Mercurial > repos > jankanis > blast2html
annotate test-data/blast xml example4.html @ 110:e17aae23cc1c
report query parameters for each query
| author | Jan Kanis <jan.code@jankanis.nl> |
|---|---|
| date | Wed, 09 Jul 2014 15:04:37 +0200 |
| parents | b3b5ee557170 |
| children | 4f0ed3b5ae46 |
| rev | line source |
|---|---|
| 32 | 1 <!DOCTYPE html> |
| 2 <html> | |
| 3 <head> | |
| 4 <meta charset="UTF-8"> | |
|
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
5 <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> |
| 32 | 6 |
| 7 <title>Blast output</title> | |
| 8 | |
| 9 <style> | |
| 10 body { | |
| 11 color: #333333; | |
| 12 font-family: Arial,Sans-Serif; | |
| 13 } | |
| 14 | |
| 15 :link { | |
| 16 color: #336699; | |
| 17 } | |
| 18 | |
| 19 .right { | |
| 20 float: right; | |
| 21 } | |
| 22 | |
| 23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ | |
| 24 #strip_html_warning { | |
| 25 display: none; | |
| 26 } | |
| 27 | |
| 28 #content { | |
| 29 margin: 0 2em; | |
| 30 padding: 0.5em; | |
| 31 border: 1px solid #888888; | |
| 32 background-color: #d3dff5; | |
| 33 } | |
| 34 | |
| 35 h1, h2, h3, h4, h5, h6 { | |
| 36 color: #2A6979; | |
| 37 font-family: arial,verdana,sans-serif; | |
| 38 letter-spacing: -1px; | |
| 39 margin: 1.2em 0 0.3em; | |
| 40 } | |
| 41 | |
| 42 h1 { | |
| 43 border-bottom: 1px solid #CCCCCC; | |
| 44 font-size: 150%; | |
| 45 padding-bottom: 0.1em; | |
| 46 } | |
| 47 | |
| 48 h2 { | |
| 49 font-size: 120%; | |
| 50 font-weight: bold; | |
| 51 } | |
| 52 | |
| 53 h4.darkHeader { | |
| 54 color: #4D4D4D; | |
| 55 letter-spacing: 0; | |
| 56 font-weight: bold; | |
| 57 } | |
| 58 | |
| 59 #nodata { | |
| 60 font-weight: bold; | |
| 61 } | |
| 62 | |
| 63 .index { | |
| 64 margin-bottom: 3em; | |
| 65 } | |
| 66 .index div.indexentry { | |
| 67 margin: 1.2em 1.6em; | |
| 68 font-weight: bold; | |
| 69 font-size: 100%; | |
| 70 } | |
| 71 | |
| 72 .headerdata { | |
| 73 font-size: 90%; | |
| 74 } | |
| 75 .headerdata .param { | |
| 76 font-weight: bold; | |
| 77 text-align: right; | |
| 78 padding: 0 1em; | |
| 79 } | |
| 80 | |
| 81 .grey { | |
| 82 background-color: #eeeeee; | |
| 83 border: 1px solid #cccccc; | |
| 84 padding: 1em; | |
| 85 } | |
| 86 | |
| 87 .white { | |
| 88 background-color: white; | |
| 89 border: 1px solid #cccccc; | |
| 90 padding: 1.5em 2%; | |
| 91 } | |
| 92 | |
| 93 .graphicrow { | |
| 94 clear: left; | |
| 95 width: 100%; | |
| 96 } | |
| 97 | |
| 98 .graphicitem { | |
| 99 float: left; | |
| 100 } | |
| 101 | |
| 102 | |
| 103 | |
| 104 .graphics .grey { | |
| 105 text-align: center; | |
| 106 } | |
| 107 | |
| 108 .graphic { | |
| 109 background-color: white; | |
| 110 border: 2px solid black; | |
| 111 padding: 1.5em; | |
| 112 margin: auto; | |
| 113 } | |
| 114 | |
| 115 .centered, .defline, div.legend, div.tablewrapper { | |
| 116 margin-left: auto; | |
| 117 margin-right: auto; | |
| 118 } | |
| 119 | |
| 120 .defline { | |
| 121 background-color: white; | |
| 122 border: 1px solid black; | |
| 123 margin: .5em auto; | |
| 124 padding-left: .2em; | |
| 125 padding-right: .2em; | |
| 126 max-width: 50em; | |
| 127 text-align: left; | |
| 128 height: 2.8em; | |
| 59 | 129 overflow: hidden; |
| 32 | 130 } |
| 131 | |
| 132 div.legend { | |
| 133 max-width: 40em; | |
| 134 } | |
| 135 div.legend div { | |
| 136 width: 100%; | |
| 137 color: white; | |
| 138 font-weight: bold; | |
| 139 border-spacing: 0; | |
| 140 } | |
| 141 div.legend div .graphicitem { | |
| 142 width: 20%; | |
| 143 padding: 0; | |
| 144 margin: 0; | |
| 145 border: none; | |
| 146 } | |
| 147 | |
| 148 div.tablewrapper { | |
| 149 width: 50%; | |
| 150 min-width: 60em; | |
| 151 } | |
| 152 | |
| 153 /* For small widths we give the graphic 100% */ | |
| 154 @media (max-width: 72.5em) { | |
| 155 div.tablewrapper { | |
| 156 width: 100%; | |
| 157 min-width: 0px; | |
| 158 } | |
| 159 } | |
| 160 | |
| 161 .scale { | |
| 162 width: 100%; | |
| 163 margin: .5em 0; | |
| 164 font-weight: bold; | |
| 165 } | |
| 166 .scale div { | |
| 167 color: red; | |
| 168 text-align: left; | |
| 169 } | |
| 170 .scale .graphicrow { | |
| 171 margin: .5em 0 .5em 0; | |
| 172 color: white; | |
| 173 } | |
| 174 .scale .graphicitem { | |
| 175 position: relative; | |
| 176 } | |
| 177 .scale .graphicitem div { | |
| 178 margin: 0 1px; | |
| 179 padding: 0 2px; | |
| 180 text-align: right; | |
| 181 background-color: red; | |
| 182 color: white; | |
| 183 } | |
| 184 .scale .graphicitem:first-child div { | |
| 185 margin-left: 0px; | |
| 186 } | |
| 187 .scale .graphicitem:last-child div { | |
| 188 margin-right: 0px; | |
| 189 } | |
| 190 .scale .graphicitem .lastlabel { | |
| 191 position: absolute; | |
| 192 top: 0px; | |
| 193 left: 100%; | |
| 194 background-color: transparent; | |
| 195 color: red; | |
| 196 } | |
| 197 | |
| 198 a.matchresult { | |
| 199 display: block; | |
| 200 margin: 0; | |
| 201 padding: 0; | |
| 202 } | |
| 203 div.matchrow { | |
| 204 margin-top: 4px; | |
| 205 } | |
| 206 div.matchrow, div.matchitem { | |
| 207 height: 4px; | |
| 208 } | |
| 209 | |
| 210 | |
| 211 table.descriptiontable { | |
| 212 font-size: 85%; | |
| 213 border: 1px solid #97b0c8; | |
| 214 border-spacing: 0; | |
| 215 color: #222222; | |
| 216 line-height: 1.3em; | |
| 217 background-color: white; | |
| 218 } | |
| 219 table.descriptiontable col:first-child { | |
| 220 width: 100%; | |
| 221 } | |
| 222 table.descriptiontable tr:hover { | |
| 223 background-color: #D5DEE3; | |
| 224 } | |
| 225 table.descriptiontable th { | |
| 226 color: #14376C; | |
| 227 font-weight: normal; | |
| 228 background-color: #F0F0F0; | |
| 229 background: linear-gradient(#FFFFFF, #F0F0F0); | |
| 230 border-bottom: 1px solid #D4DFE9; | |
| 231 border-right: 1px solid #CFCFCF; | |
| 232 border-left: 0px solid black; | |
| 233 border-top: 0px solid black; | |
| 234 } | |
| 235 table.descriptiontable td { | |
| 236 overflow: hidden; | |
| 237 text-align: center; | |
| 238 padding: .4em .8em; | |
| 239 } | |
| 240 table.descriptiontable td div { | |
| 241 width: 1em; | |
| 242 overflow: visible; | |
| 243 white-space: nowrap; | |
| 244 text-align: left; | |
| 245 } | |
| 246 | |
| 247 | |
| 248 | |
| 249 .alignments .white { | |
| 250 padding: 1.5em 1em; | |
