Mercurial > repos > jankanis > blast2html
comparison test-data/blast xml example3.html @ 118:7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
author | Jan Kanis <jan.code@jankanis.nl> |
---|---|
date | Thu, 31 Jul 2014 13:09:30 +0200 |
parents | 4f0ed3b5ae46 |
children |
comparison
equal
deleted
inserted
replaced
117:8ae714069687 | 118:7f3f8c10f44b |
---|---|
717 <div class=legend><div class=graphicrow> | 717 <div class=legend><div class=graphicrow> |
718 <div class=graphicitem style="background-color: black"><40</div> | 718 <div class=graphicitem style="background-color: black"><40</div> |
719 <div class=graphicitem style="background-color: blue">40–50</div> | 719 <div class=graphicitem style="background-color: blue">40–50</div> |
720 <div class=graphicitem style="background-color: green">50–80</div> | 720 <div class=graphicitem style="background-color: green">50–80</div> |
721 <div class=graphicitem style="background-color: magenta">80–200</div> | 721 <div class=graphicitem style="background-color: magenta">80–200</div> |
722 <div class=graphicitem style="background-color: red">200≤</div> | 722 <div class=graphicitem style="background-color: red">≥200</div> |
723 </div></div> | 723 </div></div> |
724 <div style="clear: left"></div> | 724 <div style="clear: left"></div> |
725 | 725 |
726 <div class=tablewrapper> | 726 <div class=tablewrapper> |
727 | 727 |
808 <td>37.4</td> | 808 <td>37.4</td> |
809 <td>37.4</td> | 809 <td>37.4</td> |
810 <td>100%</td> | 810 <td>100%</td> |
811 <td>7.011e-08</td> | 811 <td>7.011e-08</td> |
812 <td>100%</td> | 812 <td>100%</td> |
813 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a></td> | 813 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a></td> |
814 </tr> | 814 </tr> |
815 </table> | 815 </table> |
816 | 816 |
817 </div></div> | 817 </div></div> |
818 </section> | 818 </section> |
825 <div class=grey><div class=white> | 825 <div class=grey><div class=white> |
826 <div class=alignment id=hit3-1> | 826 <div class=alignment id=hit3-1> |
827 | 827 |
828 <div class=linkheader> | 828 <div class=linkheader> |
829 <div class=right><a href="#description3-1">Descriptions</a></div> | 829 <div class=right><a href="#description3-1">Descriptions</a></div> |
830 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Gene Bank</a> | 830 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Gene Bank</a> |
831 </div> | 831 </div> |
832 | 832 |
833 <div class=title> | 833 <div class=title> |
834 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | 834 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> |
835 <p class=titleinfo> | 835 <p class=titleinfo> |
836 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a> | 836 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a> |
837 <span class=b>Length:</span> 323 | 837 <span class=b>Length:</span> 323 |
838 <span class=b>Number of Matches:</span> 1 | 838 <span class=b>Number of Matches:</span> 1 |
839 </p> | 839 </p> |
840 </div> | 840 </div> |
841 | 841 |
848 <table class=hotspotstable> | 848 <table class=hotspotstable> |
849 <tr> | 849 <tr> |
850 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 850 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
851 </tr> | 851 </tr> |
852 <tr> | 852 <tr> |
853 <td>37.4 bits(40)</td> | 853 <td>37.3537 bits (40)</td> |
854 <td>0.0</td> | 854 <td>7.01052e-08</td> |
855 <td>20/20(100%)</td> | 855 <td>20/20 (100%)</td> |
856 <td>0/20(0%)</td> | 856 <td>0/20 (0%)</td> |
857 <td>Plus/Plus</td> | 857 <td>Plus/Plus</td> |
858 </tr> | 858 </tr> |
859 </table> | 859 </table> |
860 | 860 |
861 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | 861 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 |
950 <div class=legend><div class=graphicrow> | 950 <div class=legend><div class=graphicrow> |
951 <div class=graphicitem style="background-color: black"><40</div> | 951 <div class=graphicitem style="background-color: black"><40</div> |
