Mercurial > repos > jankanis > blast2html
comparison test-data/blast xml example4.html @ 118:7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
author | Jan Kanis <jan.code@jankanis.nl> |
---|---|
date | Thu, 31 Jul 2014 13:09:30 +0200 |
parents | 4f0ed3b5ae46 |
children |
comparison
equal
deleted
inserted
replaced
117:8ae714069687 | 118:7f3f8c10f44b |
---|---|
471 <div class=legend><div class=graphicrow> | 471 <div class=legend><div class=graphicrow> |
472 <div class=graphicitem style="background-color: black"><40</div> | 472 <div class=graphicitem style="background-color: black"><40</div> |
473 <div class=graphicitem style="background-color: blue">40–50</div> | 473 <div class=graphicitem style="background-color: blue">40–50</div> |
474 <div class=graphicitem style="background-color: green">50–80</div> | 474 <div class=graphicitem style="background-color: green">50–80</div> |
475 <div class=graphicitem style="background-color: magenta">80–200</div> | 475 <div class=graphicitem style="background-color: magenta">80–200</div> |
476 <div class=graphicitem style="background-color: red">200≤</div> | 476 <div class=graphicitem style="background-color: red">≥200</div> |
477 </div></div> | 477 </div></div> |
478 <div style="clear: left"></div> | 478 <div style="clear: left"></div> |
479 | 479 |
480 <div class=tablewrapper> | 480 <div class=tablewrapper> |
481 | 481 |
573 <td>40.1</td> | 573 <td>40.1</td> |
574 <td>40.1</td> | 574 <td>40.1</td> |
575 <td>100%</td> | 575 <td>100%</td> |
576 <td>1.513e-07</td> | 576 <td>1.513e-07</td> |
577 <td>100%</td> | 577 <td>100%</td> |
578 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">5</a></td> | 578 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">5</a></td> |
579 </tr> | 579 </tr> |
580 <tr> | 580 <tr> |
581 <td><div><a href="#hit1-2" | 581 <td><div><a href="#hit1-2" |
582 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | 582 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
583 id="description1-2"> | 583 id="description1-2"> |
586 <td>40.1</td> | 586 <td>40.1</td> |
587 <td>40.1</td> | 587 <td>40.1</td> |
588 <td>100%</td> | 588 <td>100%</td> |
589 <td>1.513e-07</td> | 589 <td>1.513e-07</td> |
590 <td>100%</td> | 590 <td>100%</td> |
591 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">2</a></td> | 591 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">2</a></td> |
592 </tr> | 592 </tr> |
593 </table> | 593 </table> |
594 | 594 |
595 </div></div> | 595 </div></div> |
596 </section> | 596 </section> |
603 <div class=grey><div class=white> | 603 <div class=grey><div class=white> |
604 <div class=alignment id=hit1-1> | 604 <div class=alignment id=hit1-1> |
605 | 605 |
606 <div class=linkheader> | 606 <div class=linkheader> |
607 <div class=right><a href="#description1-1">Descriptions</a></div> | 607 <div class=right><a href="#description1-1">Descriptions</a></div> |
608 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">Gene Bank</a> | 608 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">Gene Bank</a> |
609 </div> | 609 </div> |
610 | 610 |
611 <div class=title> | 611 <div class=title> |
612 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | 612 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> |
613 <p class=titleinfo> | 613 <p class=titleinfo> |
614 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|5</a> | 614 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|5</a> |
615 <span class=b>Length:</span> 2457 | 615 <span class=b>Length:</span> 2457 |
616 <span class=b>Number of Matches:</span> 1 | 616 <span class=b>Number of Matches:</span> 1 |
617 </p> | 617 </p> |
618 </div> | 618 </div> |
619 | 619 |
626 <table class=hotspotstable> | 626 <table class=hotspotstable> |
627 <tr> | 627 <tr> |
628 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 628 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
629 </tr> | 629 </tr> |
630 <tr> | 630 <tr> |
631 <td>40.1 bits(20)</td> | 631 <td>40.14 bits (20)</td> |
632 <td>0.0</td> | 632 <td>1.51296e-07</td> |
633 <td>20/20(100%)</td> | 633 <td>20/20 (100%)</td> |
634 <td>0/20(0%)</td> | 634 <td>0/20 (0%)</td> |
635 <td>Plus/Plus</td> | 635 <td>Plus/Plus</td> |
636 </tr> | 636 </tr> |
637 </table> | 637 </table> |
638 | 638 |
639 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | 639 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 |
645 | 645 |
646 <div class=alignment id=hit1-2> | 646 <div class=alignment id=hit1-2> |
647 | 647 |
648 <div class=linkheader> | 648 <div class=linkheader> |