| 251 } | |
| 252 | |
| 253 .alignment { | |
| 254 border-top: 1px solid black; | |
| 255 padding-left: 1em; | |
| 256 padding-right: 1em; | |
| 257 } | |
| 258 | |
| 259 div.linkheader { | |
| 260 padding-top: .2em; | |
| 261 font-size: 85%; | |
| 262 color: #14376C; | |
| 263 } | |
| 264 div.linkheader a.linkheader { | |
| 265 margin-right: 1em; | |
| 266 } | |
| 267 div.linkheader .right a { | |
| 268 text-decoration: none; | |
| 269 } | |
| 270 | |
| 271 .title .hittitle { | |
| 272 color: #222222; | |
| 273 margin-bottom: .3em; | |
| 274 } | |
| 275 .title .titleinfo { | |
| 276 font-size: 80%; | |
| 277 margin-top: 0; | |
| 278 margin-bottom: .3em; | |
| 279 } | |
| 280 .title .titleinfo .b { | |
| 281 color: #606060; | |
| 282 font-weight: bold; | |
| 283 font-size: 90%; | |
| 284 } | |
| 285 | |
| 286 .moretitles { | |
| 287 margin: 1.2em; | |
| 288 } | |
| 289 .moretitles .titleinfo { | |
| 290 margin: 0; | |
| 291 padding: 0; | |
| 292 } | |
| 293 .moretitles .hittitle { | |
| 294 margin: .4em 0 .2em 0; | |
| 295 padding: 0; | |
| 296 } | |
| 297 | |
| 298 a.showmoretitles { | |
| 299 font-size: 75%; | |
| 300 color: #336699; | |
| 301 font-weight: bold; | |
| 302 margin-top: 0; | |
| 303 } | |
| 304 a.showmoretitles:hover { | |
| 305 } | |
| 306 | |
| 307 .hotspot { | |
| 308 color: #606060; | |
| 309 font-family: verdana, arial, sans-serif; | |
| 310 margin-bottom: 2.5em; | |
| 311 } | |
| 312 | |
| 313 .hotspot p.range { | |
| 314 font-size: 70%; | |
| 315 margin-top: 0; | |
| 316 margin-top: 1em; | |
| 317 margin-bottom: .2em; | |
| 318 } | |
| 319 .hotspot p.range span.range { | |
| 320 font-weight: bold; | |
| 321 } | |
| 322 .hotspot p.range a.range { | |
| 323 margin-left: .5em; | |
| 324 } | |
| 325 | |
| 326 table.hotspotstable { | |
| 327 border-top: 1px solid; | |
| 328 border-bottom: 1px solid; | |
| 329 text-align: left; | |
| 330 border-collapse: collapse; | |
| 331 } | |
| 332 table.hotspotstable th, table.hotspotstable td { | |
| 333 padding: .1em 1em; | |
| 334 } | |
| 335 table.hotspotstable th { | |
| 336 font-size: 70%; | |
| 337 } | |
| 338 table.hotspotstable td { | |
| 339 min-width: 7em; | |
| 340 color: #222222; | |
| 341 font-size: 80%; | |
| 342 } | |
| 343 | |
| 344 pre.alignmentgraphic { | |
| 345 color: #222222; | |
| 346 } | |
| 347 | |
| 348 footer { | |
| 349 text-align: center; | |
| 350 color: #cccccc; | |
| 351 font-size: 70%; | |
| 352 margin-top: 1em; | |
| 353 } | |
| 354 footer :link { | |
| 355 color: #5588cc; | |
| 356 } | |
| 357 | |
| 358 </style> | |
| 359 | |
| 360 <script type="text/javascript"> | |
| 361 function toggle_visibility(id) { | |
| 362 var e = document.getElementById(id); | |
| 363 if(e.style.display != 'block') | |
| 364 e.style.display = 'block'; | |
| 365 else | |
| 366 e.style.display = 'none'; | |
| 367 } | |
| 368 </script> | |
| 369 | |
| 370 </head> | |
| 371 | |
| 372 | |
| 373 <body> | |
| 374 | |
| 375 <div id="strip_html_warning"> | |
| 376 <!-- This div should be hidden by the header css block. Galaxy | |
| 377 strips all css, breaking this page but making this warning | |
| 378 visible. This warning contains some ugly old skool tabular html | |
| 379 layout that is not stripped. --> | |
| 380 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> | |
| 381 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> | |
| 382 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. | |
| 383 </b></font></td></tr></table> | |
| 384 </div> | |
| 385 | |
| 386 <div id=content> | |
| 387 | |
| 388 | |
| 389 <section class=index> | |
| 390 <h1>Queries</h1> | |
| 391 | |
| 392 <div class=indexentry><a href="#match1"> | |
| 393 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 394 (20 letters, 2 hits) | |
| 395 </a></div> | |
| 396 <div class=indexentry><a href="#match2"> | |
| 397 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 398 (20 letters, 0 hits) | |
| 399 </a></div> | |
| 400 <div class=indexentry><a href="#match3"> | |
| 401 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 402 (20 letters, 3 hits) | |
| 403 </a></div> | |
| 404 <div class=indexentry><a href="#match4"> | |
| 405 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 406 (24 letters, 0 hits) | |
| 407 </a></div> | |
| 408 <div class=indexentry><a href="#match5"> | |
| 409 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 410 (20 letters, 0 hits) | |
| 411 </a></div> | |
| 412 <div class=indexentry><a href="#match6"> | |
| 413 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 414 (25 letters, 2 hits) | |
| 415 </a></div> | |
| 416 <div class=indexentry><a href="#match7"> | |
| 417 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 418 (74 letters, 2 hits) | |
| 419 </a></div> | |
| 420 | |
| 421 </section> | |
| 422 | |
| 423 | |
| 424 <section class=match id=match1> | |
| 425 | |
| 426 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 427 | |
| 428 <section class=header> | |
| 429 | |
| 430 <table class=headerdata> | |
| 431 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 432 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 433 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 434 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 435 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 436 </table> | |
| 437 | |
| 438 </section> | |
| 439 | |
| 440 | |
| 441 <section class=graphics> | |
| 442 <h2>Graphic Summary</h2> | |
| 443 | |
| 444 <div class=grey> | |
| 445 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> | |
| 446 | |
| 447 <div class=defline id=defline1> | |
| 448 Mouse-over to show defline and scores, click to show alignments | |
| 449 </div> | |
| 450 | |
| 451 <div class=graphic> | |
| 452 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 453 <div class=legend><div class=graphicrow> | |
| 454 <div class=graphicitem style="background-color: black"><40</div> | |
| 455 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 456 <div class=graphicitem style="background-color: green">50–80</div> | |
| 457 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 458 <div class=graphicitem style="background-color: red">200≤</div> | |
| 459 </div></div> | |
| 460 <div style="clear: left"></div> | |
| 461 | |
| 462 <div class=tablewrapper> | |
| 463 | |