952 <div class=graphicitem style="background-color: blue">40–50</div> | 952 <div class=graphicitem style="background-color: blue">40–50</div> |
953 <div class=graphicitem style="background-color: green">50–80</div> | 953 <div class=graphicitem style="background-color: green">50–80</div> |
954 <div class=graphicitem style="background-color: magenta">80–200</div> | 954 <div class=graphicitem style="background-color: magenta">80–200</div> |
955 <div class=graphicitem style="background-color: red">200≤</div> | 955 <div class=graphicitem style="background-color: red">≥200</div> |
956 </div></div> | 956 </div></div> |
957 <div style="clear: left"></div> | 957 <div style="clear: left"></div> |
958 | 958 |
959 <div class=tablewrapper> | 959 <div class=tablewrapper> |
960 | 960 |
1041 <td>37.4</td> | 1041 <td>37.4</td> |
1042 <td>37.4</td> | 1042 <td>37.4</td> |
1043 <td>100%</td> | 1043 <td>100%</td> |
1044 <td>7.011e-08</td> | 1044 <td>7.011e-08</td> |
1045 <td>100%</td> | 1045 <td>100%</td> |
1046 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a></td> | 1046 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a></td> |
1047 </tr> | 1047 </tr> |
1048 </table> | 1048 </table> |
1049 | 1049 |
1050 </div></div> | 1050 </div></div> |
1051 </section> | 1051 </section> |
1058 <div class=grey><div class=white> | 1058 <div class=grey><div class=white> |
1059 <div class=alignment id=hit6-1> | 1059 <div class=alignment id=hit6-1> |
1060 | 1060 |
1061 <div class=linkheader> | 1061 <div class=linkheader> |
1062 <div class=right><a href="#description6-1">Descriptions</a></div> | 1062 <div class=right><a href="#description6-1">Descriptions</a></div> |
1063 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Gene Bank</a> | 1063 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Gene Bank</a> |
1064 </div> | 1064 </div> |
1065 | 1065 |
1066 <div class=title> | 1066 <div class=title> |
1067 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | 1067 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> |
1068 <p class=titleinfo> | 1068 <p class=titleinfo> |
1069 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a> | 1069 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a> |
1070 <span class=b>Length:</span> 2457 | 1070 <span class=b>Length:</span> 2457 |
1071 <span class=b>Number of Matches:</span> 1 | 1071 <span class=b>Number of Matches:</span> 1 |
1072 </p> | 1072 </p> |
1073 </div> | 1073 </div> |
1074 | 1074 |
1081 <table class=hotspotstable> | 1081 <table class=hotspotstable> |
1082 <tr> | 1082 <tr> |
1083 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1083 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
1084 </tr> | 1084 </tr> |
1085 <tr> | 1085 <tr> |
1086 <td>37.4 bits(40)</td> | 1086 <td>37.3537 bits (40)</td> |
1087 <td>0.0</td> | 1087 <td>7.01052e-08</td> |
1088 <td>20/20(100%)</td> | 1088 <td>20/20 (100%)</td> |
1089 <td>0/20(0%)</td> | 1089 <td>0/20 (0%)</td> |
1090 <td>Plus/Plus</td> | 1090 <td>Plus/Plus</td> |
1091 </tr> | 1091 </tr> |
1092 </table> | 1092 </table> |
1093 | 1093 |
1094 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | 1094 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 |
1408 <div class=legend><div class=graphicrow> | 1408 <div class=legend><div class=graphicrow> |
1409 <div class=graphicitem style="background-color: black"><40</div> | 1409 <div class=graphicitem style="background-color: black"><40</div> |
1410 <div class=graphicitem style="background-color: blue">40–50</div> | 1410 <div class=graphicitem style="background-color: blue">40–50</div> |
1411 <div class=graphicitem style="background-color: green">50–80</div> | 1411 <div class=graphicitem style="background-color: green">50–80</div> |
1412 <div class=graphicitem style="background-color: magenta">80–200</div> | 1412 <div class=graphicitem style="background-color: magenta">80–200</div> |
