Mercurial > repos > jankanis > blast2html
annotate test-data/blast xml example3b.html @ 128:82b8c9722996 default tip
Add links to github and bitbucket
| author | Jan Kanis <jan.code@jankanis.nl> | 
|---|---|
| date | Thu, 23 Jul 2015 12:24:40 +0200 | 
| parents | 7f3f8c10f44b | 
| children | 
| rev | line source | 
|---|---|
| 106 | 1 <!DOCTYPE html> | 
| 2 <html> | |
| 3 <head> | |
| 4 <meta charset="UTF-8"> | |
| 5 <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> | |
| 6 | |
| 7 <title>Blast output</title> | |
| 8 | |
| 9 <style> | |
| 10 body { | |
| 11 color: #333333; | |
| 12 font-family: Arial,Sans-Serif; | |
| 13 } | |
| 14 | |
| 15 :link { | |
| 16 color: #336699; | |
| 17 } | |
| 18 | |
| 19 .right { | |
| 20 float: right; | |
| 21 } | |
| 22 | |
| 23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ | |
| 24 #strip_html_warning { | |
| 25 display: none; | |
| 26 } | |
| 27 | |
| 28 #content { | |
| 29 margin: 0 2em; | |
| 30 padding: 0.5em; | |
| 31 border: 1px solid #888888; | |
| 32 background-color: #d3dff5; | |
| 33 } | |
| 34 | |
| 35 h1, h2, h3, h4, h5, h6 { | |
| 36 color: #2A6979; | |
| 37 font-family: arial,verdana,sans-serif; | |
| 38 letter-spacing: -1px; | |
| 39 margin: 1.2em 0 0.3em; | |
| 40 } | |
| 41 | |
| 42 h1 { | |
| 114 | 43 font-size: 200%; | 
| 106 | 44 } | 
| 45 | |
| 46 h2 { | |
| 114 | 47 font-size: 150%; | 
| 48 } | |
| 49 | |
| 50 h1, h2 { | |
| 51 border-bottom: 1px solid #CCCCCC; | |
| 52 padding-bottom: 0.1em; | |
| 53 } | |
| 54 | |
| 55 h3 { | |
| 106 | 56 font-size: 120%; | 
| 57 font-weight: bold; | |
| 58 } | |
| 59 | |
| 114 | 60 h5.darkHeader { | 
| 106 | 61 color: #4D4D4D; | 
| 62 letter-spacing: 0; | |
| 63 font-weight: bold; | |
| 114 | 64 font-size: 108%; | 
| 106 | 65 } | 
| 66 | |
| 67 #nodata { | |
| 68 font-weight: bold; | |
| 69 } | |
| 70 | |
| 71 .index { | |
| 72 margin-bottom: 3em; | |
| 73 } | |
| 74 .index div.indexentry { | |
| 75 margin: 1.2em 1.6em; | |
| 76 font-weight: bold; | |
| 77 font-size: 100%; | |
| 78 } | |
| 79 | |
| 80 .headerdata { | |
| 81 font-size: 90%; | |
| 82 } | |
| 83 .headerdata .param { | |
| 84 font-weight: bold; | |
| 85 text-align: right; | |
| 86 padding: 0 1em; | |
| 87 } | |
| 88 | |
| 89 .grey { | |
| 90 background-color: #eeeeee; | |
| 91 border: 1px solid #cccccc; | |
| 92 padding: 1em; | |
| 93 } | |
| 94 | |
| 95 .white { | |
| 96 background-color: white; | |
| 97 border: 1px solid #cccccc; | |
| 98 padding: 1.5em 2%; | |
| 99 } | |
| 100 | |
| 101 .graphicrow { | |
| 102 clear: left; | |
| 103 width: 100%; | |
| 104 } | |
| 105 | |
| 106 .graphicitem { | |
| 107 float: left; | |
| 108 } | |
| 109 | |
| 110 | |
| 111 | |
| 112 .graphics .grey { | |
| 113 text-align: center; | |
| 114 } | |
| 115 | |
| 116 .graphic { | |
| 117 background-color: white; | |
| 118 border: 2px solid black; | |
| 119 padding: 1.5em; | |
| 120 margin: auto; | |
| 121 } | |
| 122 | |
| 123 .centered, .defline, div.legend, div.tablewrapper { | |
| 124 margin-left: auto; | |
| 125 margin-right: auto; | |
| 126 } | |
| 127 | |
| 128 .defline { | |
| 129 background-color: white; | |
| 130 border: 1px solid black; | |
| 131 margin: .5em auto; | |
| 132 padding-left: .2em; | |
| 133 padding-right: .2em; | |
| 134 max-width: 50em; | |
| 135 text-align: left; | |
| 136 height: 2.8em; | |
| 137 overflow: hidden; | |
| 138 } | |
| 139 | |
| 140 div.legend { | |
| 141 max-width: 40em; | |
| 142 } | |
| 143 div.legend div { | |
| 144 width: 100%; | |
| 145 color: white; | |
| 146 font-weight: bold; | |
| 147 border-spacing: 0; | |
| 148 } | |
| 149 div.legend div .graphicitem { | |
| 150 width: 20%; | |
| 151 padding: 0; | |
| 152 margin: 0; | |
| 153 border: none; | |
| 154 } | |
| 155 | |
| 156 div.tablewrapper { | |
| 157 width: 50%; | |
| 158 min-width: 60em; | |
| 159 } | |
| 160 | |
| 161 /* For small widths we give the graphic 100% */ | |
| 162 @media (max-width: 72.5em) { | |
| 163 div.tablewrapper { | |
| 164 width: 100%; | |
| 165 min-width: 0px; | |
| 166 } | |
| 167 } | |
| 168 | |
| 169 .scale { | |
| 170 width: 100%; | |
| 171 margin: .5em 0; | |
| 172 font-weight: bold; | |
| 173 } | |
| 174 .scale div { | |
| 175 color: red; | |
| 176 text-align: left; | |
| 177 } | |
| 178 .scale .graphicrow { | |
| 179 margin: .5em 0 .5em 0; | |
| 180 color: white; | |
| 181 } | |
| 182 .scale .graphicitem { | |
| 183 position: relative; | |
| 184 } | |
| 185 .scale .graphicitem div { | |
| 186 margin: 0 1px; | |
| 187 padding: 0 2px; | |
| 188 text-align: right; | |
| 189 background-color: red; | |
| 190 color: white; | |
| 191 } | |
| 192 .scale .graphicitem:first-child div { | |
| 193 margin-left: 0px; | |
| 194 } | |
| 195 .scale .graphicitem:last-child div { | |
| 196 margin-right: 0px; | |
| 197 } | |
| 198 .scale .graphicitem .lastlabel { | |
| 199 position: absolute; | |
| 200 top: 0px; | |
| 201 left: 100%; | |
| 202 background-color: transparent; | |
| 203 color: red; | |
| 204 } | |
| 205 | |
| 206 a.matchresult { | |
| 207 display: block; | |
| 208 margin: 0; | |
| 209 padding: 0; | |
| 210 } | |
| 211 div.matchrow { | |
| 212 margin-top: 4px; | |
| 213 } | |
| 214 div.matchrow, div.matchitem { | |
| 215 height: 4px; | |
| 216 } | |
| 217 | |
| 218 | |
| 219 table.descriptiontable { | |
| 220 font-size: 85%; | |
| 221 border: 1px solid #97b0c8; | |
| 222 border-spacing: 0; | |
| 223 color: #222222; | |
| 224 line-height: 1.3em; | |
| 225 background-color: white; | |
| 226 } | |
| 227 table.descriptiontable col:first-child { | |
| 228 width: 100%; | |
| 229 } | |
| 230 table.descriptiontable tr:hover { | |
| 231 background-color: #D5DEE3; | |
| 232 } | |
| 233 table.descriptiontable th { | |
| 234 color: #14376C; | |
| 235 font-weight: normal; | |
| 236 background-color: #F0F0F0; | |
| 237 background: linear-gradient(#FFFFFF, #F0F0F0); | |
| 238 border-bottom: 1px solid #D4DFE9; | |
| 239 border-right: 1px solid #CFCFCF; | |
| 240 border-left: 0px solid black; | |
| 241 border-top: 0px solid black; | |
| 242 } | |
| 243 table.descriptiontable td { | |
| 244 overflow: hidden; | |
| 245 text-align: center; | |
| 246 padding: .4em .8em; | |
| 247 } | |
| 248 table.descriptiontable td div { | |
| 249 width: 1em; | |
| 250 overflow: visible; | |
| 251 white-space: nowrap; | |
| 252 text-align: left; | |
| 253 } | |
| 254 | |
| 255 | |
| 256 | |
| 257 .alignments .white { | |
| 258 padding: 1.5em 1em; | |
| 259 } | |
| 260 | |
| 261 .alignment { | |
| 262 border-top: 1px solid black; | |
| 263 padding-left: 1em; | |
| 264 padding-right: 1em; | |
| 265 } | |
| 266 | |
| 267 div.linkheader { | |
| 268 padding-top: .2em; | |
| 269 font-size: 85%; | |
| 270 color: #14376C; | |
| 271 } | |
| 272 div.linkheader a.linkheader { | |
| 273 margin-right: 1em; | |
| 274 } | |
| 275 div.linkheader .right a { | |
| 276 text-decoration: none; | |
| 277 } | |
| 278 | |
| 279 .title .hittitle { | |
| 280 color: #222222; | |
| 281 margin-bottom: .3em; | |
| 282 } | |
| 283 .title .titleinfo { | |
| 284 font-size: 80%; | |
| 285 margin-top: 0; | |
| 286 margin-bottom: .3em; | |
| 287 } | |
| 288 .title .titleinfo .b { | |
| 289 color: #606060; | |
| 290 font-weight: bold; | |
| 291 font-size: 90%; | |
| 292 } | |
| 293 | |
| 294 .moretitles { | |
| 295 margin: 1.2em; | |
| 296 } | |
| 297 .moretitles .titleinfo { | |
| 298 margin: 0; | |
| 299 padding: 0; | |
| 300 } | |
| 301 .moretitles .hittitle { | |
| 302 margin: .4em 0 .2em 0; | |
| 303 padding: 0; | |
| 304 } | |
| 305 | |
| 306 a.showmoretitles { | |
| 307 font-size: 75%; | |
| 308 color: #336699; | |
| 309 font-weight: bold; | |
| 310 margin-top: 0; | |
| 311 } | |
| 312 a.showmoretitles:hover { | |
| 313 } | |
| 314 | |
| 315 .hotspot { | |
| 316 color: #606060; | |
| 317 font-family: verdana, arial, sans-serif; | |
| 318 margin-bottom: 2.5em; | |
| 319 } | |
| 320 | |
| 321 .hotspot p.range { | |
| 322 font-size: 70%; | |
| 323 margin-top: 0; | |
| 324 margin-top: 1em; | |
| 325 margin-bottom: .2em; | |
| 326 } | |
| 327 .hotspot p.range span.range { | |
| 328 font-weight: bold; | |
| 329 } | |
| 330 .hotspot p.range a.range { | |
| 331 margin-left: .5em; | |
| 332 } | |
| 333 | |
| 334 table.hotspotstable { | |
| 335 border-top: 1px solid; | |
| 336 border-bottom: 1px solid; | |
| 337 text-align: left; | |
| 338 border-collapse: collapse; | |
| 339 } | |
| 340 table.hotspotstable th, table.hotspotstable td { | |
| 341 padding: .1em 1em; | |
| 342 } | |
| 343 table.hotspotstable th { | |
| 344 font-size: 70%; | |
| 345 } | |
| 346 table.hotspotstable td { | |
| 347 min-width: 7em; | |
| 348 color: #222222; | |
| 349 font-size: 80%; | |
| 350 } | |
| 351 | |
| 352 pre.alignmentgraphic { | |
| 353 color: #222222; | |
| 354 } | |
| 355 | |
| 356 footer { | |
| 357 text-align: center; | |
| 358 color: #cccccc; | |
| 359 font-size: 70%; | |
| 360 margin-top: 1em; | |
| 361 } | |
| 362 footer :link { | |
| 363 color: #5588cc; | |
| 364 } | |
| 365 | |
| 366 </style> | |
| 367 | |
| 368 <script type="text/javascript"> | |
| 369 function toggle_visibility(id) { | |
| 370 var e = document.getElementById(id); | |
| 371 if(e.style.display != 'block') | |
| 372 e.style.display = 'block'; | |
| 373 else | |
| 374 e.style.display = 'none'; | |
| 375 } | |
| 376 </script> | |
| 377 | |
| 378 </head> | |
| 379 | |
| 380 | |
| 381 <body> | |
| 382 | |
| 383 <div id="strip_html_warning"> | |
| 384 <!-- This div should be hidden by the header css block. Galaxy | |
| 385 strips all css, breaking this page but making this warning | |
| 386 visible. This warning contains some ugly old skool tabular html | |
| 387 layout that is not stripped. --> | |
| 388 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> | |
| 389 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> | |
| 390 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. | |
| 391 </b></font></td></tr></table> | |
| 392 </div> | |
| 393 | |
| 394 <div id=content> | |
| 395 | |
| 114 | 396 <section class=header> | 
| 397 | |
| 398 <h1>Nucleotide Blast results</h1> | |
| 399 | |
| 400 <table class=headerdata> | |
| 401 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 402 <tr><td class=param>Database:</td><td></td></tr> | |
| 403 </table> | |
| 404 | |
| 405 </section> | |
| 406 | |
| 106 | 407 | 
| 408 <section class=index> | |
| 114 | 409 <h2>Queries</h2> | 
| 106 | 410 | 
| 411 <div class=indexentry><a href="#match1"> | |
| 412 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 413 (20 letters, 0 hits) | |
| 414 </a></div> | |
| 415 <div class=indexentry><a href="#match2"> | |
| 416 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 417 (20 letters, 0 hits) | |
| 418 </a></div> | |
| 419 <div class=indexentry><a href="#match3"> | |
| 420 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 421 (20 letters, 1 hits) | |
| 422 </a></div> | |
| 423 <div class=indexentry><a href="#match4"> | |
| 424 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 425 (20 letters, 0 hits) | |
| 426 </a></div> | |
| 427 <div class=indexentry><a href="#match5"> | |
| 428 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 429 (20 letters, 0 hits) | |
| 430 </a></div> | |
| 431 <div class=indexentry><a href="#match6"> | |
| 432 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 433 (20 letters, 1 hits) | |
| 434 </a></div> | |
| 435 <div class=indexentry><a href="#match7"> | |
| 436 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 437 (20 letters, 0 hits) | |
| 438 </a></div> | |
| 439 <div class=indexentry><a href="#match8"> | |
| 440 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 441 (20 letters, 0 hits) | |
| 442 </a></div> | |
| 443 <div class=indexentry><a href="#match9"> | |
| 444 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 445 (20 letters, 0 hits) | |
| 446 </a></div> | |
| 447 <div class=indexentry><a href="#match10"> | |
| 448 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 449 (20 letters, 0 hits) | |
| 450 </a></div> | |
| 451 <div class=indexentry><a href="#match11"> | |
| 452 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 453 (20 letters, 0 hits) | |
| 454 </a></div> | |
| 455 <div class=indexentry><a href="#match12"> | |
| 456 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 457 (20 letters, 0 hits) | |
| 458 </a></div> | |
| 459 <div class=indexentry><a href="#match13"> | |
| 460 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 461 (20 letters, 0 hits) | |
| 462 </a></div> | |
| 463 <div class=indexentry><a href="#match14"> | |
| 464 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 465 (20 letters, 0 hits) | |
| 466 </a></div> | |
| 467 <div class=indexentry><a href="#match15"> | |
| 468 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 469 (20 letters, 0 hits) | |
| 470 </a></div> | |
| 471 <div class=indexentry><a href="#match16"> | |
| 472 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 473 (20 letters, 0 hits) | |
| 474 </a></div> | |
| 475 <div class=indexentry><a href="#match17"> | |
| 476 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 477 (20 letters, 0 hits) | |
| 478 </a></div> | |
| 479 <div class=indexentry><a href="#match18"> | |
| 480 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 481 (20 letters, 1 hits) | |
| 482 </a></div> | |
| 483 <div class=indexentry><a href="#match19"> | |
| 484 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 485 (20 letters, 1 hits) | |
| 486 </a></div> | |
| 487 <div class=indexentry><a href="#match20"> | |
| 488 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 489 (20 letters, 0 hits) | |
| 490 </a></div> | |
| 491 <div class=indexentry><a href="#match21"> | |
| 492 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 493 (20 letters, 0 hits) | |
| 494 </a></div> | |
| 495 <div class=indexentry><a href="#match22"> | |
| 496 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 497 (20 letters, 1 hits) | |
| 498 </a></div> | |
| 499 <div class=indexentry><a href="#match23"> | |
| 500 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 501 (20 letters, 0 hits) | |
| 502 </a></div> | |
| 503 <div class=indexentry><a href="#match24"> | |
| 504 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 505 (20 letters, 0 hits) | |
| 506 </a></div> | |
| 507 <div class=indexentry><a href="#match25"> | |
