312 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	313 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	314 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	315 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	316 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	317 <Iteration_iter-num>13</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	318 <Iteration_query-ID>Query_2</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	319 <Iteration_query-def>Reverse_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	320 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	321 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	322 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	323 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	324 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	325 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	326 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	327 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	328 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	329 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	330 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	331 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	332 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	333 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	334 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	335 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	336 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	337 <Iteration_iter-num>14</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	338 <Iteration_query-ID>Query_2</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	339 <Iteration_query-def>Reverse_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	340 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	341 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	342 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	343 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	344 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	345 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	346 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	347 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	348 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	349 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	350 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	351 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	352 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	353 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	354 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	355 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	356 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	357 <Iteration_iter-num>15</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	358 <Iteration_query-ID>Query_2</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	359 <Iteration_query-def>Reverse_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	360 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	361 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	362 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	363 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	364 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	365 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	366 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	367 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	368 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	369 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	370 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	371 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	372 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	373 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	374 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	375 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	376 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	377 <Iteration_iter-num>16</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	378 <Iteration_query-ID>Query_2</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	379 <Iteration_query-def>Reverse_Primer\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	380 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	381 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	382 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	383 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	384 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	385 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	386 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	387 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	388 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	389 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	390 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	391 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	392 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	393 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	394 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	395 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	396 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	397 <Iteration_iter-num>17</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	398 <Iteration_query-ID>Query_3</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	399 <Iteration_query-def>Probe\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	400 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	401 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	402 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	403 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	404 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	405 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	406 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	407 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	408 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	409 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	410 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	411 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	412 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	413 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	414 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	415 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	416 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	417 <Iteration_iter-num>18</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	418 <Iteration_query-ID>Query_3</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	419 <Iteration_query-def>Probe\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	420 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	421 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	422 <Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	423 <Hit_num>1</Hit_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	424 <Hit_id>Subject_2</Hit_id>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	425 <Hit_def>AJ308515.1\|GenBank\|insert_GTS-40-3-2\|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.\|-9105899556052450000</Hit_def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	426 <Hit_accession>Subject_2</Hit_accession>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	427 <Hit_len>1045</Hit_len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	428 <Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	429 <Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	430 <Hsp_num>1</Hsp_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	431 <Hsp_bit-score>31.9436</Hsp_bit-score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	432 <Hsp_score>34</Hsp_score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	433 <Hsp_evalue>2.98095e-06</Hsp_evalue>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	434 <Hsp_query-from>4</Hsp_query-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	435 <Hsp_query-to>20</Hsp_query-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	436 <Hsp_hit-from>2</Hsp_hit-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	437 <Hsp_hit-to>18</Hsp_hit-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	438 <Hsp_query-frame>1</Hsp_query-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	439 <Hsp_hit-frame>1</Hsp_hit-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	440 <Hsp_identity>17</Hsp_identity>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	441 <Hsp_positive>17</Hsp_positive>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	442 <Hsp_gaps>0</Hsp_gaps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	443 <Hsp_align-len>17</Hsp_align-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	444 <Hsp_qseq>GCGCGGTGTCATCTATG</Hsp_qseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	445 <Hsp_hseq>GCGCGGTGTCATCTATG</Hsp_hseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	446 <Hsp_midline>\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|</Hsp_midline>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	447 </Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	448 </Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	449 </Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	450 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	451 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	452 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	453 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	454 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	455 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	456 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	457 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	458 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	459 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	460 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	461 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	462 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	463 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	464 <Iteration_iter-num>19</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	465 <Iteration_query-ID>Query_3</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	466 <Iteration_query-def>Probe\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	467 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	468 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	469 <Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	470 <Hit_num>1</Hit_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	471 <Hit_id>Subject_3</Hit_id>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	472 <Hit_def>DJ437711\|GenBank\|insert_MIR604\|Corn_Event_MIR604,_Left_Border_region\|-5751164067366620000</Hit_def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	473 <Hit_accession>Subject_3</Hit_accession>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	474 <Hit_len>323</Hit_len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	475 <Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	476 <Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	477 <Hsp_num>1</Hsp_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	478 <Hsp_bit-score>37.3537</Hsp_bit-score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	479 <Hsp_score>40</Hsp_score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	480 <Hsp_evalue>7.01052e-08</Hsp_evalue>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	481 <Hsp_query-from>1</Hsp_query-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	482 <Hsp_query-to>20</Hsp_query-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	483 <Hsp_hit-from>224</Hsp_hit-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	484 <Hsp_hit-to>243</Hsp_hit-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	485 <Hsp_query-frame>1</Hsp_query-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	486 <Hsp_hit-frame>1</Hsp_hit-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	487 <Hsp_identity>20</Hsp_identity>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	488 <Hsp_positive>20</Hsp_positive>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	489 <Hsp_gaps>0</Hsp_gaps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	490 <Hsp_align-len>20</Hsp_align-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	491 <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	492 <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	493 <Hsp_midline>\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|</Hsp_midline>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	494 </Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	495 </Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	496 </Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	497 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	498 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	499 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	500 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	501 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	502 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	503 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	504 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	505 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	506 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	507 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	508 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	509 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	510 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	511 <Iteration_iter-num>20</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	512 <Iteration_query-ID>Query_3</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	513 <Iteration_query-def>Probe\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	514 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	515 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	516 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	517 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	518 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	519 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	520 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	521 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	522 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	523 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	524 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	525 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	526 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	527 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	528 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	529 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	530 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	531 <Iteration_iter-num>21</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	532 <Iteration_query-ID>Query_3</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	533 <Iteration_query-def>Probe\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	534 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	535 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	536 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	537 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	538 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	539 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	540 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	541 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	542 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	543 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	544 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	545 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	546 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	547 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	548 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	549 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	550 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	551 <Iteration_iter-num>22</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	552 <Iteration_query-ID>Query_3</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	553 <Iteration_query-def>Probe\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	554 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	555 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	556 <Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	557 <Hit_num>1</Hit_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	558 <Hit_id>Subject_6</Hit_id>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	559 <Hit_def>AB209952.1\|GenBank\|insert_GTS-40-3-2\|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds\|-9105899556052450000</Hit_def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	560 <Hit_accession>Subject_6</Hit_accession>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	561 <Hit_len>2457</Hit_len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	562 <Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	563 <Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	564 <Hsp_num>1</Hsp_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	565 <Hsp_bit-score>37.3537</Hsp_bit-score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	566 <Hsp_score>40</Hsp_score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	567 <Hsp_evalue>7.01052e-08</Hsp_evalue>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	568 <Hsp_query-from>1</Hsp_query-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	569 <Hsp_query-to>20</Hsp_query-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	570 <Hsp_hit-from>2143</Hsp_hit-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	571 <Hsp_hit-to>2162</Hsp_hit-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	572 <Hsp_query-frame>1</Hsp_query-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	573 <Hsp_hit-frame>1</Hsp_hit-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	574 <Hsp_identity>20</Hsp_identity>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	575 <Hsp_positive>20</Hsp_positive>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	576 <Hsp_gaps>0</Hsp_gaps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	577 <Hsp_align-len>20</Hsp_align-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	578 <Hsp_qseq>CGCGCGCGGTGTCATCTATG</Hsp_qseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	579 <Hsp_hseq>CGCGCGCGGTGTCATCTATG</Hsp_hseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	580 <Hsp_midline>\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|</Hsp_midline>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	581 </Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	582 </Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	583 </Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	584 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	585 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	586 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	587 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	588 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	589 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	590 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	591 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	592 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	593 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	594 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	595 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	596 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	597 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	598 <Iteration_iter-num>23</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	599 <Iteration_query-ID>Query_3</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	600 <Iteration_query-def>Probe\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	601 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	602 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	603 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	604 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	605 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	606 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	607 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	608 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	609 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	610 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	611 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	612 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	613 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	614 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	615 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	616 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	617 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	618 <Iteration_iter-num>24</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	619 <Iteration_query-ID>Query_3</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	