1413 <div class=graphicitem style="background-color: red">200≤</div> | 1413 <div class=graphicitem style="background-color: red">≥200</div> |
1414 </div></div> | 1414 </div></div> |
1415 <div style="clear: left"></div> | 1415 <div style="clear: left"></div> |
1416 | 1416 |
1417 <div class=tablewrapper> | 1417 <div class=tablewrapper> |
1418 | 1418 |
1501 <td>31.9</td> | 1501 <td>31.9</td> |
1502 <td>31.9</td> | 1502 <td>31.9</td> |
1503 <td>85%</td> | 1503 <td>85%</td> |
1504 <td>2.981e-06</td> | 1504 <td>2.981e-06</td> |
1505 <td>100%</td> | 1505 <td>100%</td> |
1506 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Subject_2</a></td> | 1506 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Subject_2</a></td> |
1507 </tr> | 1507 </tr> |
1508 </table> | 1508 </table> |
1509 | 1509 |
1510 </div></div> | 1510 </div></div> |
1511 </section> | 1511 </section> |
1518 <div class=grey><div class=white> | 1518 <div class=grey><div class=white> |
1519 <div class=alignment id=hit18-1> | 1519 <div class=alignment id=hit18-1> |
1520 | 1520 |
1521 <div class=linkheader> | 1521 <div class=linkheader> |
1522 <div class=right><a href="#description18-1">Descriptions</a></div> | 1522 <div class=right><a href="#description18-1">Descriptions</a></div> |
1523 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Gene Bank</a> | 1523 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Gene Bank</a> |
1524 </div> | 1524 </div> |
1525 | 1525 |
1526 <div class=title> | 1526 <div class=title> |
1527 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | 1527 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> |
1528 <p class=titleinfo> | 1528 <p class=titleinfo> |
1529 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Subject_2</a> | 1529 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_2?report=genbank&log$=nuclalign">Subject_2</a> |
1530 <span class=b>Length:</span> 1045 | 1530 <span class=b>Length:</span> 1045 |
1531 <span class=b>Number of Matches:</span> 1 | 1531 <span class=b>Number of Matches:</span> 1 |
1532 </p> | 1532 </p> |
1533 </div> | 1533 </div> |
1534 | 1534 |
1541 <table class=hotspotstable> | 1541 <table class=hotspotstable> |
1542 <tr> | 1542 <tr> |
1543 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1543 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
1544 </tr> | 1544 </tr> |
1545 <tr> | 1545 <tr> |
1546 <td>31.9 bits(34)</td> | 1546 <td>31.9436 bits (34)</td> |
1547 <td>0.0</td> | 1547 <td>2.98095e-06</td> |
1548 <td>17/17(100%)</td> | 1548 <td>17/17 (100%)</td> |
1549 <td>0/17(0%)</td> | 1549 <td>0/17 (0%)</td> |
1550 <td>Plus/Plus</td> | 1550 <td>Plus/Plus</td> |
1551 </tr> | 1551 </tr> |
1552 </table> | 1552 </table> |
1553 | 1553 |
1554 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | 1554 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 |
1593 <div class=legend><div class=graphicrow> | 1593 <div class=legend><div class=graphicrow> |
1594 <div class=graphicitem style="background-color: black"><40</div> | 1594 <div class=graphicitem style="background-color: black"><40</div> |
1595 <div class=graphicitem style="background-color: blue">40–50</div> | 1595 <div class=graphicitem style="background-color: blue">40–50</div> |
1596 <div class=graphicitem style="background-color: green">50–80</div> | 1596 <div class=graphicitem style="background-color: green">50–80</div> |
1597 <div class=graphicitem style="background-color: magenta">80–200</div> | 1597 <div class=graphicitem style="background-color: magenta">80–200</div> |
1598 <div class=graphicitem style="background-color: red">200≤</div> | 1598 <div class=graphicitem style="background-color: red">≥200</div> |
1599 </div></div> | 1599 </div></div> |
1600 <div style="clear: left"></div> | 1600 <div style="clear: left"></div> |
1601 | 1601 |
1602 <div class=tablewrapper> | 1602 <div class=tablewrapper> |
1603 | 1603 |
1684 <td>37.4</td> | 1684 <td>37.4</td> |
1685 <td>37.4</td> | 1685 <td>37.4</td> |
1686 <td>100%</td> | 1686 <td>100%</td> |