| 508 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 509 (24 letters, 0 hits) | |
| 510 </a></div> | |
| 511 <div class=indexentry><a href="#match26"> | |
| 512 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 513 (24 letters, 0 hits) | |
| 514 </a></div> | |
| 515 <div class=indexentry><a href="#match27"> | |
| 516 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 517 (24 letters, 0 hits) | |
| 518 </a></div> | |
| 519 <div class=indexentry><a href="#match28"> | |
| 520 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 521 (24 letters, 0 hits) | |
| 522 </a></div> | |
| 523 <div class=indexentry><a href="#match29"> | |
| 524 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 525 (24 letters, 0 hits) | |
| 526 </a></div> | |
| 527 <div class=indexentry><a href="#match30"> | |
| 528 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 529 (24 letters, 0 hits) | |
| 530 </a></div> | |
| 531 <div class=indexentry><a href="#match31"> | |
| 532 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 533 (24 letters, 0 hits) | |
| 534 </a></div> | |
| 535 <div class=indexentry><a href="#match32"> | |
| 536 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 537 (24 letters, 0 hits) | |
| 538 </a></div> | |
| 539 <div class=indexentry><a href="#match33"> | |
| 540 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 541 (20 letters, 0 hits) | |
| 542 </a></div> | |
| 543 <div class=indexentry><a href="#match34"> | |
| 544 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 545 (20 letters, 0 hits) | |
| 546 </a></div> | |
| 547 <div class=indexentry><a href="#match35"> | |
| 548 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 549 (20 letters, 0 hits) | |
| 550 </a></div> | |
| 551 <div class=indexentry><a href="#match36"> | |
| 552 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 553 (20 letters, 0 hits) | |
| 554 </a></div> | |
| 555 <div class=indexentry><a href="#match37"> | |
| 556 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 557 (20 letters, 0 hits) | |
| 558 </a></div> | |
| 559 <div class=indexentry><a href="#match38"> | |
| 560 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 561 (20 letters, 0 hits) | |
| 562 </a></div> | |
| 563 <div class=indexentry><a href="#match39"> | |
| 564 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 565 (20 letters, 0 hits) | |
| 566 </a></div> | |
| 567 <div class=indexentry><a href="#match40"> | |
| 568 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 569 (20 letters, 0 hits) | |
| 570 </a></div> | |
| 571 <div class=indexentry><a href="#match41"> | |
| 572 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 573 (25 letters, 0 hits) | |
| 574 </a></div> | |
| 575 <div class=indexentry><a href="#match42"> | |
| 576 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 577 (25 letters, 0 hits) | |
| 578 </a></div> | |
| 579 <div class=indexentry><a href="#match43"> | |
| 580 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 581 (25 letters, 0 hits) | |
| 582 </a></div> | |
| 583 <div class=indexentry><a href="#match44"> | |
| 584 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 585 (25 letters, 0 hits) | |
| 586 </a></div> | |
| 587 <div class=indexentry><a href="#match45"> | |
| 588 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 589 (25 letters, 0 hits) | |
| 590 </a></div> | |
| 591 <div class=indexentry><a href="#match46"> | |
| 592 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 593 (25 letters, 0 hits) | |
| 594 </a></div> | |
| 595 <div class=indexentry><a href="#match47"> | |
| 596 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 597 (25 letters, 1 hits) | |
| 598 </a></div> | |
| 599 <div class=indexentry><a href="#match48"> | |
| 600 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 601 (25 letters, 1 hits) | |
| 602 </a></div> | |
| 603 <div class=indexentry><a href="#match49"> | |
| 604 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 605 (74 letters, 0 hits) | |
| 606 </a></div> | |
| 607 <div class=indexentry><a href="#match50"> | |
| 608 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 609 (74 letters, 0 hits) | |
| 610 </a></div> | |
| 611 <div class=indexentry><a href="#match51"> | |
| 612 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 613 (74 letters, 0 hits) | |
| 614 </a></div> | |
| 615 <div class=indexentry><a href="#match52"> | |
| 616 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 617 (74 letters, 0 hits) | |
| 618 </a></div> | |
| 619 <div class=indexentry><a href="#match53"> | |
| 620 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 621 (74 letters, 0 hits) | |
| 622 </a></div> | |
| 623 <div class=indexentry><a href="#match54"> | |
| 624 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 625 (74 letters, 0 hits) | |
| 626 </a></div> | |
| 627 <div class=indexentry><a href="#match55"> | |
| 628 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 629 (74 letters, 1 hits) | |
| 630 </a></div> | |
| 631 <div class=indexentry><a href="#match56"> | |
| 632 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 633 (74 letters, 1 hits) | |
| 634 </a></div> | |
| 635 | |
| 636 </section> | |
| 637 | |
| 638 | |
| 639 <section class=match id=match1> | |
| 640 | |
| 114 | 641 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 642 | 
| 643 <section class=header> | |
| 644 | |
| 645 <table class=headerdata> | |
| 114 | 646 <tr><td class=param>Query number:</td><td>1</td></tr> | 
| 106 | 647 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | 
| 114 | 648 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | 
| 649 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 650 </table> | 
| 651 | |
| 652 </section> | |
| 653 | |
| 654 <section> | |
| 114 | 655 <h3>No Hits</h3> | 
| 106 | 656 <div class=grey> | 
| 657 <table class=headerdata> | |
| 658 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 659 </table> | |
| 660 </div> | |
| 661 </section> | |
| 662 </section> | |
| 663 | |
| 664 <section class=match id=match2> | |
| 665 | |
| 114 | 666 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 667 | 
| 668 <section class=header> | |
| 669 | |
| 670 <table class=headerdata> | |
| 114 | 671 <tr><td class=param>Query number:</td><td>2</td></tr> | 
| 106 | 672 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | 
| 114 | 673 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | 
| 674 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 675 </table> | 
| 676 | |
| 677 </section> | |
| 678 | |
| 679 <section> | |
| 114 | 680 <h3>No Hits</h3> | 
| 106 | 681 <div class=grey> | 
| 682 <table class=headerdata> | |
| 683 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 684 </table> | |
| 685 </div> | |
| 686 </section> | |
| 687 </section> | |
| 688 | |
| 689 <section class=match id=match3> | |
| 690 | |
| 114 | 691 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 692 | 
| 693 <section class=header> | |
| 694 | |
| 695 <table class=headerdata> | |
| 114 | 696 <tr><td class=param>Query number:</td><td>3</td></tr> | 
| 106 | 697 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | 
| 114 | 698 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | 
| 699 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 700 </table> | 
| 701 | |
| 702 </section> | |
| 703 | |
| 704 | |
| 705 <section class=graphics> | |
| 114 | 706 <h3>Graphic Summary</h3> | 
| 106 | 707 | 
| 708 <div class=grey> | |
| 114 | 709 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> | 
| 106 | 710 | 
| 711 <div class=defline id=defline3> | |
| 712 Mouse-over to show defline and scores, click to show alignments | |
| 713 </div> | |
| 714 | |
| 715 <div class=graphic> | |
| 114 | 716 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 717 <div class=legend><div class=graphicrow> | 
| 718 <div class=graphicitem style="background-color: black"><40</div> | |
| 719 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 720 <div class=graphicitem style="background-color: green">50–80</div> | |
| 721 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
722 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 723 </div></div> | 
| 724 <div style="clear: left"></div> | |
| 725 | |
| 726 <div class=tablewrapper> | |
| 727 | |
| 728 <div class=scale> | |
| 729 <div>query:</div> | |
| 730 <div class=graphicrow> | |
| 731 <div> | |
| 732 <div class=graphicitem style="width: 10%"> | |
| 733 <div>2</div> | |
| 734 </div> | |
| 735 <div class=graphicitem style="width: 10%"> | |
| 736 <div>4</div> | |
| 737 </div> | |
| 738 <div class=graphicitem style="width: 10%"> | |
| 739 <div>6</div> | |
| 740 </div> | |
| 741 <div class=graphicitem style="width: 10%"> | |
| 742 <div>8</div> | |
| 743 </div> | |
| 744 <div class=graphicitem style="width: 10%"> | |
| 745 <div>10</div> | |
| 746 </div> | |
| 747 <div class=graphicitem style="width: 10%"> | |
| 748 <div>12</div> | |
| 749 </div> | |
| 750 <div class=graphicitem style="width: 10%"> | |
| 751 <div>14</div> | |
| 752 </div> | |
| 753 <div class=graphicitem style="width: 10%"> | |
| 754 <div>16</div> | |
| 755 </div> | |
| 756 <div class=graphicitem style="width: 10%"> | |
| 757 <div>18</div> | |
| 758 </div> | |
| 759 <div class=graphicitem style="width: 10%"> | |
| 760 <div>20</div> | |
| 761 </div> | |
| 762 </div> | |
| 763 </div> | |
| 764 <div style="clear: left"></div> | |
| 765 </div> | |
| 766 | |
| 767 <a class=matchresult | |
| 768 href="#hit3-1" | |
| 769 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | |
| 770 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 771 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 772 <div class="matchrow graphicrow"> | |
| 773 <div class="matchitem graphicitem" | |
| 774 style="background-color: black; width: 100%"></div> | |
| 775 </div> | |
| 776 </a> | |
| 777 | |
| 778 </div> | |
| 779 </div> | |
| 780 </div> | |
| 781 </section> | |
| 782 | |
| 783 | |
| 784 | |
| 785 <section class=descriptions> | |
| 114 | 786 <h3>Descriptions</h3> | 
| 106 | 787 | 
| 788 <div class=grey><div class=white> | |
| 114 | 789 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 790 | 
| 791 <table class=descriptiontable> | |
| 792 <col/><col/><col/><col/><col/><col/><col/> | |
| 793 <tr> | |
| 794 <th>Description</th> | |
| 795 <th>Max score</th> | |
| 796 <th>Total score</th> | |
| 797 <th>Query cover</th> | |
| 798 <th>E value</th> | |
| 799 <th>Ident</th> | |
| 800 <th>Accession</th> | |
| 801 </tr> | |
| 802 <tr> | |
| 803 <td><div><a href="#hit3-1" | |
| 804 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | |
| 805 id="description3-1"> | |
| 806 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | |
| 807 </a></div></td> | |
| 808 <td>37.4</td> | |
| 809 <td>37.4</td> | |
| 810 <td>100%</td> | |
| 811 <td>7.011e-08</td> | |
| 812 <td>100%</td> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
813 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td> | 
| 106 | 814 </tr> | 
| 815 </table> | |
| 816 | |
| 817 </div></div> | |
| 818 </section> | |
| 819 | |
| 820 | |
| 821 | |
| 822 <section class=alignments> | |
| 114 | 823 <h3>Alignments</h3> | 
| 106 | 824 | 
| 825 <div class=grey><div class=white> | |
| 826 <div class=alignment id=hit3-1> | |
| 827 | |
| 828 <div class=linkheader> | |
| 829 <div class=right><a href="#description3-1">Descriptions</a></div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
830 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a> | 
| 106 | 831 </div> | 
| 832 | |
| 833 <div class=title> | |
| 834 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 835 <p class=titleinfo> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
836 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a> | 
| 106 | 837 <span class=b>Length:</span> 323 | 
| 838 <span class=b>Number of Matches:</span> 1 | |
| 839 </p> | |
| 840 </div> | |
| 841 | |
| 842 | |
| 843 <div class=hotspot id=hotspot3-1-1> | |
| 844 <p class=range> | |
| 845 <span class=range>Range 1: 200 to 219</span> | |
| 846 </p> | |
| 847 | |
| 848 <table class=hotspotstable> | |
| 849 <tr> | |
| 850 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 851 </tr> | |
| 852 <tr> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
853 <td>37.3537 bits (40)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
854 <td>7.01052e-08</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
855 <td>20/20 (100%)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
856 <td>0/20 (0%)</td> | 
| 106 | 857 <td>Plus/Plus</td> | 
| 858 </tr> | |
| 859 </table> | |
| 860 | |
| 861 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 862 |||||||||||||||||||| | |
| 863 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> | |
| 864 </div> | |
| 865 | |
| 866 </div> | |
| 867 | |
| 868 </div></div> | |
| 869 </section> | |
| 870 </section> | |
| 871 | |
| 872 <section class=match id=match4> | |
| 873 | |
| 114 | 874 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 875 | 
| 876 <section class=header> | |
| 877 | |
| 878 <table class=headerdata> | |
| 114 | 879 <tr><td class=param>Query number:</td><td>4</td></tr> | 
| 106 | 880 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | 
| 114 | 881 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | 
| 882 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 883 </table> | 
| 884 | |
| 885 </section> | |
| 886 | |
| 887 <section> | |
| 114 | 888 <h3>No Hits</h3> | 
| 106 | 889 <div class=grey> | 
| 890 <table class=headerdata> | |
| 891 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 892 </table> | |
| 893 </div> | |
| 894 </section> | |
| 895 </section> | |
| 896 | |
| 897 <section class=match id=match5> | |
| 898 | |
| 114 | 899 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 900 | 
| 901 <section class=header> | |
| 902 | |
| 903 <table class=headerdata> | |
| 114 | 904 <tr><td class=param>Query number:</td><td>5</td></tr> | 
| 106 | 905 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | 
| 114 | 906 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | 
| 907 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 908 </table> | 
| 909 | |
| 910 </section> | |
| 911 | |
| 912 <section> | |
| 114 | 913 <h3>No Hits</h3> | 
| 106 | 914 <div class=grey> | 
| 915 <table class=headerdata> | |