620 <Iteration_query-def>Probe\|NOST-Spec_(Genetic_ID)</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	621 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	622 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	623 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	624 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	625 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	626 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	627 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	628 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	629 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	630 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	631 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	632 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	633 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	634 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	635 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	636 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	637 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	638 <Iteration_iter-num>25</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	639 <Iteration_query-ID>Query_4</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	640 <Iteration_query-def>Forward_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	641 <Iteration_query-len>24</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	642 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	643 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	644 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	645 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	646 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	647 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	648 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	649 <Statistics_eff-space>15375</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	650 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	651 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	652 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	653 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	654 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	655 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	656 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	657 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	658 <Iteration_iter-num>26</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	659 <Iteration_query-ID>Query_4</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	660 <Iteration_query-def>Forward_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	661 <Iteration_query-len>24</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	662 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	663 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	664 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	665 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	666 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	667 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	668 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	669 <Statistics_eff-space>15375</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	670 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	671 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	672 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	673 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	674 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	675 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	676 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	677 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	678 <Iteration_iter-num>27</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	679 <Iteration_query-ID>Query_4</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	680 <Iteration_query-def>Forward_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	681 <Iteration_query-len>24</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	682 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	683 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	684 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	685 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	686 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	687 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	688 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	689 <Statistics_eff-space>15375</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	690 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	691 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	692 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	693 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	694 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	695 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	696 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	697 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	698 <Iteration_iter-num>28</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	699 <Iteration_query-ID>Query_4</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	700 <Iteration_query-def>Forward_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	701 <Iteration_query-len>24</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	702 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	703 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	704 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	705 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	706 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	707 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	708 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	709 <Statistics_eff-space>15375</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	710 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	711 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	712 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	713 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	714 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	715 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	716 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	717 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	718 <Iteration_iter-num>29</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	719 <Iteration_query-ID>Query_4</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	720 <Iteration_query-def>Forward_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	721 <Iteration_query-len>24</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	722 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	723 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	724 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	725 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	726 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	727 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	728 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	729 <Statistics_eff-space>15375</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	730 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	731 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	732 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	733 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	734 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	735 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	736 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	737 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	738 <Iteration_iter-num>30</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	739 <Iteration_query-ID>Query_4</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	740 <Iteration_query-def>Forward_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	741 <Iteration_query-len>24</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	742 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	743 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	744 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	745 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	746 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	747 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	748 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	749 <Statistics_eff-space>15375</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	750 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	751 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	752 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	753 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	754 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	755 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	756 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	757 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	758 <Iteration_iter-num>31</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	759 <Iteration_query-ID>Query_4</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	760 <Iteration_query-def>Forward_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	761 <Iteration_query-len>24</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	762 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	763 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	764 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	765 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	766 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	767 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	768 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	769 <Statistics_eff-space>15375</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	770 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	771 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	772 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	773 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	774 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	775 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	776 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	777 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	778 <Iteration_iter-num>32</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	779 <Iteration_query-ID>Query_4</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	780 <Iteration_query-def>Forward_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	781 <Iteration_query-len>24</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	782 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	