1687 <td>7.011e-08</td> | 1687 <td>7.011e-08</td> |
1688 <td>100%</td> | 1688 <td>100%</td> |
1689 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a></td> | 1689 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a></td> |
1690 </tr> | 1690 </tr> |
1691 </table> | 1691 </table> |
1692 | 1692 |
1693 </div></div> | 1693 </div></div> |
1694 </section> | 1694 </section> |
1701 <div class=grey><div class=white> | 1701 <div class=grey><div class=white> |
1702 <div class=alignment id=hit19-1> | 1702 <div class=alignment id=hit19-1> |
1703 | 1703 |
1704 <div class=linkheader> | 1704 <div class=linkheader> |
1705 <div class=right><a href="#description19-1">Descriptions</a></div> | 1705 <div class=right><a href="#description19-1">Descriptions</a></div> |
1706 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Gene Bank</a> | 1706 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Gene Bank</a> |
1707 </div> | 1707 </div> |
1708 | 1708 |
1709 <div class=title> | 1709 <div class=title> |
1710 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | 1710 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> |
1711 <p class=titleinfo> | 1711 <p class=titleinfo> |
1712 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a> | 1712 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_3?report=genbank&log$=nuclalign">Subject_3</a> |
1713 <span class=b>Length:</span> 323 | 1713 <span class=b>Length:</span> 323 |
1714 <span class=b>Number of Matches:</span> 1 | 1714 <span class=b>Number of Matches:</span> 1 |
1715 </p> | 1715 </p> |
1716 </div> | 1716 </div> |
1717 | 1717 |
1724 <table class=hotspotstable> | 1724 <table class=hotspotstable> |
1725 <tr> | 1725 <tr> |
1726 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1726 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
1727 </tr> | 1727 </tr> |
1728 <tr> | 1728 <tr> |
1729 <td>37.4 bits(40)</td> | 1729 <td>37.3537 bits (40)</td> |
1730 <td>0.0</td> | 1730 <td>7.01052e-08</td> |
1731 <td>20/20(100%)</td> | 1731 <td>20/20 (100%)</td> |
1732 <td>0/20(0%)</td> | 1732 <td>0/20 (0%)</td> |
1733 <td>Plus/Plus</td> | 1733 <td>Plus/Plus</td> |
1734 </tr> | 1734 </tr> |
1735 </table> | 1735 </table> |
1736 | 1736 |
1737 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | 1737 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 |
1826 <div class=legend><div class=graphicrow> | 1826 <div class=legend><div class=graphicrow> |
1827 <div class=graphicitem style="background-color: black"><40</div> | 1827 <div class=graphicitem style="background-color: black"><40</div> |
1828 <div class=graphicitem style="background-color: blue">40–50</div> | 1828 <div class=graphicitem style="background-color: blue">40–50</div> |
1829 <div class=graphicitem style="background-color: green">50–80</div> | 1829 <div class=graphicitem style="background-color: green">50–80</div> |
1830 <div class=graphicitem style="background-color: magenta">80–200</div> | 1830 <div class=graphicitem style="background-color: magenta">80–200</div> |
1831 <div class=graphicitem style="background-color: red">200≤</div> | 1831 <div class=graphicitem style="background-color: red">≥200</div> |
1832 </div></div> | 1832 </div></div> |
1833 <div style="clear: left"></div> | 1833 <div style="clear: left"></div> |
1834 | 1834 |
1835 <div class=tablewrapper> | 1835 <div class=tablewrapper> |
1836 | 1836 |
1917 <td>37.4</td> | 1917 <td>37.4</td> |
1918 <td>37.4</td> | 1918 <td>37.4</td> |
1919 <td>100%</td> | 1919 <td>100%</td> |
1920 <td>7.011e-08</td> | 1920 <td>7.011e-08</td> |
1921 <td>100%</td> | 1921 <td>100%</td> |
1922 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a></td> | 1922 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a></td> |
1923 </tr> | 1923 </tr> |
1924 </table> | 1924 </table> |
1925 | 1925 |
1926 </div></div> | 1926 </div></div> |
1927 </section> | 1927 </section> |
1934 <div class=grey><div class=white> | 1934 <div class=grey><div class=white> |