| 916 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 917 </table> | |
| 918 </div> | |
| 919 </section> | |
| 920 </section> | |
| 921 | |
| 922 <section class=match id=match6> | |
| 923 | |
| 114 | 924 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 925 | 
| 926 <section class=header> | |
| 927 | |
| 928 <table class=headerdata> | |
| 114 | 929 <tr><td class=param>Query number:</td><td>6</td></tr> | 
| 106 | 930 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | 
| 114 | 931 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | 
| 932 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 933 </table> | 
| 934 | |
| 935 </section> | |
| 936 | |
| 937 | |
| 938 <section class=graphics> | |
| 114 | 939 <h3>Graphic Summary</h3> | 
| 106 | 940 | 
| 941 <div class=grey> | |
| 114 | 942 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> | 
| 106 | 943 | 
| 944 <div class=defline id=defline6> | |
| 945 Mouse-over to show defline and scores, click to show alignments | |
| 946 </div> | |
| 947 | |
| 948 <div class=graphic> | |
| 114 | 949 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 950 <div class=legend><div class=graphicrow> | 
| 951 <div class=graphicitem style="background-color: black"><40</div> | |
| 952 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 953 <div class=graphicitem style="background-color: green">50–80</div> | |
| 954 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
955 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 956 </div></div> | 
| 957 <div style="clear: left"></div> | |
| 958 | |
| 959 <div class=tablewrapper> | |
| 960 | |
| 961 <div class=scale> | |
| 962 <div>query:</div> | |
| 963 <div class=graphicrow> | |
| 964 <div> | |
| 965 <div class=graphicitem style="width: 10%"> | |
| 966 <div>2</div> | |
| 967 </div> | |
| 968 <div class=graphicitem style="width: 10%"> | |
| 969 <div>4</div> | |
| 970 </div> | |
| 971 <div class=graphicitem style="width: 10%"> | |
| 972 <div>6</div> | |
| 973 </div> | |
| 974 <div class=graphicitem style="width: 10%"> | |
| 975 <div>8</div> | |
| 976 </div> | |
| 977 <div class=graphicitem style="width: 10%"> | |
| 978 <div>10</div> | |
| 979 </div> | |
| 980 <div class=graphicitem style="width: 10%"> | |
| 981 <div>12</div> | |
| 982 </div> | |
| 983 <div class=graphicitem style="width: 10%"> | |
| 984 <div>14</div> | |
| 985 </div> | |
| 986 <div class=graphicitem style="width: 10%"> | |
| 987 <div>16</div> | |
| 988 </div> | |
| 989 <div class=graphicitem style="width: 10%"> | |
| 990 <div>18</div> | |
| 991 </div> | |
| 992 <div class=graphicitem style="width: 10%"> | |
| 993 <div>20</div> | |
| 994 </div> | |
| 995 </div> | |
| 996 </div> | |
| 997 <div style="clear: left"></div> | |
| 998 </div> | |
| 999 | |
| 1000 <a class=matchresult | |
| 1001 href="#hit6-1" | |
| 1002 onmouseover='document.getElementById("defline6").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | |
| 1003 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1004 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 1005 <div class="matchrow graphicrow"> | |
| 1006 <div class="matchitem graphicitem" | |
| 1007 style="background-color: black; width: 100%"></div> | |
| 1008 </div> | |
| 1009 </a> | |
| 1010 | |
| 1011 </div> | |
| 1012 </div> | |
| 1013 </div> | |
| 1014 </section> | |
| 1015 | |
| 1016 | |
| 1017 | |
| 1018 <section class=descriptions> | |
| 114 | 1019 <h3>Descriptions</h3> | 
| 106 | 1020 | 
| 1021 <div class=grey><div class=white> | |
| 114 | 1022 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 1023 | 
| 1024 <table class=descriptiontable> | |
| 1025 <col/><col/><col/><col/><col/><col/><col/> | |
| 1026 <tr> | |
| 1027 <th>Description</th> | |
| 1028 <th>Max score</th> | |
| 1029 <th>Total score</th> | |
| 1030 <th>Query cover</th> | |
| 1031 <th>E value</th> | |
| 1032 <th>Ident</th> | |
| 1033 <th>Accession</th> | |
| 1034 </tr> | |
| 1035 <tr> | |
| 1036 <td><div><a href="#hit6-1" | |
| 1037 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | |
| 1038 id="description6-1"> | |
| 1039 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | |
| 1040 </a></div></td> | |
| 1041 <td>37.4</td> | |
| 1042 <td>37.4</td> | |
| 1043 <td>100%</td> | |
| 1044 <td>7.011e-08</td> | |
| 1045 <td>100%</td> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1046 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td> | 
| 106 | 1047 </tr> | 
| 1048 </table> | |
| 1049 | |
| 1050 </div></div> | |
| 1051 </section> | |
| 1052 | |
| 1053 | |
| 1054 | |
| 1055 <section class=alignments> | |
| 114 | 1056 <h3>Alignments</h3> | 
| 106 | 1057 | 
| 1058 <div class=grey><div class=white> | |
| 1059 <div class=alignment id=hit6-1> | |
| 1060 | |
| 1061 <div class=linkheader> | |
| 1062 <div class=right><a href="#description6-1">Descriptions</a></div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1063 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a> | 
| 106 | 1064 </div> | 
| 1065 | |
| 1066 <div class=title> | |
| 1067 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 1068 <p class=titleinfo> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1069 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a> | 
| 106 | 1070 <span class=b>Length:</span> 2457 | 
| 1071 <span class=b>Number of Matches:</span> 1 | |
| 1072 </p> | |
| 1073 </div> | |
| 1074 | |
| 1075 | |
| 1076 <div class=hotspot id=hotspot6-1-1> | |
| 1077 <p class=range> | |
| 1078 <span class=range>Range 1: 2119 to 2138</span> | |
| 1079 </p> | |
| 1080 | |
| 1081 <table class=hotspotstable> | |
| 1082 <tr> | |
| 1083 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1084 </tr> | |
| 1085 <tr> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1086 <td>37.3537 bits (40)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1087 <td>7.01052e-08</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1088 <td>20/20 (100%)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1089 <td>0/20 (0%)</td> | 
| 106 | 1090 <td>Plus/Plus</td> | 
| 1091 </tr> | |
| 1092 </table> | |
| 1093 | |
| 1094 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 1095 |||||||||||||||||||| | |
| 1096 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | |
| 1097 </div> | |
| 1098 | |
| 1099 </div> | |
| 1100 | |
| 1101 </div></div> | |
| 1102 </section> | |
| 1103 </section> | |
| 1104 | |
| 1105 <section class=match id=match7> | |
| 1106 | |
| 114 | 1107 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1108 | 
| 1109 <section class=header> | |
| 1110 | |
| 1111 <table class=headerdata> | |
| 114 | 1112 <tr><td class=param>Query number:</td><td>7</td></tr> | 
| 106 | 1113 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | 
| 114 | 1114 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | 
| 1115 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1116 </table> | 
| 1117 | |
| 1118 </section> | |
| 1119 | |
| 1120 <section> | |
| 114 | 1121 <h3>No Hits</h3> | 
| 106 | 1122 <div class=grey> | 
| 1123 <table class=headerdata> | |
| 1124 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1125 </table> | |
| 1126 </div> | |
| 1127 </section> | |
| 1128 </section> | |
| 1129 | |
| 1130 <section class=match id=match8> | |
| 1131 | |
| 114 | 1132 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1133 | 
| 1134 <section class=header> | |
| 1135 | |
| 1136 <table class=headerdata> | |
| 114 | 1137 <tr><td class=param>Query number:</td><td>8</td></tr> | 
| 106 | 1138 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | 
| 114 | 1139 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | 
| 1140 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1141 </table> | 
| 1142 | |
| 1143 </section> | |
| 1144 | |
| 1145 <section> | |
| 114 | 1146 <h3>No Hits</h3> | 
| 106 | 1147 <div class=grey> | 
| 1148 <table class=headerdata> | |
| 1149 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1150 </table> | |
| 1151 </div> | |
| 1152 </section> | |
| 1153 </section> | |
| 1154 | |
| 1155 <section class=match id=match9> | |
| 1156 | |
| 114 | 1157 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1158 | 
| 1159 <section class=header> | |
| 1160 | |
| 1161 <table class=headerdata> | |
| 114 | 1162 <tr><td class=param>Query number:</td><td>9</td></tr> | 
| 1163 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1164 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1165 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1166 </table> | 
| 1167 | |
| 1168 </section> | |
| 1169 | |
| 1170 <section> | |
| 114 | 1171 <h3>No Hits</h3> | 
| 106 | 1172 <div class=grey> | 
| 1173 <table class=headerdata> | |
| 1174 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1175 </table> | |
| 1176 </div> | |
| 1177 </section> | |
| 1178 </section> | |
| 1179 | |
| 1180 <section class=match id=match10> | |
| 1181 | |
| 114 | 1182 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1183 | 
| 1184 <section class=header> | |
| 1185 | |
| 1186 <table class=headerdata> | |
| 114 | 1187 <tr><td class=param>Query number:</td><td>10</td></tr> | 
| 1188 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1189 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1190 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1191 </table> | 
| 1192 | |
| 1193 </section> | |
| 1194 | |
| 1195 <section> | |
| 114 | 1196 <h3>No Hits</h3> | 
| 106 | 1197 <div class=grey> | 
| 1198 <table class=headerdata> | |
| 1199 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1200 </table> | |
| 1201 </div> | |
| 1202 </section> | |
| 1203 </section> | |
| 1204 | |
| 1205 <section class=match id=match11> | |
| 1206 | |
| 114 | 1207 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1208 | 
| 1209 <section class=header> | |
| 1210 | |
| 1211 <table class=headerdata> | |
| 114 | 1212 <tr><td class=param>Query number:</td><td>11</td></tr> | 
| 1213 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1214 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1215 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1216 </table> | 
| 1217 | |
| 1218 </section> | |
| 1219 | |
| 1220 <section> | |
| 114 | 1221 <h3>No Hits</h3> | 
| 106 | 1222 <div class=grey> | 
| 1223 <table class=headerdata> | |
| 1224 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1225 </table> | |
| 1226 </div> | |
| 1227 </section> | |
| 1228 </section> | |
| 1229 | |
| 1230 <section class=match id=match12> | |
| 1231 | |
| 114 | 1232 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1233 | 
| 1234 <section class=header> | |
| 1235 | |
| 1236 <table class=headerdata> | |
| 114 | 1237 <tr><td class=param>Query number:</td><td>12</td></tr> | 
| 1238 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1239 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1240 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1241 </table> | 
| 1242 | |
| 1243 </section> | |
| 1244 | |
| 1245 <section> | |
| 114 | 1246 <h3>No Hits</h3> | 
| 106 | 1247 <div class=grey> | 
| 1248 <table class=headerdata> | |
| 1249 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1250 </table> | |
| 1251 </div> | |
| 1252 </section> | |
| 1253 </section> | |
| 1254 | |
| 1255 <section class=match id=match13> | |
| 1256 | |
| 114 | 1257 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1258 | 
| 1259 <section class=header> | |
| 1260 | |
| 1261 <table class=headerdata> | |
| 114 | 1262 <tr><td class=param>Query number:</td><td>13</td></tr> | 
| 1263 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1264 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1265 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1266 </table> | 
| 1267 | |
| 1268 </section> | |
| 1269 | |
| 1270 <section> | |
| 114 | 1271 <h3>No Hits</h3> | 
| 106 | 1272 <div class=grey> | 
| 1273 <table class=headerdata> | |
| 1274 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1275 </table> | |
| 1276 </div> | |
| 1277 </section> | |
| 1278 </section> | |
| 1279 | |
| 1280 <section class=match id=match14> | |
| 1281 | |
| 114 | 1282 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1283 | 
| 1284 <section class=header> | |
| 1285 | |
| 1286 <table class=headerdata> | |
| 114 | 1287 <tr><td class=param>Query number:</td><td>14</td></tr> | 
| 1288 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1289 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1290 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1291 </table> | 
| 1292 | |
| 1293 </section> | |
| 1294 | |
| 1295 <section> | |
| 114 | 1296 <h3>No Hits</h3> | 
| 106 | 1297 <div class=grey> | 
| 1298 <table class=headerdata> | |
| 1299 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1300 </table> | |
| 1301 </div> | |
| 1302 </section> | |
| 1303 </section> | |
| 1304 | |
| 1305 <section class=match id=match15> | |
| 1306 | |
| 114 | 1307 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1308 | 
| 1309 <section class=header> | |
| 1310 | |
| 1311 <table class=headerdata> | |
| 114 | 1312 <tr><td class=param>Query number:</td><td>15</td></tr> | 
| 1313 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1314 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1315 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1316 </table> | 
| 1317 | |
| 1318 </section> | |
| 1319 | |
| 1320 <section> | |
| 114 | 1321 <h3>No Hits</h3> | 
| 106 | 1322 <div class=grey> | 
| 1323 <table class=headerdata> | |
| 1324 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1325 </table> | |
| 1326 </div> | |
| 1327 </section> | |
| 1328 </section> | |
| 1329 | |
| 1330 <section class=match id=match16> | |
| 1331 | |
| 114 | 1332 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1333 | 
| 1334 <section class=header> | |
| 1335 | |
| 1336 <table class=headerdata> | |
| 114 | 1337 <tr><td class=param>Query number:</td><td>16</td></tr> | 
| 1338 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 1339 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1340 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1341 </table> | 
| 1342 | |
| 1343 </section> | |
| 1344 | |
| 1345 <section> | |
| 114 | 1346 <h3>No Hits</h3> | 
| 106 | 1347 <div class=grey> | 
| 1348 <table class=headerdata> | |
| 1349 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1350 </table> | |
| 1351 </div> | |
| 1352 </section> | |