783 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	784 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	785 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	786 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	787 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	788 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	789 <Statistics_eff-space>15375</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	790 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	791 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	792 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	793 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	794 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	795 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	796 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	797 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	798 <Iteration_iter-num>33</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	799 <Iteration_query-ID>Query_5</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	800 <Iteration_query-def>Reverse_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	801 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	802 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	803 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	804 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	805 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	806 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	807 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	808 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	809 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	810 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	811 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	812 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	813 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	814 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	815 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	816 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	817 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	818 <Iteration_iter-num>34</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	819 <Iteration_query-ID>Query_5</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	820 <Iteration_query-def>Reverse_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	821 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	822 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	823 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	824 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	825 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	826 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	827 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	828 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	829 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	830 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	831 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	832 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	833 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	834 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	835 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	836 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	837 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	838 <Iteration_iter-num>35</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	839 <Iteration_query-ID>Query_5</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	840 <Iteration_query-def>Reverse_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	841 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	842 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	843 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	844 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	845 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	846 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	847 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	848 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	849 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	850 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	851 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	852 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	853 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	854 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	855 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	856 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	857 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	858 <Iteration_iter-num>36</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	859 <Iteration_query-ID>Query_5</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	860 <Iteration_query-def>Reverse_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	861 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	862 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	863 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	864 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	865 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	866 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	867 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	868 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	869 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	870 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	871 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	872 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	873 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	874 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	875 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	876 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	877 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	878 <Iteration_iter-num>37</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	879 <Iteration_query-ID>Query_5</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	880 <Iteration_query-def>Reverse_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	881 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	882 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	883 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	884 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	885 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	886 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	887 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	888 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	889 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	890 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	891 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	892 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	893 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	894 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	895 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	896 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	897 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	898 <Iteration_iter-num>38</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	899 <Iteration_query-ID>Query_5</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	900 <Iteration_query-def>Reverse_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	901 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	902 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	903 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	904 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	905 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	906 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	907 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	908 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	909 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	910 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	911 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	912 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	913 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	914 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	915 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	916 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	917 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	918 <Iteration_iter-num>39</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	919 <Iteration_query-ID>Query_5</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	920 <Iteration_query-def>Reverse_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	921 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	922 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	923 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	924 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	925 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	926 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	927 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	928 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	929 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	930 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	931 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	932 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	933 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	934 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	935 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	936 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	937 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	938 <Iteration_iter-num>40</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	939 <Iteration_query-ID>Query_5</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	940 <Iteration_query-def>Reverse_Primer\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	941 <Iteration_query-len>20</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	942 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	943 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	944 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	945 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	946 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	947 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	948 <Statistics_hsp-len>8</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	949 <Statistics_eff-space>12312</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	950 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	951 