1935 <div class=alignment id=hit22-1> | 1935 <div class=alignment id=hit22-1> |
1936 | 1936 |
1937 <div class=linkheader> | 1937 <div class=linkheader> |
1938 <div class=right><a href="#description22-1">Descriptions</a></div> | 1938 <div class=right><a href="#description22-1">Descriptions</a></div> |
1939 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Gene Bank</a> | 1939 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Gene Bank</a> |
1940 </div> | 1940 </div> |
1941 | 1941 |
1942 <div class=title> | 1942 <div class=title> |
1943 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | 1943 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> |
1944 <p class=titleinfo> | 1944 <p class=titleinfo> |
1945 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a> | 1945 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_6?report=genbank&log$=nuclalign">Subject_6</a> |
1946 <span class=b>Length:</span> 2457 | 1946 <span class=b>Length:</span> 2457 |
1947 <span class=b>Number of Matches:</span> 1 | 1947 <span class=b>Number of Matches:</span> 1 |
1948 </p> | 1948 </p> |
1949 </div> | 1949 </div> |
1950 | 1950 |
1957 <table class=hotspotstable> | 1957 <table class=hotspotstable> |
1958 <tr> | 1958 <tr> |
1959 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1959 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
1960 </tr> | 1960 </tr> |
1961 <tr> | 1961 <tr> |
1962 <td>37.4 bits(40)</td> | 1962 <td>37.3537 bits (40)</td> |
1963 <td>0.0</td> | 1963 <td>7.01052e-08</td> |
1964 <td>20/20(100%)</td> | 1964 <td>20/20 (100%)</td> |
1965 <td>0/20(0%)</td> | 1965 <td>0/20 (0%)</td> |
1966 <td>Plus/Plus</td> | 1966 <td>Plus/Plus</td> |
1967 </tr> | 1967 </tr> |
1968 </table> | 1968 </table> |
1969 | 1969 |
1970 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | 1970 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 |
2609 <div class=legend><div class=graphicrow> | 2609 <div class=legend><div class=graphicrow> |
2610 <div class=graphicitem style="background-color: black"><40</div> | 2610 <div class=graphicitem style="background-color: black"><40</div> |
2611 <div class=graphicitem style="background-color: blue">40–50</div> | 2611 <div class=graphicitem style="background-color: blue">40–50</div> |
2612 <div class=graphicitem style="background-color: green">50–80</div> | 2612 <div class=graphicitem style="background-color: green">50–80</div> |
2613 <div class=graphicitem style="background-color: magenta">80–200</div> | 2613 <div class=graphicitem style="background-color: magenta">80–200</div> |
2614 <div class=graphicitem style="background-color: red">200≤</div> | 2614 <div class=graphicitem style="background-color: red">≥200</div> |
2615 </div></div> | 2615 </div></div> |
2616 <div style="clear: left"></div> | 2616 <div style="clear: left"></div> |
2617 | 2617 |
2618 <div class=tablewrapper> | 2618 <div class=tablewrapper> |
2619 | 2619 |
2697 <td>37.4</td> | 2697 <td>37.4</td> |
2698 <td>37.4</td> | 2698 <td>37.4</td> |
2699 <td>100%</td> | 2699 <td>100%</td> |
2700 <td>9.338e-08</td> | 2700 <td>9.338e-08</td> |
2701 <td>92%</td> | 2701 <td>92%</td> |
2702 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a></td> | 2702 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a></td> |
2703 </tr> | 2703 </tr> |
2704 </table> | 2704 </table> |
2705 | 2705 |
2706 </div></div> | 2706 </div></div> |
2707 </section> | 2707 </section> |
2714 <div class=grey><div class=white> | 2714 <div class=grey><div class=white> |
2715 <div class=alignment id=hit47-1> | 2715 <div class=alignment id=hit47-1> |
2716 | 2716 |
2717 <div class=linkheader> | 2717 <div class=linkheader> |
2718 <div class=right><a href="#description47-1">Descriptions</a></div> | 2718 <div class=right><a href="#description47-1">Descriptions</a></div> |
2719 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Gene Bank</a> | 2719 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Gene Bank</a> |