| 1353 </section> | |
| 1354 | |
| 1355 <section class=match id=match17> | |
| 1356 | |
| 114 | 1357 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1358 | 
| 1359 <section class=header> | |
| 1360 | |
| 1361 <table class=headerdata> | |
| 114 | 1362 <tr><td class=param>Query number:</td><td>17</td></tr> | 
| 1363 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1364 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1365 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1366 </table> | 
| 1367 | |
| 1368 </section> | |
| 1369 | |
| 1370 <section> | |
| 114 | 1371 <h3>No Hits</h3> | 
| 106 | 1372 <div class=grey> | 
| 1373 <table class=headerdata> | |
| 1374 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1375 </table> | |
| 1376 </div> | |
| 1377 </section> | |
| 1378 </section> | |
| 1379 | |
| 1380 <section class=match id=match18> | |
| 1381 | |
| 114 | 1382 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1383 | 
| 1384 <section class=header> | |
| 1385 | |
| 1386 <table class=headerdata> | |
| 114 | 1387 <tr><td class=param>Query number:</td><td>18</td></tr> | 
| 1388 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1389 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1390 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1391 </table> | 
| 1392 | |
| 1393 </section> | |
| 1394 | |
| 1395 | |
| 1396 <section class=graphics> | |
| 114 | 1397 <h3>Graphic Summary</h3> | 
| 106 | 1398 | 
| 1399 <div class=grey> | |
| 114 | 1400 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> | 
| 106 | 1401 | 
| 1402 <div class=defline id=defline18> | |
| 1403 Mouse-over to show defline and scores, click to show alignments | |
| 1404 </div> | |
| 1405 | |
| 1406 <div class=graphic> | |
| 114 | 1407 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 1408 <div class=legend><div class=graphicrow> | 
| 1409 <div class=graphicitem style="background-color: black"><40</div> | |
| 1410 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1411 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1412 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1413 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 1414 </div></div> | 
| 1415 <div style="clear: left"></div> | |
| 1416 | |
| 1417 <div class=tablewrapper> | |
| 1418 | |
| 1419 <div class=scale> | |
| 1420 <div>query:</div> | |
| 1421 <div class=graphicrow> | |
| 1422 <div> | |
| 1423 <div class=graphicitem style="width: 10%"> | |
| 1424 <div>2</div> | |
| 1425 </div> | |
| 1426 <div class=graphicitem style="width: 10%"> | |
| 1427 <div>4</div> | |
| 1428 </div> | |
| 1429 <div class=graphicitem style="width: 10%"> | |
| 1430 <div>6</div> | |
| 1431 </div> | |
| 1432 <div class=graphicitem style="width: 10%"> | |
| 1433 <div>8</div> | |
| 1434 </div> | |
| 1435 <div class=graphicitem style="width: 10%"> | |
| 1436 <div>10</div> | |
| 1437 </div> | |
| 1438 <div class=graphicitem style="width: 10%"> | |
| 1439 <div>12</div> | |
| 1440 </div> | |
| 1441 <div class=graphicitem style="width: 10%"> | |
| 1442 <div>14</div> | |
| 1443 </div> | |
| 1444 <div class=graphicitem style="width: 10%"> | |
| 1445 <div>16</div> | |
| 1446 </div> | |
| 1447 <div class=graphicitem style="width: 10%"> | |
| 1448 <div>18</div> | |
| 1449 </div> | |
| 1450 <div class=graphicitem style="width: 10%"> | |
| 1451 <div>20</div> | |
| 1452 </div> | |
| 1453 </div> | |
| 1454 </div> | |
| 1455 <div style="clear: left"></div> | |
| 1456 </div> | |
| 1457 | |
| 1458 <a class=matchresult | |
| 1459 href="#hit18-1" | |
| 1460 onmouseover='document.getElementById("defline18").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' | |
| 1461 onmouseout='document.getElementById("defline18").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1462 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | |
| 1463 <div class="matchrow graphicrow"> | |
| 1464 <div class="matchitem graphicitem" | |
| 1465 style="background-color: transparent; width: 15%"></div> | |
| 1466 <div class="matchitem graphicitem" | |
| 1467 style="background-color: black; width: 85%"></div> | |
| 1468 </div> | |
| 1469 </a> | |
| 1470 | |
| 1471 </div> | |
| 1472 </div> | |
| 1473 </div> | |
| 1474 </section> | |
| 1475 | |
| 1476 | |
| 1477 | |
| 1478 <section class=descriptions> | |
| 114 | 1479 <h3>Descriptions</h3> | 
| 106 | 1480 | 
| 1481 <div class=grey><div class=white> | |
| 114 | 1482 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 1483 | 
| 1484 <table class=descriptiontable> | |
| 1485 <col/><col/><col/><col/><col/><col/><col/> | |
| 1486 <tr> | |
| 1487 <th>Description</th> | |
| 1488 <th>Max score</th> | |
| 1489 <th>Total score</th> | |
| 1490 <th>Query cover</th> | |
| 1491 <th>E value</th> | |
| 1492 <th>Ident</th> | |
| 1493 <th>Accession</th> | |
| 1494 </tr> | |
| 1495 <tr> | |
| 1496 <td><div><a href="#hit18-1" | |
| 1497 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" | |
| 1498 id="description18-1"> | |
| 1499 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 | |
| 1500 </a></div></td> | |
| 1501 <td>31.9</td> | |
| 1502 <td>31.9</td> | |
| 1503 <td>85%</td> | |
| 1504 <td>2.981e-06</td> | |
| 1505 <td>100%</td> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1506 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_2">Subject_2</a></td> | 
| 106 | 1507 </tr> | 
| 1508 </table> | |
| 1509 | |
| 1510 </div></div> | |
| 1511 </section> | |
| 1512 | |
| 1513 | |
| 1514 | |
| 1515 <section class=alignments> | |
| 114 | 1516 <h3>Alignments</h3> | 
| 106 | 1517 | 
| 1518 <div class=grey><div class=white> | |
| 1519 <div class=alignment id=hit18-1> | |
| 1520 | |
| 1521 <div class=linkheader> | |
| 1522 <div class=right><a href="#description18-1">Descriptions</a></div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1523 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_2">Gene Bank</a> | 
| 106 | 1524 </div> | 
| 1525 | |
| 1526 <div class=title> | |
| 1527 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | |
| 1528 <p class=titleinfo> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1529 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_2">Subject_2</a> | 
| 106 | 1530 <span class=b>Length:</span> 1045 | 
| 1531 <span class=b>Number of Matches:</span> 1 | |
| 1532 </p> | |
| 1533 </div> | |
| 1534 | |
| 1535 | |
| 1536 <div class=hotspot id=hotspot18-1-1> | |
| 1537 <p class=range> | |
| 1538 <span class=range>Range 1: 2 to 18</span> | |
| 1539 </p> | |
| 1540 | |
| 1541 <table class=hotspotstable> | |
| 1542 <tr> | |
| 1543 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1544 </tr> | |
| 1545 <tr> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1546 <td>31.9436 bits (34)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1547 <td>2.98095e-06</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1548 <td>17/17 (100%)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1549 <td>0/17 (0%)</td> | 
| 106 | 1550 <td>Plus/Plus</td> | 
| 1551 </tr> | |
| 1552 </table> | |
| 1553 | |
| 1554 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | |
| 1555 ||||||||||||||||| | |
| 1556 Subject 2 GCGCGGTGTCATCTATG 18</pre> | |
| 1557 </div> | |
| 1558 | |
| 1559 </div> | |
| 1560 | |
| 1561 </div></div> | |
| 1562 </section> | |
| 1563 </section> | |
| 1564 | |
| 1565 <section class=match id=match19> | |
| 1566 | |
| 114 | 1567 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1568 | 
| 1569 <section class=header> | |
| 1570 | |
| 1571 <table class=headerdata> | |
| 114 | 1572 <tr><td class=param>Query number:</td><td>19</td></tr> | 
| 1573 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1574 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1575 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1576 </table> | 
| 1577 | |
| 1578 </section> | |
| 1579 | |
| 1580 | |
| 1581 <section class=graphics> | |
| 114 | 1582 <h3>Graphic Summary</h3> | 
| 106 | 1583 | 
| 1584 <div class=grey> | |
| 114 | 1585 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> | 
| 106 | 1586 | 
| 1587 <div class=defline id=defline19> | |
| 1588 Mouse-over to show defline and scores, click to show alignments | |
| 1589 </div> | |
| 1590 | |
| 1591 <div class=graphic> | |
| 114 | 1592 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 1593 <div class=legend><div class=graphicrow> | 
| 1594 <div class=graphicitem style="background-color: black"><40</div> | |
| 1595 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1596 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1597 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1598 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 1599 </div></div> | 
| 1600 <div style="clear: left"></div> | |
| 1601 | |
| 1602 <div class=tablewrapper> | |
| 1603 | |
| 1604 <div class=scale> | |
| 1605 <div>query:</div> | |
| 1606 <div class=graphicrow> | |
| 1607 <div> | |
| 1608 <div class=graphicitem style="width: 10%"> | |
| 1609 <div>2</div> | |
| 1610 </div> | |
| 1611 <div class=graphicitem style="width: 10%"> | |
| 1612 <div>4</div> | |
| 1613 </div> | |
| 1614 <div class=graphicitem style="width: 10%"> | |
| 1615 <div>6</div> | |
| 1616 </div> | |
| 1617 <div class=graphicitem style="width: 10%"> | |
| 1618 <div>8</div> | |
| 1619 </div> | |
| 1620 <div class=graphicitem style="width: 10%"> | |
| 1621 <div>10</div> | |
| 1622 </div> | |
| 1623 <div class=graphicitem style="width: 10%"> | |
| 1624 <div>12</div> | |
| 1625 </div> | |
| 1626 <div class=graphicitem style="width: 10%"> | |
| 1627 <div>14</div> | |
| 1628 </div> | |
| 1629 <div class=graphicitem style="width: 10%"> | |
| 1630 <div>16</div> | |
| 1631 </div> | |
| 1632 <div class=graphicitem style="width: 10%"> | |
| 1633 <div>18</div> | |
| 1634 </div> | |
| 1635 <div class=graphicitem style="width: 10%"> | |
| 1636 <div>20</div> | |
| 1637 </div> | |
| 1638 </div> | |
| 1639 </div> | |
| 1640 <div style="clear: left"></div> | |
| 1641 </div> | |
| 1642 | |
| 1643 <a class=matchresult | |
| 1644 href="#hit19-1" | |
| 1645 onmouseover='document.getElementById("defline19").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | |
| 1646 onmouseout='document.getElementById("defline19").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1647 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 1648 <div class="matchrow graphicrow"> | |
| 1649 <div class="matchitem graphicitem" | |
| 1650 style="background-color: black; width: 100%"></div> | |
| 1651 </div> | |
| 1652 </a> | |
| 1653 | |
| 1654 </div> | |
| 1655 </div> | |
| 1656 </div> | |
| 1657 </section> | |
| 1658 | |
| 1659 | |
| 1660 | |
| 1661 <section class=descriptions> | |
| 114 | 1662 <h3>Descriptions</h3> | 
| 106 | 1663 | 
| 1664 <div class=grey><div class=white> | |
| 114 | 1665 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 1666 | 
| 1667 <table class=descriptiontable> | |
| 1668 <col/><col/><col/><col/><col/><col/><col/> | |
| 1669 <tr> | |
| 1670 <th>Description</th> | |
| 1671 <th>Max score</th> | |
| 1672 <th>Total score</th> | |
| 1673 <th>Query cover</th> | |
| 1674 <th>E value</th> | |
| 1675 <th>Ident</th> | |
| 1676 <th>Accession</th> | |
| 1677 </tr> | |
| 1678 <tr> | |
| 1679 <td><div><a href="#hit19-1" | |
| 1680 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | |
| 1681 id="description19-1"> | |
| 1682 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | |
| 1683 </a></div></td> | |
| 1684 <td>37.4</td> | |
| 1685 <td>37.4</td> | |
| 1686 <td>100%</td> | |
| 1687 <td>7.011e-08</td> | |
| 1688 <td>100%</td> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1689 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a></td> | 
| 106 | 1690 </tr> | 
| 1691 </table> | |
| 1692 | |
| 1693 </div></div> | |
| 1694 </section> | |
| 1695 | |
| 1696 | |
| 1697 | |
| 1698 <section class=alignments> | |
| 114 | 1699 <h3>Alignments</h3> | 
| 106 | 1700 | 
| 1701 <div class=grey><div class=white> | |
| 1702 <div class=alignment id=hit19-1> | |
| 1703 | |
| 1704 <div class=linkheader> | |
| 1705 <div class=right><a href="#description19-1">Descriptions</a></div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1706 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_3">Gene Bank</a> | 
| 106 | 1707 </div> | 
| 1708 | |
| 1709 <div class=title> | |
| 1710 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 1711 <p class=titleinfo> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1712 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_3">Subject_3</a> | 
| 106 | 1713 <span class=b>Length:</span> 323 | 
| 1714 <span class=b>Number of Matches:</span> 1 | |
| 1715 </p> | |
| 1716 </div> | |
| 1717 | |
| 1718 | |
| 1719 <div class=hotspot id=hotspot19-1-1> | |
| 1720 <p class=range> | |
| 1721 <span class=range>Range 1: 224 to 243</span> | |
| 1722 </p> | |
| 1723 | |
| 1724 <table class=hotspotstable> | |
| 1725 <tr> | |
| 1726 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1727 </tr> | |
| 1728 <tr> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1729 <td>37.3537 bits (40)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1730 <td>7.01052e-08</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1731 <td>20/20 (100%)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1732 <td>0/20 (0%)</td> | 
| 106 | 1733 <td>Plus/Plus</td> | 
| 1734 </tr> | |
| 1735 </table> | |
| 1736 | |
| 1737 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 1738 |||||||||||||||||||| | |
| 1739 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | |
| 1740 </div> | |
| 1741 | |
| 1742 </div> | |
| 1743 | |
| 1744 </div></div> | |
| 1745 </section> | |
| 1746 </section> | |
| 1747 | |
| 1748 <section class=match id=match20> | |
| 1749 | |
| 114 | 1750 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1751 | 
| 1752 <section class=header> | |
| 1753 | |
| 1754 <table class=headerdata> | |
| 114 | 1755 <tr><td class=param>Query number:</td><td>20</td></tr> | 
| 1756 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1757 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1758 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1759 </table> | 
| 1760 | |
| 1761 </section> | |
| 1762 | |
| 1763 <section> | |
| 114 | 1764 <h3>No Hits</h3> | 
| 106 | 1765 <div class=grey> | 
| 1766 <table class=headerdata> | |