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	952 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	953 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	954 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	955 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	956 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	957 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	958 <Iteration_iter-num>41</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	959 <Iteration_query-ID>Query_6</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	960 <Iteration_query-def>Probe\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	961 <Iteration_query-len>25</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	962 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	963 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	964 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	965 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	966 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	967 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	968 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	969 <Statistics_eff-space>16400</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	970 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	971 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	972 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	973 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	974 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	975 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	976 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	977 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	978 <Iteration_iter-num>42</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	979 <Iteration_query-ID>Query_6</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	980 <Iteration_query-def>Probe\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	981 <Iteration_query-len>25</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	982 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	983 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	984 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	985 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	986 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	987 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	988 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	989 <Statistics_eff-space>16400</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	990 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	991 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	992 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	993 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	994 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	995 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	996 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	997 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	998 <Iteration_iter-num>43</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	999 <Iteration_query-ID>Query_6</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1000 <Iteration_query-def>Probe\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1001 <Iteration_query-len>25</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1002 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1003 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1004 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1005 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1006 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1007 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1008 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1009 <Statistics_eff-space>16400</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1010 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1011 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1012 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1013 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1014 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1015 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1016 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1017 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1018 <Iteration_iter-num>44</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1019 <Iteration_query-ID>Query_6</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1020 <Iteration_query-def>Probe\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1021 <Iteration_query-len>25</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1022 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1023 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1024 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1025 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1026 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1027 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1028 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1029 <Statistics_eff-space>16400</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1030 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1031 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1032 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1033 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1034 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1035 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1036 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1037 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1038 <Iteration_iter-num>45</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1039 <Iteration_query-ID>Query_6</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1040 <Iteration_query-def>Probe\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1041 <Iteration_query-len>25</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1042 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1043 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1044 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1045 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1046 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1047 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1048 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1049 <Statistics_eff-space>16400</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1050 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1051 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1052 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1053 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1054 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1055 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1056 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1057 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1058 <Iteration_iter-num>46</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1059 <Iteration_query-ID>Query_6</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1060 <Iteration_query-def>Probe\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1061 <Iteration_query-len>25</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1062 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1063 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1064 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1065 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1066 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1067 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1068 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1069 <Statistics_eff-space>16400</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1070 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1071 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1072 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1073 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1074 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1075 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1076 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1077 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1078 <Iteration_iter-num>47</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1079 <Iteration_query-ID>Query_6</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1080 <Iteration_query-def>Probe\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1081 <Iteration_query-len>25</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1082 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1083 <Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1084 <Hit_num>1</Hit_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1085 <Hit_id>Subject_7</Hit_id>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1086 <Hit_def>AY326434\|GenBank\|insert_MON810\|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS\|-2635190737607180000</Hit_def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1087 <Hit_accession>Subject_7</Hit_accession>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1088 <Hit_len>4180</Hit_len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1089 <Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1090 <Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1091 <Hsp_num>1</Hsp_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1092 <Hsp_bit-score>37.3537</Hsp_bit-score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1093 <Hsp_score>40</Hsp_score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1094 <Hsp_evalue>9.33825e-08</Hsp_evalue>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1095 <Hsp_query-from>1</Hsp_query-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1096 <Hsp_query-to>25</Hsp_query-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1097 <Hsp_hit-from>1541</Hsp_hit-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1098 <Hsp_hit-to>1565</Hsp_hit-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1099 <Hsp_query-frame>1</Hsp_query-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1100 <Hsp_hit-frame>1</Hsp_hit-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1101 <Hsp_identity>23</Hsp_identity>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1102 <Hsp_positive>23</Hsp_positive>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1103 <Hsp_gaps>0</Hsp_gaps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1104 <Hsp_align-len>25</Hsp_align-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1105 <Hsp_qseq>ACATGAACAGCGCCTTGACCACAGC</Hsp_qseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1106 <Hsp_hseq>ACATGAACAGCGCCCTGACCACCGC</Hsp_hseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1107 <Hsp_midline>\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|</Hsp_midline>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1108 </Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1109 </Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1110 </Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1111 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1112 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1113 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1114 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1115 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1116 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1117 <Statistics_eff-space>16400</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1118 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1119 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1120 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1121 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1122 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1123 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1124 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1125 <Iteration_iter-num>48</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1126 <Iteration_query-ID>Query_6</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1127 <Iteration_query-def>Probe\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1128 <Iteration_query-len>25</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1129 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1130 <Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1131 <Hit_num>1</Hit_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1132 <Hit_id>Subject_8</Hit_id>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1133 <Hit_def>EUG\|RIKILT\|plasmid_pV-ZMBK07\|plasmid_pV-ZMBK07\|-2635190737607180000</Hit_def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1134 <Hit_accession>Subject_8</Hit_accession>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1135 <Hit_len>4983</Hit_len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1136 <Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1137 <Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1138 <Hsp_num>1</Hsp_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1139 <Hsp_bit-score>37.3537</Hsp_bit-score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1140 <Hsp_score>40</Hsp_score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1141 <Hsp_evalue>9.33825e-08</Hsp_evalue>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1142 <Hsp_query-from>1</Hsp_query-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1143 <Hsp_query-to>25</Hsp_query-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1144 <Hsp_hit-from>2344</Hsp_hit-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1145 <Hsp_hit-to>2368</Hsp_hit-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1146 <Hsp_query-frame>1</Hsp_query-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1147 <Hsp_hit-frame>1</Hsp_hit-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1148 <Hsp_identity>23</Hsp_identity>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1149 <Hsp_positive>23</Hsp_positive>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1150 <Hsp_gaps>0</Hsp_gaps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1151 <Hsp_align-len>25</Hsp_align-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1152 <Hsp_qseq>ACATGAACAGCGCCTTGACCACAGC</Hsp_qseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1153 <Hsp_hseq>ACATGAACAGCGCCCTGACCACCGC</Hsp_hseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1154 <Hsp_midline>\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|</Hsp_midline>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1155 </Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1156 </Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1157 </Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1158 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1159 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1160 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1161 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1162 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1163 <Statistics_hsp-len>9</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1164 <Statistics_eff-space>16400</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1165 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1166 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1167 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1168 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1169 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1170 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1171 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1172 <Iteration_iter-num>49</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1173 <Iteration_query-ID>Query_7</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1174 <Iteration_query-def>Amplicon\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1175 <Iteration_query-len>74</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1176 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1177 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1178 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1179 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1180 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1181 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1182 <Statistics_hsp-len>11</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1183 <Statistics_eff-space>64449</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1184 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1185 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1186 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1187 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1188 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1189 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1190 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1191 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1192 <Iteration_iter-num>50</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1193 <Iteration_query-ID>Query_7</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1194 <Iteration_query-def>Amplicon\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1195 <Iteration_query-len>74</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1196 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1197 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1198 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1199 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1200 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1201 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1202 <Statistics_hsp-len>11</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1203 <Statistics_eff-space>64449</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1204 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1205 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1206 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1207 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1208 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1209 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1210 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1211 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1212 <Iteration_iter-num>51</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1213 <Iteration_query-ID>Query_7</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1214 <Iteration_query-def>Amplicon\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1215 <Iteration_query-len>74</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1216 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1217 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1218 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1219 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1220 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1221 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1222 <Statistics_hsp-len>11</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1223 <Statistics_eff-space>64449</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1224 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1225 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1226 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1227 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1228 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1229 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1230 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1231 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1232 <Iteration_iter-num>52</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1233 <Iteration_query-ID>Query_7</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1234 <Iteration_query-def>Amplicon\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1235 <Iteration_query-len>74</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1236 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1237 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1238 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1239 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1240 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1241 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1242 <Statistics_hsp-len>11</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1243 <Statistics_eff-space>64449</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1244 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1245 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1246 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1247 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1248 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1249 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1250 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1251 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1252 <Iteration_iter-num>53</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1253 <Iteration_query-ID>Query_7</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1254 <Iteration_query-def>Amplicon\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1255 <Iteration_query-len>74</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1256 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1257 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1258 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1259 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1260 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1261 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1262 <Statistics_hsp-len>11</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1263 <Statistics_eff-space>64449</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1264 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1265 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1266 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1267 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1268 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1269 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1270 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1271 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1272 <Iteration_iter-num>54</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1273 <Iteration_query-ID>Query_7</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1274 <Iteration_query-def>Amplicon\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1275 <Iteration_query-len>74</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1276 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1277 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1278 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1279 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1280 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1281 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1282 <Statistics_hsp-len>11</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1283 <Statistics_eff-space>64449</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1284 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1285 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1286 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1287 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1288 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1289 <Iteration_message>No hits found</Iteration_message>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1290 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1291 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1292 <Iteration_iter-num>55</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1293 <Iteration_query-ID>Query_7</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1294 <Iteration_query-def>Amplicon\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1295 <Iteration_query-len>74</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1296 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1297 <Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1298 <Hit_num>1</Hit_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1299 <Hit_id>Subject_7</Hit_id>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1300 <Hit_def>AY326434\|GenBank\|insert_MON810\|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS\|-2635190737607180000</Hit_def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1301 <Hit_accession>Subject_7</Hit_accession>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1302 <Hit_len>4180</Hit_len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1303 <Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1304 <Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1305 <Hsp_num>1</Hsp_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1306 <Hsp_bit-score>89.6514</Hsp_bit-score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1307 <Hsp_score>98</Hsp_score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1308 <Hsp_evalue>6.62923e-23</Hsp_evalue>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1309 <Hsp_query-from>1</Hsp_query-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1310 <Hsp_query-to>74</Hsp_query-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1311 <Hsp_hit-from>1516</Hsp_hit-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1312 <Hsp_hit-to>1589</Hsp_hit-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1313 <Hsp_query-frame>1</Hsp_query-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1314 <Hsp_hit-frame>1</Hsp_hit-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1315 <Hsp_identity>64</Hsp_identity>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1316 <Hsp_positive>64</Hsp_positive>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1317 <Hsp_gaps>0</Hsp_gaps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1318 <Hsp_align-len>74</Hsp_align-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1319 <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1320 <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1321 <Hsp_midline>\|\|\|\|\| \|\|\|\|\| \|\| \|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\| \|\|\|\|\|\| \| \|\|\|\|\| \|\|\|\|\|\|\|\|</Hsp_midline>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1322 </Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1323 </Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1324 </Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1325 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1326 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1327 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1328 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1329 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1330 <Statistics_hsp-len>11</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1331 <Statistics_eff-space>64449</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1332 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1333 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1334 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1335 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1336 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1337 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1338 <Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1339 <Iteration_iter-num>56</Iteration_iter-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1340 <Iteration_query-ID>Query_7</Iteration_query-ID>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1341 <Iteration_query-def>Amplicon\|QL-ELE-Bt-F1(mod)/Bt-R</Iteration_query-def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1342 <Iteration_query-len>74</Iteration_query-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1343 <Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1344 <Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1345 <Hit_num>1</Hit_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1346 <Hit_id>Subject_8</Hit_id>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1347 <Hit_def>EUG\|RIKILT\|plasmid_pV-ZMBK07\|plasmid_pV-ZMBK07\|-2635190737607180000</Hit_def>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1348 <Hit_accession>Subject_8</Hit_accession>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1349 <Hit_len>4983</Hit_len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1350 <Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1351 <Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1352 <Hsp_num>1</Hsp_num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1353 <Hsp_bit-score>89.6514</Hsp_bit-score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1354 <Hsp_score>98</Hsp_score>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1355 <Hsp_evalue>6.62923e-23</Hsp_evalue>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1356 <Hsp_query-from>1</Hsp_query-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1357 <Hsp_query-to>74</Hsp_query-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1358 <Hsp_hit-from>2319</Hsp_hit-from>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1359 <Hsp_hit-to>2392</Hsp_hit-to>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1360 <Hsp_query-frame>1</Hsp_query-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1361 <Hsp_hit-frame>1</Hsp_hit-frame>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1362 <Hsp_identity>64</Hsp_identity>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1363 <Hsp_positive>64</Hsp_positive>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1364 <Hsp_gaps>0</Hsp_gaps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1365 <Hsp_align-len>74</Hsp_align-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1366 <Hsp_qseq>GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAA</Hsp_qseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1367 <Hsp_hseq>GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTCTTCGCCGTCCAGAA</Hsp_hseq>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1368 <Hsp_midline>\|\|\|\|\| \|\|\|\|\| \|\| \|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\| \|\|\|\|\|\| \| \|\|\|\|\| \|\|\|\|\|\|\|\|</Hsp_midline>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1369 </Hsp>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1370 </Hit_hsps>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1371 </Hit>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1372 </Iteration_hits>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1373 <Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1374 <Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1375 <Statistics_db-num>0</Statistics_db-num>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1376 <Statistics_db-len>0</Statistics_db-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1377 <Statistics_hsp-len>11</Statistics_hsp-len>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1378 <Statistics_eff-space>64449</Statistics_eff-space>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1379 <Statistics_kappa>0.41</Statistics_kappa>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1380 <Statistics_lambda>0.625</Statistics_lambda>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1381 <Statistics_entropy>0.78</Statistics_entropy>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1382 </Statistics>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1383 </Iteration_stat>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1384 </Iteration>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1385 </BlastOutput_iterations>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1386 </BlastOutput>
b77934f57522 add more example xmls, move them to a subdirectory Jan Kanis <jan.code@jankanis.nl> parents: diff changeset	1387

Mercurial > repos > jankanis > blast2html

annotate test-data/blast xml example3.xml @ 38:91008923c402