2720 </div> | 2720 </div> |
2721 | 2721 |
2722 <div class=title> | 2722 <div class=title> |
2723 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | 2723 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> |
2724 <p class=titleinfo> | 2724 <p class=titleinfo> |
2725 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a> | 2725 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a> |
2726 <span class=b>Length:</span> 4180 | 2726 <span class=b>Length:</span> 4180 |
2727 <span class=b>Number of Matches:</span> 1 | 2727 <span class=b>Number of Matches:</span> 1 |
2728 </p> | 2728 </p> |
2729 </div> | 2729 </div> |
2730 | 2730 |
2737 <table class=hotspotstable> | 2737 <table class=hotspotstable> |
2738 <tr> | 2738 <tr> |
2739 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 2739 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
2740 </tr> | 2740 </tr> |
2741 <tr> | 2741 <tr> |
2742 <td>37.4 bits(40)</td> | 2742 <td>37.3537 bits (40)</td> |
2743 <td>0.0</td> | 2743 <td>9.33825e-08</td> |
2744 <td>23/25(92%)</td> | 2744 <td>23/25 (92%)</td> |
2745 <td>0/25(0%)</td> | 2745 <td>0/25 (0%)</td> |
2746 <td>Plus/Plus</td> | 2746 <td>Plus/Plus</td> |
2747 </tr> | 2747 </tr> |
2748 </table> | 2748 </table> |
2749 | 2749 |
2750 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | 2750 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 |
2789 <div class=legend><div class=graphicrow> | 2789 <div class=legend><div class=graphicrow> |
2790 <div class=graphicitem style="background-color: black"><40</div> | 2790 <div class=graphicitem style="background-color: black"><40</div> |
2791 <div class=graphicitem style="background-color: blue">40–50</div> | 2791 <div class=graphicitem style="background-color: blue">40–50</div> |
2792 <div class=graphicitem style="background-color: green">50–80</div> | 2792 <div class=graphicitem style="background-color: green">50–80</div> |
2793 <div class=graphicitem style="background-color: magenta">80–200</div> | 2793 <div class=graphicitem style="background-color: magenta">80–200</div> |
2794 <div class=graphicitem style="background-color: red">200≤</div> | 2794 <div class=graphicitem style="background-color: red">≥200</div> |
2795 </div></div> | 2795 </div></div> |
2796 <div style="clear: left"></div> | 2796 <div style="clear: left"></div> |
2797 | 2797 |
2798 <div class=tablewrapper> | 2798 <div class=tablewrapper> |
2799 | 2799 |
2877 <td>37.4</td> | 2877 <td>37.4</td> |
2878 <td>37.4</td> | 2878 <td>37.4</td> |
2879 <td>100%</td> | 2879 <td>100%</td> |
2880 <td>9.338e-08</td> | 2880 <td>9.338e-08</td> |
2881 <td>92%</td> | 2881 <td>92%</td> |
2882 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a></td> | 2882 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a></td> |
2883 </tr> | 2883 </tr> |
2884 </table> | 2884 </table> |
2885 | 2885 |
2886 </div></div> | 2886 </div></div> |
2887 </section> | 2887 </section> |
2894 <div class=grey><div class=white> | 2894 <div class=grey><div class=white> |
2895 <div class=alignment id=hit48-1> | 2895 <div class=alignment id=hit48-1> |
2896 | 2896 |
2897 <div class=linkheader> | 2897 <div class=linkheader> |
2898 <div class=right><a href="#description48-1">Descriptions</a></div> | 2898 <div class=right><a href="#description48-1">Descriptions</a></div> |
2899 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Gene Bank</a> | 2899 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Gene Bank</a> |
2900 </div> | 2900 </div> |
2901 | 2901 |
2902 <div class=title> | 2902 <div class=title> |
2903 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | 2903 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> |
2904 <p class=titleinfo> | 2904 <p class=titleinfo> |
2905 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a> | 2905 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a> |
2906 <span class=b>Length:</span> 4983 | 2906 <span class=b>Length:</span> 4983 |