| 1767 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1768 </table> | |
| 1769 </div> | |
| 1770 </section> | |
| 1771 </section> | |
| 1772 | |
| 1773 <section class=match id=match21> | |
| 1774 | |
| 114 | 1775 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1776 | 
| 1777 <section class=header> | |
| 1778 | |
| 1779 <table class=headerdata> | |
| 114 | 1780 <tr><td class=param>Query number:</td><td>21</td></tr> | 
| 1781 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1782 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1783 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1784 </table> | 
| 1785 | |
| 1786 </section> | |
| 1787 | |
| 1788 <section> | |
| 114 | 1789 <h3>No Hits</h3> | 
| 106 | 1790 <div class=grey> | 
| 1791 <table class=headerdata> | |
| 1792 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1793 </table> | |
| 1794 </div> | |
| 1795 </section> | |
| 1796 </section> | |
| 1797 | |
| 1798 <section class=match id=match22> | |
| 1799 | |
| 114 | 1800 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1801 | 
| 1802 <section class=header> | |
| 1803 | |
| 1804 <table class=headerdata> | |
| 114 | 1805 <tr><td class=param>Query number:</td><td>22</td></tr> | 
| 1806 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1807 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1808 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1809 </table> | 
| 1810 | |
| 1811 </section> | |
| 1812 | |
| 1813 | |
| 1814 <section class=graphics> | |
| 114 | 1815 <h3>Graphic Summary</h3> | 
| 106 | 1816 | 
| 1817 <div class=grey> | |
| 114 | 1818 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> | 
| 106 | 1819 | 
| 1820 <div class=defline id=defline22> | |
| 1821 Mouse-over to show defline and scores, click to show alignments | |
| 1822 </div> | |
| 1823 | |
| 1824 <div class=graphic> | |
| 114 | 1825 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 1826 <div class=legend><div class=graphicrow> | 
| 1827 <div class=graphicitem style="background-color: black"><40</div> | |
| 1828 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1829 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1830 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1831 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 1832 </div></div> | 
| 1833 <div style="clear: left"></div> | |
| 1834 | |
| 1835 <div class=tablewrapper> | |
| 1836 | |
| 1837 <div class=scale> | |
| 1838 <div>query:</div> | |
| 1839 <div class=graphicrow> | |
| 1840 <div> | |
| 1841 <div class=graphicitem style="width: 10%"> | |
| 1842 <div>2</div> | |
| 1843 </div> | |
| 1844 <div class=graphicitem style="width: 10%"> | |
| 1845 <div>4</div> | |
| 1846 </div> | |
| 1847 <div class=graphicitem style="width: 10%"> | |
| 1848 <div>6</div> | |
| 1849 </div> | |
| 1850 <div class=graphicitem style="width: 10%"> | |
| 1851 <div>8</div> | |
| 1852 </div> | |
| 1853 <div class=graphicitem style="width: 10%"> | |
| 1854 <div>10</div> | |
| 1855 </div> | |
| 1856 <div class=graphicitem style="width: 10%"> | |
| 1857 <div>12</div> | |
| 1858 </div> | |
| 1859 <div class=graphicitem style="width: 10%"> | |
| 1860 <div>14</div> | |
| 1861 </div> | |
| 1862 <div class=graphicitem style="width: 10%"> | |
| 1863 <div>16</div> | |
| 1864 </div> | |
| 1865 <div class=graphicitem style="width: 10%"> | |
| 1866 <div>18</div> | |
| 1867 </div> | |
| 1868 <div class=graphicitem style="width: 10%"> | |
| 1869 <div>20</div> | |
| 1870 </div> | |
| 1871 </div> | |
| 1872 </div> | |
| 1873 <div style="clear: left"></div> | |
| 1874 </div> | |
| 1875 | |
| 1876 <a class=matchresult | |
| 1877 href="#hit22-1" | |
| 1878 onmouseover='document.getElementById("defline22").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | |
| 1879 onmouseout='document.getElementById("defline22").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1880 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 1881 <div class="matchrow graphicrow"> | |
| 1882 <div class="matchitem graphicitem" | |
| 1883 style="background-color: black; width: 100%"></div> | |
| 1884 </div> | |
| 1885 </a> | |
| 1886 | |
| 1887 </div> | |
| 1888 </div> | |
| 1889 </div> | |
| 1890 </section> | |
| 1891 | |
| 1892 | |
| 1893 | |
| 1894 <section class=descriptions> | |
| 114 | 1895 <h3>Descriptions</h3> | 
| 106 | 1896 | 
| 1897 <div class=grey><div class=white> | |
| 114 | 1898 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 1899 | 
| 1900 <table class=descriptiontable> | |
| 1901 <col/><col/><col/><col/><col/><col/><col/> | |
| 1902 <tr> | |
| 1903 <th>Description</th> | |
| 1904 <th>Max score</th> | |
| 1905 <th>Total score</th> | |
| 1906 <th>Query cover</th> | |
| 1907 <th>E value</th> | |
| 1908 <th>Ident</th> | |
| 1909 <th>Accession</th> | |
| 1910 </tr> | |
| 1911 <tr> | |
| 1912 <td><div><a href="#hit22-1" | |
| 1913 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | |
| 1914 id="description22-1"> | |
| 1915 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | |
| 1916 </a></div></td> | |
| 1917 <td>37.4</td> | |
| 1918 <td>37.4</td> | |
| 1919 <td>100%</td> | |
| 1920 <td>7.011e-08</td> | |
| 1921 <td>100%</td> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1922 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a></td> | 
| 106 | 1923 </tr> | 
| 1924 </table> | |
| 1925 | |
| 1926 </div></div> | |
| 1927 </section> | |
| 1928 | |
| 1929 | |
| 1930 | |
| 1931 <section class=alignments> | |
| 114 | 1932 <h3>Alignments</h3> | 
| 106 | 1933 | 
| 1934 <div class=grey><div class=white> | |
| 1935 <div class=alignment id=hit22-1> | |
| 1936 | |
| 1937 <div class=linkheader> | |
| 1938 <div class=right><a href="#description22-1">Descriptions</a></div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1939 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_6">Gene Bank</a> | 
| 106 | 1940 </div> | 
| 1941 | |
| 1942 <div class=title> | |
| 1943 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 1944 <p class=titleinfo> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1945 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_6">Subject_6</a> | 
| 106 | 1946 <span class=b>Length:</span> 2457 | 
| 1947 <span class=b>Number of Matches:</span> 1 | |
| 1948 </p> | |
| 1949 </div> | |
| 1950 | |
| 1951 | |
| 1952 <div class=hotspot id=hotspot22-1-1> | |
| 1953 <p class=range> | |
| 1954 <span class=range>Range 1: 2143 to 2162</span> | |
| 1955 </p> | |
| 1956 | |
| 1957 <table class=hotspotstable> | |
| 1958 <tr> | |
| 1959 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1960 </tr> | |
| 1961 <tr> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1962 <td>37.3537 bits (40)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1963 <td>7.01052e-08</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1964 <td>20/20 (100%)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
1965 <td>0/20 (0%)</td> | 
| 106 | 1966 <td>Plus/Plus</td> | 
| 1967 </tr> | |
| 1968 </table> | |
| 1969 | |
| 1970 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 1971 |||||||||||||||||||| | |
| 1972 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | |
| 1973 </div> | |
| 1974 | |
| 1975 </div> | |
| 1976 | |
| 1977 </div></div> | |
| 1978 </section> | |
| 1979 </section> | |
| 1980 | |
| 1981 <section class=match id=match23> | |
| 1982 | |
| 114 | 1983 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1984 | 
| 1985 <section class=header> | |
| 1986 | |
| 1987 <table class=headerdata> | |
| 114 | 1988 <tr><td class=param>Query number:</td><td>23</td></tr> | 
| 1989 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 1990 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 1991 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1992 </table> | 
| 1993 | |
| 1994 </section> | |
| 1995 | |
| 1996 <section> | |
| 114 | 1997 <h3>No Hits</h3> | 
| 106 | 1998 <div class=grey> | 
| 1999 <table class=headerdata> | |
| 2000 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2001 </table> | |
| 2002 </div> | |
| 2003 </section> | |
| 2004 </section> | |
| 2005 | |
| 2006 <section class=match id=match24> | |
| 2007 | |
| 114 | 2008 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 2009 | 
| 2010 <section class=header> | |
| 2011 | |
| 2012 <table class=headerdata> | |
| 114 | 2013 <tr><td class=param>Query number:</td><td>24</td></tr> | 
| 2014 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 2015 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 2016 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2017 </table> | 
| 2018 | |
| 2019 </section> | |
| 2020 | |
| 2021 <section> | |
| 114 | 2022 <h3>No Hits</h3> | 
| 106 | 2023 <div class=grey> | 
| 2024 <table class=headerdata> | |
| 2025 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2026 </table> | |
| 2027 </div> | |
| 2028 </section> | |
| 2029 </section> | |
| 2030 | |
| 2031 <section class=match id=match25> | |
| 2032 | |
| 114 | 2033 <h2>Nucleotide Sequence (24 letters)</h2> | 
| 106 | 2034 | 
| 2035 <section class=header> | |
| 2036 | |
| 2037 <table class=headerdata> | |
| 114 | 2038 <tr><td class=param>Query number:</td><td>25</td></tr> | 
| 2039 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2040 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2041 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2042 </table> | 
| 2043 | |
| 2044 </section> | |
| 2045 | |
| 2046 <section> | |
| 114 | 2047 <h3>No Hits</h3> | 
| 106 | 2048 <div class=grey> | 
| 2049 <table class=headerdata> | |
| 2050 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2051 </table> | |
| 2052 </div> | |
| 2053 </section> | |
| 2054 </section> | |
| 2055 | |
| 2056 <section class=match id=match26> | |
| 2057 | |
| 114 | 2058 <h2>Nucleotide Sequence (24 letters)</h2> | 
| 106 | 2059 | 
| 2060 <section class=header> | |
| 2061 | |
| 2062 <table class=headerdata> | |
| 114 | 2063 <tr><td class=param>Query number:</td><td>26</td></tr> | 
| 2064 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2065 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2066 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2067 </table> | 
| 2068 | |
| 2069 </section> | |
| 2070 | |
| 2071 <section> | |
| 114 | 2072 <h3>No Hits</h3> | 
| 106 | 2073 <div class=grey> | 
| 2074 <table class=headerdata> | |
| 2075 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2076 </table> | |
| 2077 </div> | |
| 2078 </section> | |
| 2079 </section> | |
| 2080 | |
| 2081 <section class=match id=match27> | |
| 2082 | |
| 114 | 2083 <h2>Nucleotide Sequence (24 letters)</h2> | 
| 106 | 2084 | 
| 2085 <section class=header> | |
| 2086 | |
| 2087 <table class=headerdata> | |
| 114 | 2088 <tr><td class=param>Query number:</td><td>27</td></tr> | 
| 2089 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2090 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2091 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2092 </table> | 
| 2093 | |
| 2094 </section> | |
| 2095 | |
| 2096 <section> | |
| 114 | 2097 <h3>No Hits</h3> | 
| 106 | 2098 <div class=grey> | 
| 2099 <table class=headerdata> | |
| 2100 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2101 </table> | |
| 2102 </div> | |
| 2103 </section> | |
| 2104 </section> | |
| 2105 | |
| 2106 <section class=match id=match28> | |
| 2107 | |
| 114 | 2108 <h2>Nucleotide Sequence (24 letters)</h2> | 
| 106 | 2109 | 
| 2110 <section class=header> | |
| 2111 | |
| 2112 <table class=headerdata> | |
| 114 | 2113 <tr><td class=param>Query number:</td><td>28</td></tr> | 
| 2114 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2115 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2116 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2117 </table> | 
| 2118 | |
| 2119 </section> | |
| 2120 | |
| 2121 <section> | |
| 114 | 2122 <h3>No Hits</h3> | 
| 106 | 2123 <div class=grey> | 
| 2124 <table class=headerdata> | |
| 2125 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2126 </table> | |
| 2127 </div> | |
| 2128 </section> | |
| 2129 </section> | |
| 2130 | |
| 2131 <section class=match id=match29> | |
| 2132 | |
| 114 | 2133 <h2>Nucleotide Sequence (24 letters)</h2> | 
| 106 | 2134 | 
| 2135 <section class=header> | |
| 2136 | |
| 2137 <table class=headerdata> | |
| 114 | 2138 <tr><td class=param>Query number:</td><td>29</td></tr> | 
| 2139 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2140 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2141 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2142 </table> | 
| 2143 | |
| 2144 </section> | |
| 2145 | |
| 2146 <section> | |
| 114 | 2147 <h3>No Hits</h3> | 
| 106 | 2148 <div class=grey> | 
| 2149 <table class=headerdata> | |
| 2150 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2151 </table> | |
| 2152 </div> | |
| 2153 </section> | |
| 2154 </section> | |
| 2155 | |
| 2156 <section class=match id=match30> | |
| 2157 | |
| 114 | 2158 <h2>Nucleotide Sequence (24 letters)</h2> | 
| 106 | 2159 | 
| 2160 <section class=header> | |
| 2161 | |
| 2162 <table class=headerdata> | |
| 114 | 2163 <tr><td class=param>Query number:</td><td>30</td></tr> | 
| 2164 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2165 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2166 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2167 </table> | 
| 2168 | |
| 2169 </section> | |
| 2170 | |
| 2171 <section> | |
| 114 | 2172 <h3>No Hits</h3> | 
| 106 | 2173 <div class=grey> | 
| 2174 <table class=headerdata> | |
| 2175 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2176 </table> | |
| 2177 </div> | |
| 2178 </section> | |
| 2179 </section> | |
| 2180 | |
| 2181 <section class=match id=match31> | |
| 2182 | |
| 114 | 2183 <h2>Nucleotide Sequence (24 letters)</h2> | 
| 106 | 2184 | 
| 2185 <section class=header> | |
| 2186 | |
| 2187 <table class=headerdata> | |
| 114 | 2188 <tr><td class=param>Query number:</td><td>31</td></tr> | 
| 2189 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2190 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2191 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2192 </table> | 
| 2193 | |
| 2194 </section> | |
| 2195 | |
| 2196 <section> | |
| 114 | 2197 <h3>No Hits</h3> | 
| 106 | 2198 <div class=grey> | 
| 2199 <table class=headerdata> | |
| 2200 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2201 </table> | |