| 464 <div class=scale> | |
| 465 <div>query:</div> | |
| 466 <div class=graphicrow> | |
| 467 <div> | |
| 77 | 468 <div class=graphicitem style="width: 10%"> |
| 32 | 469 <div>2</div> |
| 470 </div> | |
| 77 | 471 <div class=graphicitem style="width: 10%"> |
| 32 | 472 <div>4</div> |
| 473 </div> | |
| 77 | 474 <div class=graphicitem style="width: 10%"> |
| 32 | 475 <div>6</div> |
| 476 </div> | |
| 77 | 477 <div class=graphicitem style="width: 10%"> |
| 32 | 478 <div>8</div> |
| 479 </div> | |
| 77 | 480 <div class=graphicitem style="width: 10%"> |
| 32 | 481 <div>10</div> |
| 482 </div> | |
| 77 | 483 <div class=graphicitem style="width: 10%"> |
| 32 | 484 <div>12</div> |
| 485 </div> | |
| 77 | 486 <div class=graphicitem style="width: 10%"> |
| 32 | 487 <div>14</div> |
| 488 </div> | |
| 77 | 489 <div class=graphicitem style="width: 10%"> |
| 32 | 490 <div>16</div> |
| 491 </div> | |
| 77 | 492 <div class=graphicitem style="width: 10%"> |
| 32 | 493 <div>18</div> |
| 494 </div> | |
| 77 | 495 <div class=graphicitem style="width: 10%"> |
| 32 | 496 <div>20</div> |
| 497 </div> | |
| 498 </div> | |
| 499 </div> | |
| 500 <div style="clear: left"></div> | |
| 501 </div> | |
| 502 | |
| 503 <a class=matchresult | |
| 59 | 504 href="#hit1-1" |
| 32 | 505 onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
| 506 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 507 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 508 <div class="matchrow graphicrow"> | |
| 509 <div class="matchitem graphicitem" | |
| 77 | 510 style="background-color: black; width: 100%"></div> |
| 32 | 511 </div> |
| 512 </a> | |
| 513 | |
| 514 <a class=matchresult | |
| 59 | 515 href="#hit1-2" |
| 32 | 516 onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
| 517 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 518 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 519 <div class="matchrow graphicrow"> | |
| 520 <div class="matchitem graphicitem" | |
| 77 | 521 style="background-color: black; width: 100%"></div> |
| 32 | 522 </div> |
| 523 </a> | |
| 524 | |
| 525 </div> | |
| 526 </div> | |
| 527 </div> | |
| 528 </section> | |
| 529 | |
| 530 | |
| 531 | |
| 532 <section class=descriptions> | |
| 533 <h2>Descriptions</h2> | |
| 534 | |
| 535 <div class=grey><div class=white> | |
| 536 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 537 | |
| 538 <table class=descriptiontable> | |
| 539 <col/><col/><col/><col/><col/><col/><col/> | |
| 540 <tr> | |
| 541 <th>Description</th> | |
| 542 <th>Max score</th> | |
| 543 <th>Total score</th> | |
| 544 <th>Query cover</th> | |
| 545 <th>E value</th> | |
| 546 <th>Ident</th> | |
| 547 <th>Accession</th> | |
| 548 </tr> | |
| 549 <tr> | |
| 59 | 550 <td><div><a href="#hit1-1" |
| 32 | 551 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
| 59 | 552 id="description1-1"> |
| 32 | 553 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
| 554 </a></div></td> | |
| 555 <td>40.1</td> | |
| 556 <td>40.1</td> | |
| 557 <td>100%</td> | |
| 558 <td>1.513e-07</td> | |
| 559 <td>100%</td> | |
| 105 | 560 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">5</a></td> |
| 32 | 561 </tr> |
| 562 <tr> | |
| 59 | 563 <td><div><a href="#hit1-2" |
| 32 | 564 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 59 | 565 id="description1-2"> |
| 32 | 566 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
| 567 </a></div></td> | |
| 568 <td>40.1</td> | |
| 569 <td>40.1</td> | |
| 570 <td>100%</td> | |
| 571 <td>1.513e-07</td> | |
| 572 <td>100%</td> | |
| 105 | 573 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">2</a></td> |
| 32 | 574 </tr> |
| 575 </table> | |
| 576 | |
| 577 </div></div> | |
| 578 </section> | |
| 579 | |
| 580 | |
| 581 | |
| 582 <section class=alignments> | |
| 583 <h2>Alignments</h2> | |
| 584 | |
| 585 <div class=grey><div class=white> | |
| 59 | 586 <div class=alignment id=hit1-1> |
| 32 | 587 |
| 588 <div class=linkheader> | |
| 59 | 589 <div class=right><a href="#description1-1">Descriptions</a></div> |
| 105 | 590 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">Gene Bank</a> |
| 32 | 591 </div> |
| 592 | |
| 593 <div class=title> | |
| 594 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 595 <p class=titleinfo> | |
| 105 | 596 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|5</a> |
| 32 | 597 <span class=b>Length:</span> 2457 |
| 598 <span class=b>Number of Matches:</span> 1 | |
| 599 </p> | |
| 600 </div> | |
| 601 | |
| 602 | |
| 59 | 603 <div class=hotspot id=hotspot1-1-1> |
| 32 | 604 <p class=range> |
| 605 <span class=range>Range 1: 2119 to 2138</span> | |
| 606 </p> | |
| 607 | |
| 608 <table class=hotspotstable> | |
| 609 <tr> | |
| 610 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 611 </tr> | |
| 612 <tr> | |
| 613 <td>40.1 bits(20)</td> | |
| 614 <td>0.0</td> | |
| 615 <td>20/20(100%)</td> | |
| 616 <td>0/20(0%)</td> | |
| 617 <td>Plus/Plus</td> | |
| 618 </tr> | |
| 619 </table> | |
| 620 | |
| 621 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 622 |||||||||||||||||||| | |
| 623 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | |
| 624 </div> | |
| 625 | |
| 626 </div> | |
| 627 | |
| 59 | 628 <div class=alignment id=hit1-2> |
| 32 | 629 |
| 630 <div class=linkheader> | |
| 59 | 631 <div class=right><a href="#description1-2">Descriptions</a></div> |
| 105 | 632 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">Gene Bank</a> |
| 32 | 633 </div> |
| 634 | |
| 635 <div class=title> | |
| 636 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 637 <p class=titleinfo> | |
| 105 | 638 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|2</a> |
| 32 | 639 <span class=b>Length:</span> 323 |
| 640 <span class=b>Number of Matches:</span> 1 | |
| 641 </p> | |
| 642 </div> | |
| 643 | |
| 644 | |
| 59 | 645 <div class=hotspot id=hotspot1-2-1> |
| 32 | 646 <p class=range> |
| 647 <span class=range>Range 1: 200 to 219</span> | |
| 648 </p> | |
| 649 | |
| 650 <table class=hotspotstable> | |
| 651 <tr> | |
| 652 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 653 </tr> | |
| 654 <tr> | |
| 655 <td>40.1 bits(20)</td> | |
| 656 <td>0.0</td> | |
| 657 <td>20/20(100%)</td> | |
| 658 <td>0/20(0%)</td> | |
| 659 <td>Plus/Plus</td> | |
| 660 </tr> | |
| 661 </table> | |