2907 <span class=b>Number of Matches:</span> 1 | 2907 <span class=b>Number of Matches:</span> 1 |
2908 </p> | 2908 </p> |
2909 </div> | 2909 </div> |
2910 | 2910 |
2917 <table class=hotspotstable> | 2917 <table class=hotspotstable> |
2918 <tr> | 2918 <tr> |
2919 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 2919 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
2920 </tr> | 2920 </tr> |
2921 <tr> | 2921 <tr> |
2922 <td>37.4 bits(40)</td> | 2922 <td>37.3537 bits (40)</td> |
2923 <td>0.0</td> | 2923 <td>9.33825e-08</td> |
2924 <td>23/25(92%)</td> | 2924 <td>23/25 (92%)</td> |
2925 <td>0/25(0%)</td> | 2925 <td>0/25 (0%)</td> |
2926 <td>Plus/Plus</td> | 2926 <td>Plus/Plus</td> |
2927 </tr> | 2927 </tr> |
2928 </table> | 2928 </table> |
2929 | 2929 |
2930 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 | 2930 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCACAGC 25 |
3119 <div class=legend><div class=graphicrow> | 3119 <div class=legend><div class=graphicrow> |
3120 <div class=graphicitem style="background-color: black"><40</div> | 3120 <div class=graphicitem style="background-color: black"><40</div> |
3121 <div class=graphicitem style="background-color: blue">40–50</div> | 3121 <div class=graphicitem style="background-color: blue">40–50</div> |
3122 <div class=graphicitem style="background-color: green">50–80</div> | 3122 <div class=graphicitem style="background-color: green">50–80</div> |
3123 <div class=graphicitem style="background-color: magenta">80–200</div> | 3123 <div class=graphicitem style="background-color: magenta">80–200</div> |
3124 <div class=graphicitem style="background-color: red">200≤</div> | 3124 <div class=graphicitem style="background-color: red">≥200</div> |
3125 </div></div> | 3125 </div></div> |
3126 <div style="clear: left"></div> | 3126 <div style="clear: left"></div> |
3127 | 3127 |
3128 <div class=tablewrapper> | 3128 <div class=tablewrapper> |
3129 | 3129 |
3211 <td>89.7</td> | 3211 <td>89.7</td> |
3212 <td>89.7</td> | 3212 <td>89.7</td> |
3213 <td>100%</td> | 3213 <td>100%</td> |
3214 <td>6.629e-23</td> | 3214 <td>6.629e-23</td> |
3215 <td>86%</td> | 3215 <td>86%</td> |
3216 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a></td> | 3216 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a></td> |
3217 </tr> | 3217 </tr> |
3218 </table> | 3218 </table> |
3219 | 3219 |
3220 </div></div> | 3220 </div></div> |
3221 </section> | 3221 </section> |
3228 <div class=grey><div class=white> | 3228 <div class=grey><div class=white> |
3229 <div class=alignment id=hit55-1> | 3229 <div class=alignment id=hit55-1> |
3230 | 3230 |
3231 <div class=linkheader> | 3231 <div class=linkheader> |
3232 <div class=right><a href="#description55-1">Descriptions</a></div> | 3232 <div class=right><a href="#description55-1">Descriptions</a></div> |
3233 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Gene Bank</a> | 3233 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Gene Bank</a> |
3234 </div> | 3234 </div> |
3235 | 3235 |
3236 <div class=title> | 3236 <div class=title> |
3237 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | 3237 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> |
3238 <p class=titleinfo> | 3238 <p class=titleinfo> |
3239 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a> | 3239 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_7?report=genbank&log$=nuclalign">Subject_7</a> |
3240 <span class=b>Length:</span> 4180 | 3240 <span class=b>Length:</span> 4180 |
3241 <span class=b>Number of Matches:</span> 1 | 3241 <span class=b>Number of Matches:</span> 1 |
3242 </p> | 3242 </p> |
3243 </div> | 3243 </div> |
3244 | 3244 |
3251 <table class=hotspotstable> | 3251 <table class=hotspotstable> |
3252 <tr> | 3252 <tr> |
3253 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 3253 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
3254 </tr> | 3254 </tr> |
3255 <tr> | 3255 <tr> |