| 2202 </div> | |
| 2203 </section> | |
| 2204 </section> | |
| 2205 | |
| 2206 <section class=match id=match32> | |
| 2207 | |
| 114 | 2208 <h2>Nucleotide Sequence (24 letters)</h2> | 
| 106 | 2209 | 
| 2210 <section class=header> | |
| 2211 | |
| 2212 <table class=headerdata> | |
| 114 | 2213 <tr><td class=param>Query number:</td><td>32</td></tr> | 
| 2214 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 2215 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2216 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 2217 </table> | 
| 2218 | |
| 2219 </section> | |
| 2220 | |
| 2221 <section> | |
| 114 | 2222 <h3>No Hits</h3> | 
| 106 | 2223 <div class=grey> | 
| 2224 <table class=headerdata> | |
| 2225 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2226 </table> | |
| 2227 </div> | |
| 2228 </section> | |
| 2229 </section> | |
| 2230 | |
| 2231 <section class=match id=match33> | |
| 2232 | |
| 114 | 2233 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 2234 | 
| 2235 <section class=header> | |
| 2236 | |
| 2237 <table class=headerdata> | |
| 114 | 2238 <tr><td class=param>Query number:</td><td>33</td></tr> | 
| 2239 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2240 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2241 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2242 </table> | 
| 2243 | |
| 2244 </section> | |
| 2245 | |
| 2246 <section> | |
| 114 | 2247 <h3>No Hits</h3> | 
| 106 | 2248 <div class=grey> | 
| 2249 <table class=headerdata> | |
| 2250 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2251 </table> | |
| 2252 </div> | |
| 2253 </section> | |
| 2254 </section> | |
| 2255 | |
| 2256 <section class=match id=match34> | |
| 2257 | |
| 114 | 2258 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 2259 | 
| 2260 <section class=header> | |
| 2261 | |
| 2262 <table class=headerdata> | |
| 114 | 2263 <tr><td class=param>Query number:</td><td>34</td></tr> | 
| 2264 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2265 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2266 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2267 </table> | 
| 2268 | |
| 2269 </section> | |
| 2270 | |
| 2271 <section> | |
| 114 | 2272 <h3>No Hits</h3> | 
| 106 | 2273 <div class=grey> | 
| 2274 <table class=headerdata> | |
| 2275 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2276 </table> | |
| 2277 </div> | |
| 2278 </section> | |
| 2279 </section> | |
| 2280 | |
| 2281 <section class=match id=match35> | |
| 2282 | |
| 114 | 2283 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 2284 | 
| 2285 <section class=header> | |
| 2286 | |
| 2287 <table class=headerdata> | |
| 114 | 2288 <tr><td class=param>Query number:</td><td>35</td></tr> | 
| 2289 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2290 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2291 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2292 </table> | 
| 2293 | |
| 2294 </section> | |
| 2295 | |
| 2296 <section> | |
| 114 | 2297 <h3>No Hits</h3> | 
| 106 | 2298 <div class=grey> | 
| 2299 <table class=headerdata> | |
| 2300 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2301 </table> | |
| 2302 </div> | |
| 2303 </section> | |
| 2304 </section> | |
| 2305 | |
| 2306 <section class=match id=match36> | |
| 2307 | |
| 114 | 2308 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 2309 | 
| 2310 <section class=header> | |
| 2311 | |
| 2312 <table class=headerdata> | |
| 114 | 2313 <tr><td class=param>Query number:</td><td>36</td></tr> | 
| 2314 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2315 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2316 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2317 </table> | 
| 2318 | |
| 2319 </section> | |
| 2320 | |
| 2321 <section> | |
| 114 | 2322 <h3>No Hits</h3> | 
| 106 | 2323 <div class=grey> | 
| 2324 <table class=headerdata> | |
| 2325 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2326 </table> | |
| 2327 </div> | |
| 2328 </section> | |
| 2329 </section> | |
| 2330 | |
| 2331 <section class=match id=match37> | |
| 2332 | |
| 114 | 2333 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 2334 | 
| 2335 <section class=header> | |
| 2336 | |
| 2337 <table class=headerdata> | |
| 114 | 2338 <tr><td class=param>Query number:</td><td>37</td></tr> | 
| 2339 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2340 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2341 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2342 </table> | 
| 2343 | |
| 2344 </section> | |
| 2345 | |
| 2346 <section> | |
| 114 | 2347 <h3>No Hits</h3> | 
| 106 | 2348 <div class=grey> | 
| 2349 <table class=headerdata> | |
| 2350 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2351 </table> | |
| 2352 </div> | |
| 2353 </section> | |
| 2354 </section> | |
| 2355 | |
| 2356 <section class=match id=match38> | |
| 2357 | |
| 114 | 2358 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 2359 | 
| 2360 <section class=header> | |
| 2361 | |
| 2362 <table class=headerdata> | |
| 114 | 2363 <tr><td class=param>Query number:</td><td>38</td></tr> | 
| 2364 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2365 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2366 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2367 </table> | 
| 2368 | |
| 2369 </section> | |
| 2370 | |
| 2371 <section> | |
| 114 | 2372 <h3>No Hits</h3> | 
| 106 | 2373 <div class=grey> | 
| 2374 <table class=headerdata> | |
| 2375 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2376 </table> | |
| 2377 </div> | |
| 2378 </section> | |
| 2379 </section> | |
| 2380 | |
| 2381 <section class=match id=match39> | |
| 2382 | |
| 114 | 2383 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 2384 | 
| 2385 <section class=header> | |
| 2386 | |
| 2387 <table class=headerdata> | |
| 114 | 2388 <tr><td class=param>Query number:</td><td>39</td></tr> | 
| 2389 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2390 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2391 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2392 </table> | 
| 2393 | |
| 2394 </section> | |
| 2395 | |
| 2396 <section> | |
| 114 | 2397 <h3>No Hits</h3> | 
| 106 | 2398 <div class=grey> | 
| 2399 <table class=headerdata> | |
| 2400 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2401 </table> | |
| 2402 </div> | |
| 2403 </section> | |
| 2404 </section> | |
| 2405 | |
| 2406 <section class=match id=match40> | |
| 2407 | |
| 114 | 2408 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 2409 | 
| 2410 <section class=header> | |
| 2411 | |
| 2412 <table class=headerdata> | |
| 114 | 2413 <tr><td class=param>Query number:</td><td>40</td></tr> | 
| 2414 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 2415 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2416 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 2417 </table> | 
| 2418 | |
| 2419 </section> | |
| 2420 | |
| 2421 <section> | |
| 114 | 2422 <h3>No Hits</h3> | 
| 106 | 2423 <div class=grey> | 
| 2424 <table class=headerdata> | |
| 2425 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2426 </table> | |
| 2427 </div> | |
| 2428 </section> | |
| 2429 </section> | |
| 2430 | |
| 2431 <section class=match id=match41> | |
| 2432 | |
| 114 | 2433 <h2>Nucleotide Sequence (25 letters)</h2> | 
| 106 | 2434 | 
| 2435 <section class=header> | |
| 2436 | |
| 2437 <table class=headerdata> | |
| 114 | 2438 <tr><td class=param>Query number:</td><td>41</td></tr> | 
| 2439 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2440 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2441 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2442 </table> | 
| 2443 | |
| 2444 </section> | |
| 2445 | |
| 2446 <section> | |
| 114 | 2447 <h3>No Hits</h3> | 
| 106 | 2448 <div class=grey> | 
| 2449 <table class=headerdata> | |
| 2450 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2451 </table> | |
| 2452 </div> | |
| 2453 </section> | |
| 2454 </section> | |
| 2455 | |
| 2456 <section class=match id=match42> | |
| 2457 | |
| 114 | 2458 <h2>Nucleotide Sequence (25 letters)</h2> | 
| 106 | 2459 | 
| 2460 <section class=header> | |
| 2461 | |
| 2462 <table class=headerdata> | |
| 114 | 2463 <tr><td class=param>Query number:</td><td>42</td></tr> | 
| 2464 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2465 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2466 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2467 </table> | 
| 2468 | |
| 2469 </section> | |
| 2470 | |
| 2471 <section> | |
| 114 | 2472 <h3>No Hits</h3> | 
| 106 | 2473 <div class=grey> | 
| 2474 <table class=headerdata> | |
| 2475 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2476 </table> | |
| 2477 </div> | |
| 2478 </section> | |
| 2479 </section> | |
| 2480 | |
| 2481 <section class=match id=match43> | |
| 2482 | |
| 114 | 2483 <h2>Nucleotide Sequence (25 letters)</h2> | 
| 106 | 2484 | 
| 2485 <section class=header> | |
| 2486 | |
| 2487 <table class=headerdata> | |
| 114 | 2488 <tr><td class=param>Query number:</td><td>43</td></tr> | 
| 2489 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2490 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2491 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2492 </table> | 
| 2493 | |
| 2494 </section> | |
| 2495 | |
| 2496 <section> | |
| 114 | 2497 <h3>No Hits</h3> | 
| 106 | 2498 <div class=grey> | 
| 2499 <table class=headerdata> | |
| 2500 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2501 </table> | |
| 2502 </div> | |
| 2503 </section> | |
| 2504 </section> | |
| 2505 | |
| 2506 <section class=match id=match44> | |
| 2507 | |
| 114 | 2508 <h2>Nucleotide Sequence (25 letters)</h2> | 
| 106 | 2509 | 
| 2510 <section class=header> | |
| 2511 | |
| 2512 <table class=headerdata> | |
| 114 | 2513 <tr><td class=param>Query number:</td><td>44</td></tr> | 
| 2514 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2515 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2516 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2517 </table> | 
| 2518 | |
| 2519 </section> | |
| 2520 | |
| 2521 <section> | |
| 114 | 2522 <h3>No Hits</h3> | 
| 106 | 2523 <div class=grey> | 
| 2524 <table class=headerdata> | |
| 2525 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2526 </table> | |
| 2527 </div> | |
| 2528 </section> | |
| 2529 </section> | |
| 2530 | |
| 2531 <section class=match id=match45> | |
| 2532 | |
| 114 | 2533 <h2>Nucleotide Sequence (25 letters)</h2> | 
| 106 | 2534 | 
| 2535 <section class=header> | |
| 2536 | |
| 2537 <table class=headerdata> | |
| 114 | 2538 <tr><td class=param>Query number:</td><td>45</td></tr> | 
| 2539 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2540 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2541 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2542 </table> | 
| 2543 | |
| 2544 </section> | |
| 2545 | |
| 2546 <section> | |
| 114 | 2547 <h3>No Hits</h3> | 
| 106 | 2548 <div class=grey> | 
| 2549 <table class=headerdata> | |
| 2550 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2551 </table> | |
| 2552 </div> | |
| 2553 </section> | |
| 2554 </section> | |
| 2555 | |
| 2556 <section class=match id=match46> | |
| 2557 | |
| 114 | 2558 <h2>Nucleotide Sequence (25 letters)</h2> | 
| 106 | 2559 | 
| 2560 <section class=header> | |
| 2561 | |
| 2562 <table class=headerdata> | |
| 114 | 2563 <tr><td class=param>Query number:</td><td>46</td></tr> | 
| 2564 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2565 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2566 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2567 </table> | 
| 2568 | |
| 2569 </section> | |
| 2570 | |
| 2571 <section> | |
| 114 | 2572 <h3>No Hits</h3> | 
| 106 | 2573 <div class=grey> | 
| 2574 <table class=headerdata> | |
| 2575 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2576 </table> | |
| 2577 </div> | |
| 2578 </section> | |
| 2579 </section> | |
| 2580 | |
| 2581 <section class=match id=match47> | |
| 2582 | |
| 114 | 2583 <h2>Nucleotide Sequence (25 letters)</h2> | 
| 106 | 2584 | 
| 2585 <section class=header> | |
| 2586 | |
| 2587 <table class=headerdata> | |
| 114 | 2588 <tr><td class=param>Query number:</td><td>47</td></tr> | 
| 2589 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2590 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2591 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2592 </table> | 
| 2593 | |
| 2594 </section> | |
| 2595 | |
| 2596 | |
| 2597 <section class=graphics> | |
| 114 | 2598 <h3>Graphic Summary</h3> | 
| 106 | 2599 | 
| 2600 <div class=grey> | |
| 114 | 2601 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> | 
| 106 | 2602 | 
| 2603 <div class=defline id=defline47> | |
| 2604 Mouse-over to show defline and scores, click to show alignments | |
| 2605 </div> | |
| 2606 | |
| 2607 <div class=graphic> | |
| 114 | 2608 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 2609 <div class=legend><div class=graphicrow> | 
| 2610 <div class=graphicitem style="background-color: black"><40</div> | |
| 2611 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 2612 <div class=graphicitem style="background-color: green">50–80</div> | |
| 2613 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2614 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 2615 </div></div> | 
| 2616 <div style="clear: left"></div> | |
| 2617 | |
| 2618 <div class=tablewrapper> | |
| 2619 | |
| 2620 <div class=scale> | |
| 2621 <div>query:</div> | |
| 2622 <div class=graphicrow> | |
| 2623 <div> | |
| 2624 <div class=graphicitem style="width: 12%"> | |
| 2625 <div>3</div> | |
| 2626 </div> | |
| 2627 <div class=graphicitem style="width: 12%"> | |
| 2628 <div>6</div> | |
| 2629 </div> | |
| 2630 <div class=graphicitem style="width: 12%"> | |
| 2631 <div>9</div> | |
| 2632 </div> | |
| 2633 <div class=graphicitem style="width: 12%"> | |
| 2634 <div>12</div> | |
| 2635 </div> | |
| 2636 <div class=graphicitem style="width: 12%"> | |
| 2637 <div>15</div> | |
| 2638 </div> | |
| 2639 <div class=graphicitem style="width: 12%"> | |
| 2640 <div>18</div> | |
| 2641 </div> | |
| 2642 <div class=graphicitem style="width: 12%"> | |
| 2643 <div>21</div> | |
| 2644 </div> | |
| 2645 <div class=graphicitem style="width: 12%"> | |
| 2646 <div>24</div> | |
| 2647 </div> | |
| 2648 <div class=graphicitem style="width: 4%"> | |
| 2649 <div>25</div> | |
| 2650 </div> | |
| 2651 </div> | |
| 2652 </div> | |
| 2653 <div style="clear: left"></div> | |
| 2654 </div> | |
| 2655 | |
| 2656 <a class=matchresult | |
| 2657 href="#hit47-1" | |
| 2658 onmouseover='document.getElementById("defline47").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | |
| 2659 onmouseout='document.getElementById("defline47").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 2660 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 2661 <div class="matchrow graphicrow"> | |
| 2662 <div class="matchitem graphicitem" | |
| 2663 style="background-color: black; width: 100%"></div> | |
| 2664 </div> | |
| 2665 </a> | |
| 2666 | |
| 2667 </div> | |
| 2668 </div> | |
| 2669 </div> | |
| 2670 </section> | |
| 2671 | |
| 2672 | |
| 2673 | |
| 2674 <section class=descriptions> | |
| 114 | 2675 <h3>Descriptions</h3> | 
| 106 | 2676 | 
| 2677 <div class=grey><div class=white> | |
| 114 | 2678 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 2679 | 
| 2680 <table class=descriptiontable> | |
| 2681 <col/><col/><col/><col/><col/><col/><col/> | |
| 2682 <tr> | |
| 2683 <th>Description</th> | |
| 2684 <th>Max score</th> | |
| 2685 <th>Total score</th> | |
| 2686 <th>Query cover</th> | |
| 2687 <th>E value</th> | |
| 2688 <th>Ident</th> | |
| 2689 <th>Accession</th> | |
| 2690 </tr> | |
| 2691 <tr> | |
| 2692 <td><div><a href="#hit47-1" | |
| 2693 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | |
| 2694 id="description47-1"> | |
| 2695 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | |
| 2696 </a></div></td> | |
| 2697 <td>37.4</td> | |
| 2698 <td>37.4</td> | |
| 2699 <td>100%</td> | |
| 2700 <td>9.338e-08</td> | |
| 2701 <td>92%</td> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2702 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td> | 
| 106 | 2703 </tr> | 
| 2704 </table> | |
| 2705 | |
| 2706 </div></div> | |
| 2707 </section> | |
| 2708 | |
| 2709 | |
| 2710 | |
| 2711 <section class=alignments> | |
| 114 | 2712 <h3>Alignments</h3> | 
| 106 | 2713 | 
| 2714 <div class=grey><div class=white> | |
| 2715 <div class=alignment id=hit47-1> | |
| 2716 | |
| 2717 <div class=linkheader> | |
| 2718 <div class=right><a href="#description47-1">Descriptions</a></div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2719 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a> | 
| 106 | 2720 </div> | 
| 2721 | |
| 2722 <div class=title> | |
| 2723 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 2724 <p class=titleinfo> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2725 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a> | 
| 106 | 2726 <span class=b>Length:</span> 4180 | 
| 2727 <span class=b>Number of Matches:</span> 1 | |
| 2728 </p> | |
| 2729 </div> | |
| 2730 | |
| 2731 | |
| 2732 <div class=hotspot id=hotspot47-1-1> | |
| 2733 <p class=range> | |
| 2734 <span class=range>Range 1: 1541 to 1565</span> | |
| 2735 </p> | |
| 2736 | |
| 2737 <table class=hotspotstable> | |
| 2738 <tr> | |
| 2739 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 2740 </tr> | |
| 2741 <tr> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2742 <td>37.3537 bits (40)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2743 <td>9.33825e-08</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2744 <td>23/25 (92%)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2745 <td>0/25 (0%)</td> | 
| 106 | 2746 <td>Plus/Plus</td> | 
| 2747 </tr> | |
| 2748 </table> | |
| 2749 | |
| 2750 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | |
| 2751 |||||||||||||| ||||||| || | |
| 2752 Subject 1541 ACATGAACAGCGCCCTGACCACCGC 1565</pre> | |
| 2753 </div> | |
| 2754 | |
| 2755 </div> | |
| 2756 | |
| 2757 </div></div> | |
| 2758 </section> | |
| 2759 </section> | |
| 2760 | |
| 2761 <section class=match id=match48> | |
| 2762 | |
| 114 | 2763 <h2>Nucleotide Sequence (25 letters)</h2> | 
| 106 | 2764 | 
| 2765 <section class=header> | |
| 2766 | |
| 2767 <table class=headerdata> | |
| 114 | 2768 <tr><td class=param>Query number:</td><td>48</td></tr> | 
| 2769 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 2770 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2771 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 2772 </table> | 
| 2773 | |
| 2774 </section> | |
| 2775 | |
| 2776 | |
| 2777 <section class=graphics> | |
| 114 | 2778 <h3>Graphic Summary</h3> | 
| 106 | 2779 | 
| 2780 <div class=grey> | |
| 114 | 2781 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> | 
| 106 | 2782 | 
| 2783 <div class=defline id=defline48> | |
| 2784 Mouse-over to show defline and scores, click to show alignments | |
| 2785 </div> | |
| 2786 | |
| 2787 <div class=graphic> | |
| 114 | 2788 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 2789 <div class=legend><div class=graphicrow> | 
| 2790 <div class=graphicitem style="background-color: black"><40</div> | |
| 2791 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 2792 <div class=graphicitem style="background-color: green">50–80</div> | |
| 2793 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2794 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 2795 </div></div> | 
| 2796 <div style="clear: left"></div> | |
| 2797 | |
| 2798 <div class=tablewrapper> | |
| 2799 | |
| 2800 <div class=scale> | |
| 2801 <div>query:</div> | |
| 2802 <div class=graphicrow> | |
| 2803 <div> | |
| 2804 <div class=graphicitem style="width: 12%"> | |
| 2805 <div>3</div> | |
| 2806 </div> | |
| 2807 <div class=graphicitem style="width: 12%"> | |
| 2808 <div>6</div> | |
| 2809 </div> | |
| 2810 <div class=graphicitem style="width: 12%"> | |
| 2811 <div>9</div> | |
| 2812 </div> | |
| 2813 <div class=graphicitem style="width: 12%"> | |
| 2814 <div>12</div> | |
| 2815 </div> | |
| 2816 <div class=graphicitem style="width: 12%"> | |
| 2817 <div>15</div> | |
| 2818 </div> | |
| 2819 <div class=graphicitem style="width: 12%"> | |
| 2820 <div>18</div> | |
| 2821 </div> | |
| 2822 <div class=graphicitem style="width: 12%"> | |
| 2823 <div>21</div> | |
| 2824 </div> | |
| 2825 <div class=graphicitem style="width: 12%"> | |
| 2826 <div>24</div> | |
| 2827 </div> | |
| 2828 <div class=graphicitem style="width: 4%"> | |
| 2829 <div>25</div> | |
| 2830 </div> | |
| 2831 </div> | |
| 2832 </div> | |
| 2833 <div style="clear: left"></div> | |
| 2834 </div> | |
| 2835 | |
| 2836 <a class=matchresult | |
| 2837 href="#hit48-1" | |
| 2838 onmouseover='document.getElementById("defline48").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | |
| 2839 onmouseout='document.getElementById("defline48").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 2840 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 2841 <div class="matchrow graphicrow"> | |
| 2842 <div class="matchitem graphicitem" | |
| 2843 style="background-color: black; width: 100%"></div> | |
| 2844 </div> | |
| 2845 </a> | |
| 2846 | |
| 2847 </div> | |
| 2848 </div> | |
| 2849 </div> | |
| 2850 </section> | |
| 2851 | |
| 2852 | |
| 2853 | |
| 2854 <section class=descriptions> | |
| 114 | 2855 <h3>Descriptions</h3> | 
| 106 | 2856 | 
| 2857 <div class=grey><div class=white> | |
| 114 | 2858 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 2859 | 
| 2860 <table class=descriptiontable> | |
| 2861 <col/><col/><col/><col/><col/><col/><col/> | |
| 2862 <tr> | |
| 2863 <th>Description</th> | |
| 2864 <th>Max score</th> | |
| 2865 <th>Total score</th> | |
| 2866 <th>Query cover</th> | |
| 2867 <th>E value</th> | |
| 2868 <th>Ident</th> | |
| 2869 <th>Accession</th> | |
| 2870 </tr> | |
| 2871 <tr> | |
| 2872 <td><div><a href="#hit48-1" | |
| 2873 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | |
| 2874 id="description48-1"> | |
| 2875 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | |
| 2876 </a></div></td> | |
| 2877 <td>37.4</td> | |
| 2878 <td>37.4</td> | |
| 2879 <td>100%</td> | |
| 2880 <td>9.338e-08</td> | |
| 2881 <td>92%</td> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2882 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td> | 
| 106 | 2883 </tr> | 
| 2884 </table> | |
| 2885 | |
| 2886 </div></div> | |
| 2887 </section> | |
| 2888 | |
| 2889 | |
| 2890 | |
| 2891 <section class=alignments> | |
| 114 | 2892 <h3>Alignments</h3> | 
| 106 | 2893 | 
| 2894 <div class=grey><div class=white> | |
| 2895 <div class=alignment id=hit48-1> | |
| 2896 | |
| 2897 <div class=linkheader> | |
| 2898 <div class=right><a href="#description48-1">Descriptions</a></div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2899 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a> | 
| 106 | 2900 </div> | 
| 2901 | |
| 2902 <div class=title> | |
| 2903 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 2904 <p class=titleinfo> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2905 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a> | 
| 106 | 2906 <span class=b>Length:</span> 4983 | 
| 2907 <span class=b>Number of Matches:</span> 1 | |
| 2908 </p> | |
| 2909 </div> | |
| 2910 | |
| 2911 | |
| 2912 <div class=hotspot id=hotspot48-1-1> | |
| 2913 <p class=range> | |
| 2914 <span class=range>Range 1: 2344 to 2368</span> | |
| 2915 </p> | |
| 2916 | |
| 2917 <table class=hotspotstable> | |
| 2918 <tr> | |
| 2919 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 2920 </tr> | |
| 2921 <tr> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2922 <td>37.3537 bits (40)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2923 <td>9.33825e-08</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2924 <td>23/25 (92%)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
2925 <td>0/25 (0%)</td> | 
| 106 | 2926 <td>Plus/Plus</td> | 
| 2927 </tr> | |
| 2928 </table> | |
| 2929 | |
| 2930 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | |
| 2931 |||||||||||||| ||||||| || | |
| 2932 Subject 2344 ACATGAACAGCGCCCTGACCACCGC 2368</pre> | |
| 2933 </div> | |
| 2934 | |
| 2935 </div> | |
| 2936 | |
| 2937 </div></div> | |
| 2938 </section> | |
| 2939 </section> | |
| 2940 | |
| 2941 <section class=match id=match49> | |
| 2942 | |
| 114 | 2943 <h2>Nucleotide Sequence (74 letters)</h2> | 
| 106 | 2944 | 
| 2945 <section class=header> | |
| 2946 | |
| 2947 <table class=headerdata> | |
| 114 | 2948 <tr><td class=param>Query number:</td><td>49</td></tr> | 
| 2949 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 2950 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2951 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 2952 </table> | 
| 2953 | |
| 2954 </section> | |
| 2955 | |
| 2956 <section> | |
| 114 | 2957 <h3>No Hits</h3> | 
| 106 | 2958 <div class=grey> | 
| 2959 <table class=headerdata> | |
| 2960 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2961 </table> | |
| 2962 </div> | |
| 2963 </section> | |
| 2964 </section> | |
| 2965 | |
| 2966 <section class=match id=match50> | |
| 2967 | |
| 114 | 2968 <h2>Nucleotide Sequence (74 letters)</h2> | 
| 106 | 2969 | 
| 2970 <section class=header> | |
| 2971 | |
| 2972 <table class=headerdata> | |
| 114 | 2973 <tr><td class=param>Query number:</td><td>50</td></tr> | 
| 2974 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 2975 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 2976 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 2977 </table> | 
| 2978 | |
| 2979 </section> | |
| 2980 | |
| 2981 <section> | |
| 114 | 2982 <h3>No Hits</h3> | 
| 106 | 2983 <div class=grey> | 
| 2984 <table class=headerdata> | |
| 2985 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 2986 </table> | |
| 2987 </div> | |
| 2988 </section> | |
| 2989 </section> | |
| 2990 | |
| 2991 <section class=match id=match51> | |
| 2992 | |
| 114 | 2993 <h2>Nucleotide Sequence (74 letters)</h2> | 
| 106 | 2994 | 
| 2995 <section class=header> | |
| 2996 | |
| 2997 <table class=headerdata> | |
| 114 | 2998 <tr><td class=param>Query number:</td><td>51</td></tr> | 
| 2999 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3000 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3001 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3002 </table> | 
| 3003 | |
| 3004 </section> | |
| 3005 | |
| 3006 <section> | |
| 114 | 3007 <h3>No Hits</h3> | 
| 106 | 3008 <div class=grey> | 
| 3009 <table class=headerdata> | |
| 3010 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3011 </table> | |
| 3012 </div> | |
| 3013 </section> | |
| 3014 </section> | |
| 3015 | |
| 3016 <section class=match id=match52> | |
| 3017 | |
| 114 | 3018 <h2>Nucleotide Sequence (74 letters)</h2> | 
| 106 | 3019 | 
| 3020 <section class=header> | |
| 3021 | |
| 3022 <table class=headerdata> | |
| 114 | 3023 <tr><td class=param>Query number:</td><td>52</td></tr> | 
| 3024 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3025 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3026 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3027 </table> | 
| 3028 | |
| 3029 </section> | |
| 3030 | |
| 3031 <section> | |
| 114 | 3032 <h3>No Hits</h3> | 
| 106 | 3033 <div class=grey> | 
| 3034 <table class=headerdata> | |
| 3035 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3036 </table> | |
| 3037 </div> | |
| 3038 </section> | |
| 3039 </section> | |
| 3040 | |
| 3041 <section class=match id=match53> | |
| 3042 | |
| 114 | 3043 <h2>Nucleotide Sequence (74 letters)</h2> | 
| 106 | 3044 | 
| 3045 <section class=header> | |
| 3046 | |
| 3047 <table class=headerdata> | |
| 114 | 3048 <tr><td class=param>Query number:</td><td>53</td></tr> | 
| 3049 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3050 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3051 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3052 </table> | 
| 3053 | |
| 3054 </section> | |
| 3055 | |
| 3056 <section> | |
| 114 | 3057 <h3>No Hits</h3> | 
| 106 | 3058 <div class=grey> | 
| 3059 <table class=headerdata> | |
| 3060 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3061 </table> | |
| 3062 </div> | |
| 3063 </section> | |
| 3064 </section> | |
| 3065 | |
| 3066 <section class=match id=match54> | |
| 3067 | |
| 114 | 3068 <h2>Nucleotide Sequence (74 letters)</h2> | 
| 106 | 3069 | 
| 3070 <section class=header> | |
| 3071 | |
| 3072 <table class=headerdata> | |
| 114 | 3073 <tr><td class=param>Query number:</td><td>54</td></tr> | 
| 3074 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3075 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3076 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3077 </table> | 
| 3078 | |
| 3079 </section> | |
| 3080 | |
| 3081 <section> | |
| 114 | 3082 <h3>No Hits</h3> | 
| 106 | 3083 <div class=grey> | 
| 3084 <table class=headerdata> | |
| 3085 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 3086 </table> | |
| 3087 </div> | |
| 3088 </section> | |
| 3089 </section> | |
| 3090 | |
| 3091 <section class=match id=match55> | |
| 3092 | |
| 114 | 3093 <h2>Nucleotide Sequence (74 letters)</h2> | 
| 106 | 3094 | 
| 3095 <section class=header> | |
| 3096 | |
| 3097 <table class=headerdata> | |
| 114 | 3098 <tr><td class=param>Query number:</td><td>55</td></tr> | 
| 3099 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3100 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3101 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3102 </table> | 
| 3103 | |
| 3104 </section> | |
| 3105 | |
| 3106 | |
| 3107 <section class=graphics> | |
| 114 | 3108 <h3>Graphic Summary</h3> | 
| 106 | 3109 | 
| 3110 <div class=grey> | |
| 114 | 3111 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> | 
| 106 | 3112 | 
| 3113 <div class=defline id=defline55> | |
| 3114 Mouse-over to show defline and scores, click to show alignments | |
| 3115 </div> | |
| 3116 | |
| 3117 <div class=graphic> | |
| 114 | 3118 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 3119 <div class=legend><div class=graphicrow> | 
| 3120 <div class=graphicitem style="background-color: black"><40</div> | |
| 3121 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 3122 <div class=graphicitem style="background-color: green">50–80</div> | |
| 3123 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3124 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 3125 </div></div> | 
| 3126 <div style="clear: left"></div> | |
| 3127 | |
| 3128 <div class=tablewrapper> | |
| 3129 | |
| 3130 <div class=scale> | |
| 3131 <div>query:</div> | |
| 3132 <div class=graphicrow> | |
| 3133 <div> | |
| 3134 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3135 <div>8</div> | |
| 3136 </div> | |
| 3137 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3138 <div>16</div> | |
| 3139 </div> | |
| 3140 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3141 <div>24</div> | |
| 3142 </div> | |
| 3143 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3144 <div>32</div> | |
| 3145 </div> | |
| 3146 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3147 <div>40</div> | |
| 3148 </div> | |
| 3149 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3150 <div>48</div> | |
| 3151 </div> | |
| 3152 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3153 <div>56</div> | |
| 3154 </div> | |
| 3155 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3156 <div>64</div> | |
| 3157 </div> | |
| 3158 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3159 <div>72</div> | |
| 3160 </div> | |
| 3161 <div class=graphicitem style="width: 2.7027027027%"> | |
| 3162 <div> </div> | |
| 3163 <div class=lastlabel>74</div> | |
| 3164 </div> | |
| 3165 </div> | |
| 3166 </div> | |
| 3167 <div style="clear: left"></div> | |
| 3168 </div> | |
| 3169 | |
| 3170 <a class=matchresult | |
| 3171 href="#hit55-1" | |
| 3172 onmouseover='document.getElementById("defline55").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | |
| 3173 onmouseout='document.getElementById("defline55").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 3174 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 3175 <div class="matchrow graphicrow"> | |
| 3176 <div class="matchitem graphicitem" | |
| 3177 style="background-color: green; width: 100%"></div> | |
| 3178 </div> | |
| 3179 </a> | |
| 3180 | |
| 3181 </div> | |
| 3182 </div> | |
| 3183 </div> | |
| 3184 </section> | |
| 3185 | |
| 3186 | |
| 3187 | |
| 3188 <section class=descriptions> | |
| 114 | 3189 <h3>Descriptions</h3> | 
| 106 | 3190 | 
| 3191 <div class=grey><div class=white> | |
| 114 | 3192 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 3193 | 
| 3194 <table class=descriptiontable> | |
| 3195 <col/><col/><col/><col/><col/><col/><col/> | |
| 3196 <tr> | |
| 3197 <th>Description</th> | |
| 3198 <th>Max score</th> | |
| 3199 <th>Total score</th> | |
| 3200 <th>Query cover</th> | |
| 3201 <th>E value</th> | |
| 3202 <th>Ident</th> | |
| 3203 <th>Accession</th> | |
| 3204 </tr> | |
| 3205 <tr> | |
| 3206 <td><div><a href="#hit55-1" | |
| 3207 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | |
| 3208 id="description55-1"> | |
| 3209 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | |
| 3210 </a></div></td> | |
| 3211 <td>89.7</td> | |
| 3212 <td>89.7</td> | |
| 3213 <td>100%</td> | |
| 3214 <td>6.629e-23</td> | |
| 3215 <td>86%</td> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3216 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a></td> | 
| 106 | 3217 </tr> | 
| 3218 </table> | |
| 3219 | |
| 3220 </div></div> | |
| 3221 </section> | |
| 3222 | |
| 3223 | |
| 3224 | |
| 3225 <section class=alignments> | |
| 114 | 3226 <h3>Alignments</h3> | 
| 106 | 3227 | 
| 3228 <div class=grey><div class=white> | |
| 3229 <div class=alignment id=hit55-1> | |
| 3230 | |
| 3231 <div class=linkheader> | |
| 3232 <div class=right><a href="#description55-1">Descriptions</a></div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3233 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_7">Gene Bank</a> | 
| 106 | 3234 </div> | 
| 3235 | |
| 3236 <div class=title> | |
| 3237 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 3238 <p class=titleinfo> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3239 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_7">Subject_7</a> | 
| 106 | 3240 <span class=b>Length:</span> 4180 | 
| 3241 <span class=b>Number of Matches:</span> 1 | |
| 3242 </p> | |
| 3243 </div> | |
| 3244 | |
| 3245 | |
| 3246 <div class=hotspot id=hotspot55-1-1> | |
| 3247 <p class=range> | |
| 3248 <span class=range>Range 1: 1516 to 1589</span> | |
| 3249 </p> | |
| 3250 | |
| 3251 <table class=hotspotstable> | |
| 3252 <tr> | |
| 3253 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 3254 </tr> | |
| 3255 <tr> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3256 <td>89.6514 bits (98)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3257 <td>6.62923e-23</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3258 <td>64/74 (86%)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3259 <td>0/74 (0%)</td> | 
| 106 | 3260 <td>Plus/Plus</td> | 
| 3261 </tr> | |
| 3262 </table> | |
| 3263 | |
| 3264 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | |
| 3265 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | | |
| 3266 Subject 1516 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1575</pre> | |
| 3267 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 | |
| 3268 ||||| |||||||| | |
| 3269 Subject 1576 TTCGCCGTCCAGAA 1589</pre> | |
| 3270 </div> | |
| 3271 | |
| 3272 </div> | |
| 3273 | |
| 3274 </div></div> | |
| 3275 </section> | |
| 3276 </section> | |
| 3277 | |
| 3278 <section class=match id=match56> | |
| 3279 | |
| 114 | 3280 <h2>Nucleotide Sequence (74 letters)</h2> | 
| 106 | 3281 | 
| 3282 <section class=header> | |
| 3283 | |
| 3284 <table class=headerdata> | |
| 114 | 3285 <tr><td class=param>Query number:</td><td>56</td></tr> | 
| 3286 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 3287 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 3288 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 3289 </table> | 
| 3290 | |
| 3291 </section> | |
| 3292 | |
| 3293 | |
| 3294 <section class=graphics> | |
| 114 | 3295 <h3>Graphic Summary</h3> | 
| 106 | 3296 | 
| 3297 <div class=grey> | |
| 114 | 3298 <h4 class=centered>Distribution of 56 Blast Hits on the Query Sequence</h4> | 
| 106 | 3299 | 
| 3300 <div class=defline id=defline56> | |
| 3301 Mouse-over to show defline and scores, click to show alignments | |
| 3302 </div> | |
| 3303 | |
| 3304 <div class=graphic> | |
| 114 | 3305 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 3306 <div class=legend><div class=graphicrow> | 
| 3307 <div class=graphicitem style="background-color: black"><40</div> | |
| 3308 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 3309 <div class=graphicitem style="background-color: green">50–80</div> | |
| 3310 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3311 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 3312 </div></div> | 
| 3313 <div style="clear: left"></div> | |
| 3314 | |
| 3315 <div class=tablewrapper> | |
| 3316 | |
| 3317 <div class=scale> | |
| 3318 <div>query:</div> | |
| 3319 <div class=graphicrow> | |
| 3320 <div> | |
| 3321 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3322 <div>8</div> | |
| 3323 </div> | |
| 3324 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3325 <div>16</div> | |
| 3326 </div> | |
| 3327 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3328 <div>24</div> | |
| 3329 </div> | |
| 3330 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3331 <div>32</div> | |
| 3332 </div> | |
| 3333 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3334 <div>40</div> | |
| 3335 </div> | |
| 3336 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3337 <div>48</div> | |
| 3338 </div> | |
| 3339 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3340 <div>56</div> | |
| 3341 </div> | |
| 3342 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3343 <div>64</div> | |
| 3344 </div> | |
| 3345 <div class=graphicitem style="width: 10.8108108108%"> | |
| 3346 <div>72</div> | |
| 3347 </div> | |
| 3348 <div class=graphicitem style="width: 2.7027027027%"> | |
| 3349 <div> </div> | |
| 3350 <div class=lastlabel>74</div> | |
| 3351 </div> | |
| 3352 </div> | |
| 3353 </div> | |
| 3354 <div style="clear: left"></div> | |
| 3355 </div> | |
| 3356 | |
| 3357 <a class=matchresult | |
| 3358 href="#hit56-1" | |
| 3359 onmouseover='document.getElementById("defline56").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | |
| 3360 onmouseout='document.getElementById("defline56").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 3361 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 3362 <div class="matchrow graphicrow"> | |
| 3363 <div class="matchitem graphicitem" | |
| 3364 style="background-color: green; width: 100%"></div> | |
| 3365 </div> | |
| 3366 </a> | |
| 3367 | |
| 3368 </div> | |
| 3369 </div> | |
| 3370 </div> | |
| 3371 </section> | |
| 3372 | |
| 3373 | |
| 3374 | |
| 3375 <section class=descriptions> | |
| 114 | 3376 <h3>Descriptions</h3> | 
| 106 | 3377 | 
| 3378 <div class=grey><div class=white> | |
| 114 | 3379 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 3380 | 
| 3381 <table class=descriptiontable> | |
| 3382 <col/><col/><col/><col/><col/><col/><col/> | |
| 3383 <tr> | |
| 3384 <th>Description</th> | |
| 3385 <th>Max score</th> | |
| 3386 <th>Total score</th> | |
| 3387 <th>Query cover</th> | |
| 3388 <th>E value</th> | |
| 3389 <th>Ident</th> | |
| 3390 <th>Accession</th> | |
| 3391 </tr> | |
| 3392 <tr> | |
| 3393 <td><div><a href="#hit56-1" | |
| 3394 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | |
| 3395 id="description56-1"> | |
| 3396 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | |
| 3397 </a></div></td> | |
| 3398 <td>89.7</td> | |
| 3399 <td>89.7</td> | |
| 3400 <td>100%</td> | |
| 3401 <td>6.629e-23</td> | |
| 3402 <td>86%</td> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3403 <td><a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td> | 
| 106 | 3404 </tr> | 
| 3405 </table> | |
| 3406 | |
| 3407 </div></div> | |
| 3408 </section> | |
| 3409 | |
| 3410 | |
| 3411 | |
| 3412 <section class=alignments> | |
| 114 | 3413 <h3>Alignments</h3> | 
| 106 | 3414 | 
| 3415 <div class=grey><div class=white> | |
| 3416 <div class=alignment id=hit56-1> | |
| 3417 | |
| 3418 <div class=linkheader> | |
| 3419 <div class=right><a href="#description56-1">Descriptions</a></div> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3420 <a class="linkheader" target="_top" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a> | 
| 106 | 3421 </div> | 
| 3422 | |
| 3423 <div class=title> | |
| 3424 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 3425 <p class=titleinfo> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3426 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank?id=Subject_8">Subject_8</a> | 
| 106 | 3427 <span class=b>Length:</span> 4983 | 
| 3428 <span class=b>Number of Matches:</span> 1 | |
| 3429 </p> | |
| 3430 </div> | |
| 3431 | |
| 3432 | |
| 3433 <div class=hotspot id=hotspot56-1-1> | |
| 3434 <p class=range> | |
| 3435 <span class=range>Range 1: 2319 to 2392</span> | |
| 3436 </p> | |
| 3437 | |
| 3438 <table class=hotspotstable> | |
| 3439 <tr> | |
| 3440 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 3441 </tr> | |
| 3442 <tr> | |
| 
118
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3443 <td>89.6514 bits (98)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3444 <td>6.62923e-23</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3445 <td>64/74 (86%)</td> | 
| 
 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 
Jan Kanis <jan.code@jankanis.nl> 
parents: 
114 
diff
changeset
 | 
3446 <td>0/74 (0%)</td> | 
| 106 | 3447 <td>Plus/Plus</td> | 
| 3448 </tr> | |
| 3449 </table> | |
| 3450 | |
| 3451 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | |
| 3452 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | | |
| 3453 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre> | |
| 3454 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 | |
| 3455 ||||| |||||||| | |
| 3456 Subject 2379 TTCGCCGTCCAGAA 2392</pre> | |
| 3457 </div> | |
| 3458 | |
| 3459 </div> | |
| 3460 | |
| 3461 </div></div> | |
| 3462 </section> | |
| 3463 </section> | |
| 3464 | |
| 3465 </div> | |
| 3466 | |
| 3467 <footer> | |
| 3468 This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. | |
| 3469 </footer> | |
| 3470 </body> | |
| 3471 </html> | |
| 3472 | 