| 662 | |
| 663 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 664 |||||||||||||||||||| | |
| 665 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> | |
| 666 </div> | |
| 667 | |
| 668 </div> | |
| 669 | |
| 670 </div></div> | |
| 671 </section> | |
| 672 </section> | |
| 673 | |
| 674 <section class=match id=match2> | |
| 675 | |
| 676 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 677 | |
| 678 <section class=header> | |
| 679 | |
| 680 <table class=headerdata> | |
| 681 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 682 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 683 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 684 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 685 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 686 </table> | |
| 687 | |
| 688 </section> | |
| 689 | |
| 690 <section> | |
| 691 <h2>No Hits</h2> | |
| 692 <div class=grey> | |
| 693 <table class=headerdata> | |
| 694 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 695 </table> | |
| 696 </div> | |
| 697 </section> | |
| 698 </section> | |
| 699 | |
| 700 <section class=match id=match3> | |
| 701 | |
| 702 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 703 | |
| 704 <section class=header> | |
| 705 | |
| 706 <table class=headerdata> | |
| 707 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 708 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 709 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 710 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 711 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 712 </table> | |
| 713 | |
| 714 </section> | |
| 715 | |
| 716 | |
| 717 <section class=graphics> | |
| 718 <h2>Graphic Summary</h2> | |
| 719 | |
| 720 <div class=grey> | |
| 721 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> | |
| 722 | |
| 723 <div class=defline id=defline3> | |
| 724 Mouse-over to show defline and scores, click to show alignments | |
| 725 </div> | |
| 726 | |
| 727 <div class=graphic> | |
| 728 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 729 <div class=legend><div class=graphicrow> | |
| 730 <div class=graphicitem style="background-color: black"><40</div> | |
| 731 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 732 <div class=graphicitem style="background-color: green">50–80</div> | |
| 733 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 734 <div class=graphicitem style="background-color: red">200≤</div> | |
| 735 </div></div> | |
| 736 <div style="clear: left"></div> | |
| 737 | |
| 738 <div class=tablewrapper> | |
| 739 | |
| 740 <div class=scale> | |
| 741 <div>query:</div> | |
| 742 <div class=graphicrow> | |
| 743 <div> | |
| 77 | 744 <div class=graphicitem style="width: 10%"> |
| 32 | 745 <div>2</div> |
| 746 </div> | |
| 77 | 747 <div class=graphicitem style="width: 10%"> |
| 32 | 748 <div>4</div> |
| 749 </div> | |
| 77 | 750 <div class=graphicitem style="width: 10%"> |
| 32 | 751 <div>6</div> |
| 752 </div> | |
| 77 | 753 <div class=graphicitem style="width: 10%"> |
| 32 | 754 <div>8</div> |
| 755 </div> | |
| 77 | 756 <div class=graphicitem style="width: 10%"> |
| 32 | 757 <div>10</div> |
| 758 </div> | |
| 77 | 759 <div class=graphicitem style="width: 10%"> |
| 32 | 760 <div>12</div> |
| 761 </div> | |
| 77 | 762 <div class=graphicitem style="width: 10%"> |
| 32 | 763 <div>14</div> |
| 764 </div> | |
| 77 | 765 <div class=graphicitem style="width: 10%"> |
| 32 | 766 <div>16</div> |
| 767 </div> | |
| 77 | 768 <div class=graphicitem style="width: 10%"> |
| 32 | 769 <div>18</div> |
| 770 </div> | |
| 77 | 771 <div class=graphicitem style="width: 10%"> |
| 32 | 772 <div>20</div> |
| 773 </div> | |
| 774 </div> | |
| 775 </div> | |
| 776 <div style="clear: left"></div> | |
| 777 </div> | |
| 778 | |
| 779 <a class=matchresult | |
| 59 | 780 href="#hit3-1" |
| 32 | 781 onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' |
| 782 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 783 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 784 <div class="matchrow graphicrow"> | |
| 785 <div class="matchitem graphicitem" | |
| 77 | 786 style="background-color: black; width: 100%"></div> |
| 32 | 787 </div> |
| 788 </a> | |
| 789 | |
| 790 <a class=matchresult | |
| 59 | 791 href="#hit3-2" |
| 32 | 792 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' |
| 793 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 794 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 795 <div class="matchrow graphicrow"> | |
| 796 <div class="matchitem graphicitem" | |
| 77 | 797 style="background-color: black; width: 100%"></div> |
| 32 | 798 </div> |
| 799 </a> | |
| 800 | |
| 801 <a class=matchresult | |
| 59 | 802 href="#hit3-3" |
| 32 | 803 onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' |
| 804 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 805 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | |
| 806 <div class="matchrow graphicrow"> | |
| 807 <div class="matchitem graphicitem" | |
| 77 | 808 style="background-color: transparent; width: 15%"></div> |
| 32 | 809 <div class="matchitem graphicitem" |
| 77 | 810 style="background-color: black; width: 85%"></div> |
| 32 | 811 </div> |
| 812 </a> | |
| 813 | |
| 814 </div> | |
| 815 </div> | |
| 816 </div> | |
| 817 </section> | |
| 818 | |
| 819 | |
| 820 | |
| 821 <section class=descriptions> | |
| 822 <h2>Descriptions</h2> | |
| 823 | |
| 824 <div class=grey><div class=white> | |
| 825 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 826 | |
| 827 <table class=descriptiontable> | |
| 828 <col/><col/><col/><col/><col/><col/><col/> | |
| 829 <tr> | |
| 830 <th>Description</th> | |
| 831 <th>Max score</th> | |
| 832 <th>Total score</th> | |
| 833 <th>Query cover</th> | |
| 834 <th>E value</th> | |
| 835 <th>Ident</th> | |
| 836 <th>Accession</th> | |
| 837 </tr> | |
| 838 <tr> | |
| 59 | 839 <td><div><a href="#hit3-1" |
| 32 | 840 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" |
| 59 | 841 id="description3-1"> |
| 32 | 842 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 |
| 843 </a></div></td> | |
| 844 <td>40.1</td> | |
| 845 <td>40.1</td> | |
| 846 <td>100%</td> | |
| 847 <td>1.513e-07</td> | |
| 848 <td>100%</td> | |
| 105 | 849 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">5</a></td> |
| 32 | 850 </tr> |
| 851 <tr> | |
| 59 | 852 <td><div><a href="#hit3-2" |
| 32 | 853 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
| 59 | 854 id="description3-2"> |
| 32 | 855 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 |
| 856 </a></div></td> | |
| 857 <td>40.1</td> | |
| 858 <td>40.1</td> | |
| 859 <td>100%</td> | |
| 860 <td>1.513e-07</td> | |
| 861 <td>100%</td> | |
| 105 | 862 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">2</a></td> |
| 32 | 863 </tr> |
| 864 <tr> | |
| 59 | 865 <td><div><a href="#hit3-3" |
| 32 | 866 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" |
| 59 | 867 id="description3-3"> |
| 32 | 868 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 |
| 869 </a></div></td> | |
| 870 <td>34.2</td> | |
| 871 <td>34.2</td> | |
| 872 <td>85%</td> | |
| 873 <td>9.334e-06</td> | |
| 874 <td>100%</td> | |
| 105 | 875 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">1</a></td> |
| 32 | 876 </tr> |
| 877 </table> | |
| 878 | |
| 879 </div></div> | |
| 880 </section> | |
| 881 | |
| 882 | |
| 883 | |
| 884 <section class=alignments> | |
| 885 <h2>Alignments</h2> | |
| 886 | |
| 887 <div class=grey><div class=white> | |
| 59 | 888 <div class=alignment id=hit3-1> |
| 32 | 889 |
| 890 <div class=linkheader> | |
| 59 | 891 <div class=right><a href="#description3-1">Descriptions</a></div> |
| 105 | 892 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">Gene Bank</a> |
| 32 | 893 </div> |
| 894 | |
| 895 <div class=title> | |
| 896 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 897 <p class=titleinfo> | |
| 105 | 898 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|5</a> |
| 32 | 899 <span class=b>Length:</span> 2457 |
| 900 <span class=b>Number of Matches:</span> 1 | |
| 901 </p> | |
| 902 </div> | |
| 903 | |
| 904 | |
| 59 | 905 <div class=hotspot id=hotspot3-1-1> |
| 32 | 906 <p class=range> |
| 907 <span class=range>Range 1: 2143 to 2162</span> | |
| 908 </p> | |
| 909 | |
| 910 <table class=hotspotstable> | |
| 911 <tr> | |
| 912 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 913 </tr> | |
| 914 <tr> | |
| 915 <td>40.1 bits(20)</td> | |
| 916 <td>0.0</td> | |
| 917 <td>20/20(100%)</td> | |
| 918 <td>0/20(0%)</td> | |
| 919 <td>Plus/Plus</td> | |
| 920 </tr> | |
| 921 </table> | |
| 922 | |
| 923 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 924 |||||||||||||||||||| | |
| 925 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | |
| 926 </div> | |
| 927 | |
| 928 </div> | |
| 929 | |
| 59 | 930 <div class=alignment id=hit3-2> |
| 32 | 931 |
| 932 <div class=linkheader> | |
| 59 | 933 <div class=right><a href="#description3-2">Descriptions</a></div> |
| 105 | 934 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">Gene Bank</a> |
| 32 | 935 </div> |
| 936 | |
| 937 <div class=title> | |
| 938 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 939 <p class=titleinfo> | |
| 105 | 940 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|2</a> |
| 32 | 941 <span class=b>Length:</span> 323 |
| 942 <span class=b>Number of Matches:</span> 1 | |
| 943 </p> | |
| 944 </div> | |
| 945 | |
| 946 | |
| 59 | 947 <div class=hotspot id=hotspot3-2-1> |
| 32 | 948 <p class=range> |
| 949 <span class=range>Range 1: 224 to 243</span> | |
| 950 </p> | |
| 951 | |
| 952 <table class=hotspotstable> | |
| 953 <tr> | |
| 954 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 955 </tr> | |
| 956 <tr> | |
| 957 <td>40.1 bits(20)</td> | |
| 958 <td>0.0</td> | |
| 959 <td>20/20(100%)</td> | |
| 960 <td>0/20(0%)</td> | |
| 961 <td>Plus/Plus</td> | |
| 962 </tr> | |
| 963 </table> | |
| 964 | |
| 965 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 966 |||||||||||||||||||| | |
| 967 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | |
| 968 </div> | |
| 969 | |
| 970 </div> | |
| 971 | |
| 59 | 972 <div class=alignment id=hit3-3> |
| 32 | 973 |
| 974 <div class=linkheader> | |
| 59 | 975 <div class=right><a href="#description3-3">Descriptions</a></div> |
| 105 | 976 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">Gene Bank</a> |
| 32 | 977 </div> |
| 978 | |
| 979 <div class=title> | |
| 980 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | |
| 981 <p class=titleinfo> | |
| 105 | 982 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|1</a> |
| 32 | 983 <span class=b>Length:</span> 1045 |
| 984 <span class=b>Number of Matches:</span> 1 | |
| 985 </p> | |
| 986 </div> | |
| 987 | |
| 988 | |
| 59 | 989 <div class=hotspot id=hotspot3-3-1> |
| 32 | 990 <p class=range> |
| 991 <span class=range>Range 1: 2 to 18</span> | |
| 992 </p> | |
| 993 | |
| 994 <table class=hotspotstable> | |
| 995 <tr> | |
| 996 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 997 </tr> | |
| 998 <tr> | |
| 999 <td>34.2 bits(17)</td> | |
| 1000 <td>0.0</td> | |
| 1001 <td>17/17(100%)</td> | |
| 1002 <td>0/17(0%)</td> | |
| 1003 <td>Plus/Plus</td> | |
| 1004 </tr> | |
| 1005 </table> | |
| 1006 | |
| 1007 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | |
| 1008 ||||||||||||||||| | |
| 1009 Subject 2 GCGCGGTGTCATCTATG 18</pre> | |
| 1010 </div> | |
| 1011 | |
| 1012 </div> | |
| 1013 | |
| 1014 </div></div> | |
| 1015 </section> | |
| 1016 </section> | |
| 1017 | |
| 1018 <section class=match id=match4> | |
| 1019 | |
| 1020 <h1>Nucleotide Sequence (24 letters)</h1> | |
| 1021 | |
| 1022 <section class=header> | |
| 1023 | |
| 1024 <table class=headerdata> | |
| 1025 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1026 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1027 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1028 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1029 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 1030 </table> | |
| 1031 | |
| 1032 </section> | |
| 1033 | |
| 1034 <section> | |
| 1035 <h2>No Hits</h2> | |
| 1036 <div class=grey> | |
| 1037 <table class=headerdata> | |
| 1038 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1039 </table> | |
| 1040 </div> | |
| 1041 </section> | |
| 1042 </section> | |
| 1043 | |
| 1044 <section class=match id=match5> | |
| 1045 | |
| 1046 <h1>Nucleotide Sequence (20 letters)</h1> | |
| 1047 | |
| 1048 <section class=header> | |
| 1049 | |
| 1050 <table class=headerdata> | |