3256 <td>89.7 bits(98)</td> | 3256 <td>89.6514 bits (98)</td> |
3257 <td>0.0</td> | 3257 <td>6.62923e-23</td> |
3258 <td>64/74(86%)</td> | 3258 <td>64/74 (86%)</td> |
3259 <td>0/74(0%)</td> | 3259 <td>0/74 (0%)</td> |
3260 <td>Plus/Plus</td> | 3260 <td>Plus/Plus</td> |
3261 </tr> | 3261 </tr> |
3262 </table> | 3262 </table> |
3263 | 3263 |
3264 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | 3264 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
3306 <div class=legend><div class=graphicrow> | 3306 <div class=legend><div class=graphicrow> |
3307 <div class=graphicitem style="background-color: black"><40</div> | 3307 <div class=graphicitem style="background-color: black"><40</div> |
3308 <div class=graphicitem style="background-color: blue">40–50</div> | 3308 <div class=graphicitem style="background-color: blue">40–50</div> |
3309 <div class=graphicitem style="background-color: green">50–80</div> | 3309 <div class=graphicitem style="background-color: green">50–80</div> |
3310 <div class=graphicitem style="background-color: magenta">80–200</div> | 3310 <div class=graphicitem style="background-color: magenta">80–200</div> |
3311 <div class=graphicitem style="background-color: red">200≤</div> | 3311 <div class=graphicitem style="background-color: red">≥200</div> |
3312 </div></div> | 3312 </div></div> |
3313 <div style="clear: left"></div> | 3313 <div style="clear: left"></div> |
3314 | 3314 |
3315 <div class=tablewrapper> | 3315 <div class=tablewrapper> |
3316 | 3316 |
3398 <td>89.7</td> | 3398 <td>89.7</td> |
3399 <td>89.7</td> | 3399 <td>89.7</td> |
3400 <td>100%</td> | 3400 <td>100%</td> |
3401 <td>6.629e-23</td> | 3401 <td>6.629e-23</td> |
3402 <td>86%</td> | 3402 <td>86%</td> |
3403 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a></td> | 3403 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a></td> |
3404 </tr> | 3404 </tr> |
3405 </table> | 3405 </table> |
3406 | 3406 |
3407 </div></div> | 3407 </div></div> |
3408 </section> | 3408 </section> |
3415 <div class=grey><div class=white> | 3415 <div class=grey><div class=white> |
3416 <div class=alignment id=hit56-1> | 3416 <div class=alignment id=hit56-1> |
3417 | 3417 |
3418 <div class=linkheader> | 3418 <div class=linkheader> |
3419 <div class=right><a href="#description56-1">Descriptions</a></div> | 3419 <div class=right><a href="#description56-1">Descriptions</a></div> |
3420 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Gene Bank</a> | 3420 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Gene Bank</a> |
3421 </div> | 3421 </div> |
3422 | 3422 |
3423 <div class=title> | 3423 <div class=title> |
3424 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | 3424 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> |
3425 <p class=titleinfo> | 3425 <p class=titleinfo> |
3426 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a> | 3426 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/Subject_8?report=genbank&log$=nuclalign">Subject_8</a> |
3427 <span class=b>Length:</span> 4983 | 3427 <span class=b>Length:</span> 4983 |
3428 <span class=b>Number of Matches:</span> 1 | 3428 <span class=b>Number of Matches:</span> 1 |
3429 </p> | 3429 </p> |
3430 </div> | 3430 </div> |
3431 | 3431 |
3438 <table class=hotspotstable> | 3438 <table class=hotspotstable> |
3439 <tr> | 3439 <tr> |
3440 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 3440 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
3441 </tr> | 3441 </tr> |
3442 <tr> | 3442 <tr> |
3443 <td>89.7 bits(98)</td> | 3443 <td>89.6514 bits (98)</td> |
3444 <td>0.0</td> | 3444 <td>6.62923e-23</td> |
3445 <td>64/74(86%)</td> | 3445 <td>64/74 (86%)</td> |
3446 <td>0/74(0%)</td> | 3446 <td>0/74 (0%)</td> |
3447 <td>Plus/Plus</td> | 3447 <td>Plus/Plus</td> |
3448 </tr> | 3448 </tr> |
3449 </table> | 3449 </table> |
3450 | 3450 |
3451 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | 3451 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |