Nucleotide Blast results
| Program: | BLASTN 2.2.29+ |
| Database: | /opt/galaxy/blastdbs/EUginius_plasmid_insert |
Queries
Nucleotide Sequence (20 letters)
| Query number: | 1 |
| Query ID: | Query_1 |
| Definition line: | Forward_Primer|NOST-Spec_(Genetic_ID) |
| Length: | 20 |
Graphic Summary
Descriptions
Alignments
AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
Sequence ID: gnl|BL_ORD_ID|5 Length: 2457 Number of Matches: 1
Range 1: 2119 to 2138
| Score | Expect | Identities | Gaps | Strand |
|---|---|---|---|---|
| 40.1 bits(20) | 0.0 | 20/20(100%) | 0/20(0%) | Plus/Plus |
Query 1 AGCGCGCAAACTAGGATAAA 20
||||||||||||||||||||
Subject 2119 AGCGCGCAAACTAGGATAAA 2138
DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
Sequence ID: gnl|BL_ORD_ID|2 Length: 323 Number of Matches: 1
Range 1: 200 to 219
| Score | Expect | Identities | Gaps | Strand |
|---|---|---|---|---|
| 40.1 bits(20) | 0.0 | 20/20(100%) | 0/20(0%) | Plus/Plus |
Query 1 AGCGCGCAAACTAGGATAAA 20
||||||||||||||||||||
Subject 200 AGCGCGCAAACTAGGATAAA 219
Nucleotide Sequence (20 letters)
| Query number: | 2 |
| Query ID: | Query_2 |
| Definition line: | Reverse_Primer|NOST-Spec_(Genetic_ID) |
| Length: | 20 |
No Hits
| Message: | No hits found |
Nucleotide Sequence (20 letters)
| Query number: | 3 |
| Query ID: | Query_3 |
| Definition line: | Probe|NOST-Spec_(Genetic_ID) |
| Length: | 20 |
Graphic Summary
Descriptions
Alignments
AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000
Sequence ID: gnl|BL_ORD_ID|5 Length: 2457 Number of Matches: 1
Range 1: 2143 to 2162
| Score | Expect | Identities | Gaps | Strand |
|---|---|---|---|---|
| 40.1 bits(20) | 0.0 | 20/20(100%) | 0/20(0%) | Plus/Plus |
Query 1 CGCGCGCGGTGTCATCTATG 20
||||||||||||||||||||
Subject 2143 CGCGCGCGGTGTCATCTATG 2162
DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000
Sequence ID: gnl|BL_ORD_ID|2 Length: 323 Number of Matches: 1
Range 1: 224 to 243
| Score | Expect | Identities | Gaps | Strand |
|---|---|---|---|---|
| 40.1 bits(20) | 0.0 | 20/20(100%) | 0/20(0%) | Plus/Plus |
Query 1 CGCGCGCGGTGTCATCTATG 20
||||||||||||||||||||
Subject 224 CGCGCGCGGTGTCATCTATG 243
AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000
Sequence ID: gnl|BL_ORD_ID|1 Length: 1045 Number of Matches: 1
Range 1: 2 to 18
| Score | Expect | Identities | Gaps | Strand |
|---|---|---|---|---|
| 34.2 bits(17) | 0.0 | 17/17(100%) | 0/17(0%) | Plus/Plus |
Query 4 GCGCGGTGTCATCTATG 20
|||||||||||||||||
Subject 2 GCGCGGTGTCATCTATG 18
Nucleotide Sequence (24 letters)
| Query number: | 4 |
| Query ID: | Query_4 |
| Definition line: | Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R |
| Length: | 24 |
No Hits
| Message: | No hits found |
Nucleotide Sequence (20 letters)
| Query number: | 5 |
| Query ID: | Query_5 |
| Definition line: | Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R |
| Length: | 20 |
No Hits
| Message: | No hits found |
Nucleotide Sequence (25 letters)
| Query number: | 6 |
| Query ID: | Query_6 |
| Definition line: | Probe|QL-ELE-Bt-F1(mod)/Bt-R |
| Length: | 25 |
Graphic Summary
Descriptions
Alignments
EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
Sequence ID: gnl|BL_ORD_ID|7 Length: 4983 Number of Matches: 1
Range 1: 2344 to 2365
| Score | Expect | Identities | Gaps | Strand |
|---|---|---|---|---|
| 36.2 bits(18) | 0.0 | 21/22(95%) | 0/22(0%) | Plus/Plus |
Query 1 ACATGAACAGCGCCTTGACCAC 22
|||||||||||||| |||||||
Subject 2344 ACATGAACAGCGCCCTGACCAC 2365
AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
Sequence ID: gnl|BL_ORD_ID|6 Length: 4180 Number of Matches: 1
Range 1: 1541 to 1562
| Score | Expect | Identities | Gaps | Strand |
|---|---|---|---|---|
| 36.2 bits(18) | 0.0 | 21/22(95%) | 0/22(0%) | Plus/Plus |
Query 1 ACATGAACAGCGCCTTGACCAC 22
|||||||||||||| |||||||
Subject 1541 ACATGAACAGCGCCCTGACCAC 1562
Nucleotide Sequence (74 letters)
| Query number: | 7 |
| Query ID: | Query_7 |
| Definition line: | Amplicon|QL-ELE-Bt-F1(mod)/Bt-R |
| Length: | 74 |
Graphic Summary
Descriptions
Alignments
EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000
Sequence ID: gnl|BL_ORD_ID|7 Length: 4983 Number of Matches: 1
Range 1: 2319 to 2392
| Score | Expect | Identities | Gaps | Strand |
|---|---|---|---|---|
| 67.9 bits(34) | 0.0 | 64/74(86%) | 0/74(0%) | Plus/Plus |
Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60
||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| |
Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378
Query 61 TTCGCAGTCCAGAA 74
||||| ||||||||
Subject 2379 TTCGCCGTCCAGAA 2392
AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000
Sequence ID: gnl|BL_ORD_ID|6 Length: 4180 Number of Matches: 1
Range 1: 1589 to 1516
| Score | Expect | Identities | Gaps | Strand |
|---|---|---|---|---|
| 67.9 bits(34) | 0.0 | 64/74(86%) | 0/74(0%) | Plus/Minus |
Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60
||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| |
Subject 1589 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1530
Query 61 TTCGCAGTCCAGAA 74
||||| ||||||||
Subject 1529 TTCGCCGTCCAGAA 1516