| 1051 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1052 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1053 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1054 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1055 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 1056 </table> | |
| 1057 | |
| 1058 </section> | |
| 1059 | |
| 1060 <section> | |
| 1061 <h2>No Hits</h2> | |
| 1062 <div class=grey> | |
| 1063 <table class=headerdata> | |
| 1064 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1065 </table> | |
| 1066 </div> | |
| 1067 </section> | |
| 1068 </section> | |
| 1069 | |
| 1070 <section class=match id=match6> | |
| 1071 | |
| 1072 <h1>Nucleotide Sequence (25 letters)</h1> | |
| 1073 | |
| 1074 <section class=header> | |
| 1075 | |
| 1076 <table class=headerdata> | |
| 1077 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1078 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1079 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1080 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1081 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 1082 </table> | |
| 1083 | |
| 1084 </section> | |
| 1085 | |
| 1086 | |
| 1087 <section class=graphics> | |
| 1088 <h2>Graphic Summary</h2> | |
| 1089 | |
| 1090 <div class=grey> | |
| 1091 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> | |
| 1092 | |
| 1093 <div class=defline id=defline6> | |
| 1094 Mouse-over to show defline and scores, click to show alignments | |
| 1095 </div> | |
| 1096 | |
| 1097 <div class=graphic> | |
| 1098 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1099 <div class=legend><div class=graphicrow> | |
| 1100 <div class=graphicitem style="background-color: black"><40</div> | |
| 1101 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1102 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1103 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1104 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1105 </div></div> | |
| 1106 <div style="clear: left"></div> | |
| 1107 | |
| 1108 <div class=tablewrapper> | |
| 1109 | |
| 1110 <div class=scale> | |
| 1111 <div>query:</div> | |
| 1112 <div class=graphicrow> | |
| 1113 <div> | |
| 77 | 1114 <div class=graphicitem style="width: 12%"> |
| 32 | 1115 <div>3</div> |
| 1116 </div> | |
| 77 | 1117 <div class=graphicitem style="width: 12%"> |
| 32 | 1118 <div>6</div> |
| 1119 </div> | |
| 77 | 1120 <div class=graphicitem style="width: 12%"> |
| 32 | 1121 <div>9</div> |
| 1122 </div> | |
| 77 | 1123 <div class=graphicitem style="width: 12%"> |
| 32 | 1124 <div>12</div> |
| 1125 </div> | |
| 77 | 1126 <div class=graphicitem style="width: 12%"> |
| 32 | 1127 <div>15</div> |
| 1128 </div> | |
| 77 | 1129 <div class=graphicitem style="width: 12%"> |
| 32 | 1130 <div>18</div> |
| 1131 </div> | |
| 77 | 1132 <div class=graphicitem style="width: 12%"> |
| 32 | 1133 <div>21</div> |
| 1134 </div> | |
| 77 | 1135 <div class=graphicitem style="width: 12%"> |
| 32 | 1136 <div>24</div> |
| 1137 </div> | |
| 77 | 1138 <div class=graphicitem style="width: 4%"> |
| 32 | 1139 <div>25</div> |
| 1140 </div> | |
| 1141 </div> | |
| 1142 </div> | |
| 1143 <div style="clear: left"></div> | |
| 1144 </div> | |
| 1145 | |
| 1146 <a class=matchresult | |
| 59 | 1147 href="#hit6-1" |
| 32 | 1148 onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
| 1149 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1150 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 1151 <div class="matchrow graphicrow"> | |
| 1152 <div class="matchitem graphicitem" | |
| 77 | 1153 style="background-color: black; width: 88%"></div> |
| 32 | 1154 <div class="matchitem graphicitem" |
| 77 | 1155 style="background-color: transparent; width: 12%"></div> |
| 32 | 1156 </div> |
| 1157 </a> | |
| 1158 | |
| 1159 <a class=matchresult | |
| 59 | 1160 href="#hit6-2" |
| 32 | 1161 onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
| 1162 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1163 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 1164 <div class="matchrow graphicrow"> | |
| 1165 <div class="matchitem graphicitem" | |
| 77 | 1166 style="background-color: black; width: 88%"></div> |
| 32 | 1167 <div class="matchitem graphicitem" |
| 77 | 1168 style="background-color: transparent; width: 12%"></div> |
| 32 | 1169 </div> |
| 1170 </a> | |
| 1171 | |
| 1172 </div> | |
| 1173 </div> | |
| 1174 </div> | |
| 1175 </section> | |
| 1176 | |
| 1177 | |
| 1178 | |
| 1179 <section class=descriptions> | |
| 1180 <h2>Descriptions</h2> | |
| 1181 | |
| 1182 <div class=grey><div class=white> | |
| 1183 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1184 | |
| 1185 <table class=descriptiontable> | |
| 1186 <col/><col/><col/><col/><col/><col/><col/> | |
| 1187 <tr> | |
| 1188 <th>Description</th> | |
| 1189 <th>Max score</th> | |
| 1190 <th>Total score</th> | |
| 1191 <th>Query cover</th> | |
| 1192 <th>E value</th> | |
| 1193 <th>Ident</th> | |
| 1194 <th>Accession</th> | |
| 1195 </tr> | |
| 1196 <tr> | |
| 59 | 1197 <td><div><a href="#hit6-1" |
| 32 | 1198 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
| 59 | 1199 id="description6-1"> |
| 32 | 1200 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
| 1201 </a></div></td> | |
| 1202 <td>36.2</td> | |
| 1203 <td>36.2</td> | |
| 1204 <td>88%</td> | |
| 1205 <td>3.148e-06</td> | |
| 1206 <td>95%</td> | |
| 105 | 1207 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">7</a></td> |
| 32 | 1208 </tr> |
| 1209 <tr> | |
| 59 | 1210 <td><div><a href="#hit6-2" |
| 32 | 1211 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 59 | 1212 id="description6-2"> |
| 32 | 1213 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
| 1214 </a></div></td> | |
| 1215 <td>36.2</td> | |
| 1216 <td>36.2</td> | |
| 1217 <td>88%</td> | |
| 1218 <td>3.148e-06</td> | |
| 1219 <td>95%</td> | |
| 105 | 1220 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">6</a></td> |
| 32 | 1221 </tr> |
| 1222 </table> | |
| 1223 | |
| 1224 </div></div> | |
| 1225 </section> | |
| 1226 | |
| 1227 | |
| 1228 | |
| 1229 <section class=alignments> | |
| 1230 <h2>Alignments</h2> | |
| 1231 | |
| 1232 <div class=grey><div class=white> | |
| 59 | 1233 <div class=alignment id=hit6-1> |
| 32 | 1234 |
| 1235 <div class=linkheader> | |
| 59 | 1236 <div class=right><a href="#description6-1">Descriptions</a></div> |
| 105 | 1237 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">Gene Bank</a> |
| 32 | 1238 </div> |
| 1239 | |
| 1240 <div class=title> | |
| 1241 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 1242 <p class=titleinfo> | |
| 105 | 1243 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|7</a> |
| 32 | 1244 <span class=b>Length:</span> 4983 |
| 1245 <span class=b>Number of Matches:</span> 1 | |
| 1246 </p> | |
| 1247 </div> | |
| 1248 | |
| 1249 | |
| 59 | 1250 <div class=hotspot id=hotspot6-1-1> |
| 32 | 1251 <p class=range> |
| 1252 <span class=range>Range 1: 2344 to 2365</span> | |
| 1253 </p> | |
| 1254 | |
| 1255 <table class=hotspotstable> | |
| 1256 <tr> | |
| 1257 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1258 </tr> | |
| 1259 <tr> | |
| 1260 <td>36.2 bits(18)</td> | |
| 1261 <td>0.0</td> | |
| 1262 <td>21/22(95%)</td> | |
| 1263 <td>0/22(0%)</td> | |
| 1264 <td>Plus/Plus</td> | |
| 1265 </tr> | |
| 1266 </table> | |
| 1267 | |
| 1268 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | |
| 1269 |||||||||||||| ||||||| | |
| 1270 Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre> | |
| 1271 </div> | |
| 1272 | |
| 1273 </div> | |
| 1274 | |
| 59 | 1275 <div class=alignment id=hit6-2> |
| 32 | 1276 |
| 1277 <div class=linkheader> | |
| 59 | 1278 <div class=right><a href="#description6-2">Descriptions</a></div> |
| 105 | 1279 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">Gene Bank</a> |
| 32 | 1280 </div> |
| 1281 | |
| 1282 <div class=title> | |
| 1283 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 1284 <p class=titleinfo> | |
| 105 | 1285 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|6</a> |
| 32 | 1286 <span class=b>Length:</span> 4180 |
| 1287 <span class=b>Number of Matches:</span> 1 | |
| 1288 </p> | |
| 1289 </div> | |
| 1290 | |
| 1291 | |
| 59 | 1292 <div class=hotspot id=hotspot6-2-1> |
| 32 | 1293 <p class=range> |
| 1294 <span class=range>Range 1: 1541 to 1562</span> | |
| 1295 </p> | |
| 1296 | |
| 1297 <table class=hotspotstable> | |
| 1298 <tr> | |
| 1299 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1300 </tr> | |
| 1301 <tr> | |
| 1302 <td>36.2 bits(18)</td> | |
| 1303 <td>0.0</td> | |
| 1304 <td>21/22(95%)</td> | |
| 1305 <td>0/22(0%)</td> | |
| 1306 <td>Plus/Plus</td> | |
| 1307 </tr> | |
| 1308 </table> | |
| 1309 | |
| 1310 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | |
| 1311 |||||||||||||| ||||||| | |
| 1312 Subject 1541 ACATGAACAGCGCCCTGACCAC 1562</pre> | |
| 1313 </div> | |
| 1314 | |
| 1315 </div> | |
| 1316 | |
| 1317 </div></div> | |
| 1318 </section> | |
| 1319 </section> | |
| 1320 | |
| 1321 <section class=match id=match7> | |
| 1322 | |
| 1323 <h1>Nucleotide Sequence (74 letters)</h1> | |
| 1324 | |
| 1325 <section class=header> | |
| 1326 | |
| 1327 <table class=headerdata> | |
| 1328 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | |
| 1329 <tr><td class=param>Query definition:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1330 <tr><td class=param>Query length:</td><td>20</td></tr> | |
| 1331 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 1332 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 1333 </table> | |
| 1334 | |
| 1335 </section> | |
| 1336 | |
| 1337 | |
| 1338 <section class=graphics> | |
| 1339 <h2>Graphic Summary</h2> | |
| 1340 | |
| 1341 <div class=grey> | |
| 1342 <h3 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h3> | |
| 1343 | |
| 1344 <div class=defline id=defline7> | |
| 1345 Mouse-over to show defline and scores, click to show alignments | |
| 1346 </div> | |
| 1347 | |
| 1348 <div class=graphic> | |
| 1349 <h4 class=darkHeader>Color key for alignment scores</h4> | |
| 1350 <div class=legend><div class=graphicrow> | |
| 1351 <div class=graphicitem style="background-color: black"><40</div> | |
| 1352 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1353 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1354 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 1355 <div class=graphicitem style="background-color: red">200≤</div> | |
| 1356 </div></div> | |
| 1357 <div style="clear: left"></div> | |
| 1358 | |
| 1359 <div class=tablewrapper> | |
| 1360 | |
| 1361 <div class=scale> | |
| 1362 <div>query:</div> | |
| 1363 <div class=graphicrow> | |
| 1364 <div> | |
| 77 | 1365 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1366 <div>8</div> |
| 1367 </div> | |
| 77 | 1368 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1369 <div>16</div> |
| 1370 </div> | |
| 77 | 1371 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1372 <div>24</div> |
| 1373 </div> | |
| 77 | 1374 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1375 <div>32</div> |
| 1376 </div> | |
| 77 | 1377 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1378 <div>40</div> |
| 1379 </div> | |
| 77 | 1380 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1381 <div>48</div> |
| 1382 </div> | |
| 77 | 1383 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1384 <div>56</div> |
| 1385 </div> | |
| 77 | 1386 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1387 <div>64</div> |
| 1388 </div> | |
| 77 | 1389 <div class=graphicitem style="width: 10.8108108108%"> |
| 32 | 1390 <div>72</div> |
| 1391 </div> | |
| 77 | 1392 <div class=graphicitem style="width: 2.7027027027%"> |
| 32 | 1393 <div> </div> |
| 1394 <div class=lastlabel>74</div> | |
| 1395 </div> | |
| 1396 </div> | |
| 1397 </div> | |
| 1398 <div style="clear: left"></div> | |
| 1399 </div> | |
| 1400 | |
| 1401 <a class=matchresult | |
| 59 | 1402 href="#hit7-1" |
| 32 | 1403 onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' |
| 1404 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1405 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 1406 <div class="matchrow graphicrow"> | |
| 1407 <div class="matchitem graphicitem" | |
| 77 | 1408 style="background-color: green; width: 100%"></div> |
| 32 | 1409 </div> |
| 1410 </a> | |
| 1411 | |
| 1412 <a class=matchresult | |
| 59 | 1413 href="#hit7-2" |
| 32 | 1414 onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' |
| 1415 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1416 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 1417 <div class="matchrow graphicrow"> | |
| 1418 <div class="matchitem graphicitem" | |
| 77 | 1419 style="background-color: green; width: 100%"></div> |
| 32 | 1420 </div> |
| 1421 </a> | |
| 1422 | |
| 1423 </div> | |
| 1424 </div> | |
| 1425 </div> | |
| 1426 </section> | |
| 1427 | |
| 1428 | |
| 1429 | |
| 1430 <section class=descriptions> | |
| 1431 <h2>Descriptions</h2> | |
| 1432 | |
| 1433 <div class=grey><div class=white> | |
| 1434 <h4 class=darkHeader>Sequences producing significant alignments:</h4> | |
| 1435 | |
| 1436 <table class=descriptiontable> | |
| 1437 <col/><col/><col/><col/><col/><col/><col/> | |
| 1438 <tr> | |
| 1439 <th>Description</th> | |
| 1440 <th>Max score</th> | |
| 1441 <th>Total score</th> | |
| 1442 <th>Query cover</th> | |
| 1443 <th>E value</th> | |
| 1444 <th>Ident</th> | |
| 1445 <th>Accession</th> | |
| 1446 </tr> | |
| 1447 <tr> | |
| 59 | 1448 <td><div><a href="#hit7-1" |
| 32 | 1449 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" |
| 59 | 1450 id="description7-1"> |
| 32 | 1451 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 |
| 1452 </a></div></td> | |
| 1453 <td>67.9</td> | |
| 1454 <td>67.9</td> | |
| 1455 <td>100%</td> | |
| 1456 <td>3.564e-15</td> | |
| 1457 <td>86%</td> | |
| 105 | 1458 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">7</a></td> |
| 32 | 1459 </tr> |
| 1460 <tr> | |
| 59 | 1461 <td><div><a href="#hit7-2" |
| 32 | 1462 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
| 59 | 1463 id="description7-2"> |
| 32 | 1464 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 |
| 1465 </a></div></td> | |
| 1466 <td>67.9</td> | |
| 1467 <td>67.9</td> | |
| 1468 <td>100%</td> | |
| 1469 <td>3.564e-15</td> | |
| 1470 <td>86%</td> | |
| 105 | 1471 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">6</a></td> |
| 32 | 1472 </tr> |
| 1473 </table> | |
| 1474 | |
| 1475 </div></div> | |
| 1476 </section> | |
| 1477 | |
| 1478 | |
| 1479 | |
| 1480 <section class=alignments> | |
| 1481 <h2>Alignments</h2> | |
| 1482 | |
| 1483 <div class=grey><div class=white> | |
| 59 | 1484 <div class=alignment id=hit7-1> |
| 32 | 1485 |
| 1486 <div class=linkheader> | |
| 59 | 1487 <div class=right><a href="#description7-1">Descriptions</a></div> |
| 105 | 1488 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">Gene Bank</a> |
| 32 | 1489 </div> |
| 1490 | |
| 1491 <div class=title> | |
| 1492 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 1493 <p class=titleinfo> | |
| 105 | 1494 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|7</a> |
| 32 | 1495 <span class=b>Length:</span> 4983 |
| 1496 <span class=b>Number of Matches:</span> 1 | |
| 1497 </p> | |
| 1498 </div> | |
| 1499 | |
| 1500 | |
| 59 | 1501 <div class=hotspot id=hotspot7-1-1> |
| 32 | 1502 <p class=range> |
| 1503 <span class=range>Range 1: 2319 to 2392</span> | |
| 1504 </p> | |
| 1505 | |
| 1506 <table class=hotspotstable> | |
| 1507 <tr> | |
| 1508 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1509 </tr> | |
| 1510 <tr> | |
| 1511 <td>67.9 bits(34)</td> | |
| 1512 <td>0.0</td> | |
| 1513 <td>64/74(86%)</td> | |
| 1514 <td>0/74(0%)</td> | |
| 1515 <td>Plus/Plus</td> | |
| 1516 </tr> | |
| 1517 </table> | |
| 1518 | |
|
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1519 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1520 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1521 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre> |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1522 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1523 ||||| |||||||| |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1524 Subject 2379 TTCGCCGTCCAGAA 2392</pre> |
| 32 | 1525 </div> |
| 1526 | |
| 1527 </div> | |
| 1528 | |
| 59 | 1529 <div class=alignment id=hit7-2> |
| 32 | 1530 |
| 1531 <div class=linkheader> | |
| 59 | 1532 <div class=right><a href="#description7-2">Descriptions</a></div> |
| 105 | 1533 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">Gene Bank</a> |
| 32 | 1534 </div> |
| 1535 | |
| 1536 <div class=title> | |
| 1537 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 1538 <p class=titleinfo> | |
| 105 | 1539 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|6</a> |
| 32 | 1540 <span class=b>Length:</span> 4180 |
| 1541 <span class=b>Number of Matches:</span> 1 | |
| 1542 </p> | |
| 1543 </div> | |
| 1544 | |
| 1545 | |
| 59 | 1546 <div class=hotspot id=hotspot7-2-1> |
| 32 | 1547 <p class=range> |
|
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1548 <span class=range>Range 1: 1589 to 1516</span> |
| 32 | 1549 </p> |
| 1550 | |
| 1551 <table class=hotspotstable> | |
| 1552 <tr> | |
| 1553 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1554 </tr> | |
| 1555 <tr> | |
| 1556 <td>67.9 bits(34)</td> | |
| 1557 <td>0.0</td> | |
| 1558 <td>64/74(86%)</td> | |
| 1559 <td>0/74(0%)</td> | |
|
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1560 <td>Plus/Minus</td> |
| 32 | 1561 </tr> |
| 1562 </table> | |
| 1563 | |
|
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1564 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1565 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | |
|
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1566 Subject 1589 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1530</pre> |
|
68
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1567 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 |
|
fa8a93bdefd7
fix bug in calculations of alignment end
Jan Kanis <jan.code@jankanis.nl>
parents:
59
diff
changeset
|
1568 ||||| |||||||| |
|
70
0ef071bba164
Modify test data to include a negative frame sequence that is split in multiple lines
Jan Kanis <jan.code@jankanis.nl>
parents:
68
diff
changeset
|
1569 Subject 1529 TTCGCCGTCCAGAA 1516</pre> |
| 32 | 1570 </div> |
| 1571 | |
| 1572 </div> | |
| 1573 | |
| 1574 </div></div> | |
| 1575 </section> | |
| 1576 </section> | |
| 1577 | |
| 1578 </div> | |
| 1579 | |
| 1580 <footer> | |
|
33
3bb5da68305e
add test update script, add url to github page
Jan Kanis <jan.code@jankanis.nl>
parents:
32
diff
changeset
|
1581 This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. |
| 32 | 1582 </footer> |
| 1583 </body> | |
| 1584 </html> | |
| 1585 |