649 <div class=right><a href="#description1-2">Descriptions</a></div> | 649 <div class=right><a href="#description1-2">Descriptions</a></div> |
650 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">Gene Bank</a> | 650 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">Gene Bank</a> |
651 </div> | 651 </div> |
652 | 652 |
653 <div class=title> | 653 <div class=title> |
654 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | 654 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> |
655 <p class=titleinfo> | 655 <p class=titleinfo> |
656 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|2</a> | 656 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|2</a> |
657 <span class=b>Length:</span> 323 | 657 <span class=b>Length:</span> 323 |
658 <span class=b>Number of Matches:</span> 1 | 658 <span class=b>Number of Matches:</span> 1 |
659 </p> | 659 </p> |
660 </div> | 660 </div> |
661 | 661 |
668 <table class=hotspotstable> | 668 <table class=hotspotstable> |
669 <tr> | 669 <tr> |
670 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 670 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
671 </tr> | 671 </tr> |
672 <tr> | 672 <tr> |
673 <td>40.1 bits(20)</td> | 673 <td>40.14 bits (20)</td> |
674 <td>0.0</td> | 674 <td>1.51296e-07</td> |
675 <td>20/20(100%)</td> | 675 <td>20/20 (100%)</td> |
676 <td>0/20(0%)</td> | 676 <td>0/20 (0%)</td> |
677 <td>Plus/Plus</td> | 677 <td>Plus/Plus</td> |
678 </tr> | 678 </tr> |
679 </table> | 679 </table> |
680 | 680 |
681 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | 681 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 |
745 <div class=legend><div class=graphicrow> | 745 <div class=legend><div class=graphicrow> |
746 <div class=graphicitem style="background-color: black"><40</div> | 746 <div class=graphicitem style="background-color: black"><40</div> |
747 <div class=graphicitem style="background-color: blue">40–50</div> | 747 <div class=graphicitem style="background-color: blue">40–50</div> |
748 <div class=graphicitem style="background-color: green">50–80</div> | 748 <div class=graphicitem style="background-color: green">50–80</div> |
749 <div class=graphicitem style="background-color: magenta">80–200</div> | 749 <div class=graphicitem style="background-color: magenta">80–200</div> |
750 <div class=graphicitem style="background-color: red">200≤</div> | 750 <div class=graphicitem style="background-color: red">≥200</div> |
751 </div></div> | 751 </div></div> |
752 <div style="clear: left"></div> | 752 <div style="clear: left"></div> |
753 | 753 |
754 <div class=tablewrapper> | 754 <div class=tablewrapper> |
755 | 755 |
860 <td>40.1</td> | 860 <td>40.1</td> |
861 <td>40.1</td> | 861 <td>40.1</td> |
862 <td>100%</td> | 862 <td>100%</td> |
863 <td>1.513e-07</td> | 863 <td>1.513e-07</td> |
864 <td>100%</td> | 864 <td>100%</td> |
865 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">5</a></td> | 865 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">5</a></td> |
866 </tr> | 866 </tr> |
867 <tr> | 867 <tr> |
868 <td><div><a href="#hit3-2" | 868 <td><div><a href="#hit3-2" |
869 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | 869 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" |
870 id="description3-2"> | 870 id="description3-2"> |
873 <td>40.1</td> | 873 <td>40.1</td> |
874 <td>40.1</td> | 874 <td>40.1</td> |
875 <td>100%</td> | 875 <td>100%</td> |
876 <td>1.513e-07</td> | 876 <td>1.513e-07</td> |
877 <td>100%</td> | 877 <td>100%</td> |
878 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">2</a></td> | 878 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">2</a></td> |
879 </tr> | 879 </tr> |
880 <tr> | 880 <tr> |
881 <td><div><a href="#hit3-3" | 881 <td><div><a href="#hit3-3" |
882 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" | 882 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" |
883 id="description3-3"> | 883 id="description3-3"> |
886 <td>34.2</td> | 886 <td>34.2</td> |
887 <td>34.2</td> | 887 <td>34.2</td> |
888 <td>85%</td> | 888 <td>85%</td> |
889 <td>9.334e-06</td> | 889 <td>9.334e-06</td> |
890 <td>100%</td> | 890 <td>100%</td> |
891 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">1</a></td> | 891 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">1</a></td> |
892 </tr> | 892 </tr> |
893 </table> | 893 </table> |
894 | 894 |
895 </div></div> | 895 </div></div> |
896 </section> | 896 </section> |
903 <div class=grey><div class=white> | 903 <div class=grey><div class=white> |
904 <div class=alignment id=hit3-1> | 904 <div class=alignment id=hit3-1> |
905 | 905 |
906 <div class=linkheader> | 906 <div class=linkheader> |
907 <div class=right><a href="#description3-1">Descriptions</a></div> | 907 <div class=right><a href="#description3-1">Descriptions</a></div> |
908 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">Gene Bank</a> | 908 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">Gene Bank</a> |
909 </div> | 909 </div> |
910 | 910 |
911 <div class=title> | 911 <div class=title> |
912 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | 912 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> |
913 <p class=titleinfo> | 913 <p class=titleinfo> |
914 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|5</a> | 914 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/5?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|5</a> |
915 <span class=b>Length:</span> 2457 | 915 <span class=b>Length:</span> 2457 |
916 <span class=b>Number of Matches:</span> 1 | 916 <span class=b>Number of Matches:</span> 1 |
917 </p> | 917 </p> |
918 </div> | 918 </div> |
919 | 919 |
926 <table class=hotspotstable> | 926 <table class=hotspotstable> |
927 <tr> | 927 <tr> |
928 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 928 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
929 </tr> | 929 </tr> |
930 <tr> | 930 <tr> |
931 <td>40.1 bits(20)</td> | 931 <td>40.14 bits (20)</td> |
932 <td>0.0</td> | 932 <td>1.51296e-07</td> |
933 <td>20/20(100%)</td> | 933 <td>20/20 (100%)</td> |
934 <td>0/20(0%)</td> | 934 <td>0/20 (0%)</td> |
935 <td>Plus/Plus</td> | 935 <td>Plus/Plus</td> |
936 </tr> | 936 </tr> |
937 </table> | 937 </table> |
938 | 938 |
939 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | 939 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 |
945 | 945 |
946 <div class=alignment id=hit3-2> | 946 <div class=alignment id=hit3-2> |
947 | 947 |
948 <div class=linkheader> | 948 <div class=linkheader> |
949 <div class=right><a href="#description3-2">Descriptions</a></div> | 949 <div class=right><a href="#description3-2">Descriptions</a></div> |
950 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">Gene Bank</a> | 950 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">Gene Bank</a> |
951 </div> | 951 </div> |
952 | 952 |
953 <div class=title> | 953 <div class=title> |
954 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | 954 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> |
955 <p class=titleinfo> | 955 <p class=titleinfo> |
956 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|2</a> | 956 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/2?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|2</a> |
957 <span class=b>Length:</span> 323 | 957 <span class=b>Length:</span> 323 |
958 <span class=b>Number of Matches:</span> 1 | 958 <span class=b>Number of Matches:</span> 1 |
959 </p> | 959 </p> |
960 </div> | 960 </div> |
961 | 961 |
968 <table class=hotspotstable> | 968 <table class=hotspotstable> |
969 <tr> | 969 <tr> |
970 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 970 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
971 </tr> | 971 </tr> |
972 <tr> | 972 <tr> |
973 <td>40.1 bits(20)</td> | 973 <td>40.14 bits (20)</td> |
974 <td>0.0</td> | 974 <td>1.51296e-07</td> |
975 <td>20/20(100%)</td> | 975 <td>20/20 (100%)</td> |
976 <td>0/20(0%)</td> | 976 <td>0/20 (0%)</td> |
977 <td>Plus/Plus</td> | 977 <td>Plus/Plus</td> |
978 </tr> | 978 </tr> |
979 </table> | 979 </table> |
980 | 980 |
981 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | 981 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 |
987 | 987 |
988 <div class=alignment id=hit3-3> | 988 <div class=alignment id=hit3-3> |
989 | 989 |
990 <div class=linkheader> | 990 <div class=linkheader> |
991 <div class=right><a href="#description3-3">Descriptions</a></div> | 991 <div class=right><a href="#description3-3">Descriptions</a></div> |
992 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">Gene Bank</a> | 992 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">Gene Bank</a> |
993 </div> | 993 </div> |
994 | 994 |
995 <div class=title> | 995 <div class=title> |
996 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | 996 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> |
997 <p class=titleinfo> | 997 <p class=titleinfo> |
998 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|1</a> | 998 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/1?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|1</a> |
999 <span class=b>Length:</span> 1045 | 999 <span class=b>Length:</span> 1045 |
1000 <span class=b>Number of Matches:</span> 1 | 1000 <span class=b>Number of Matches:</span> 1 |
1001 </p> | 1001 </p> |
1002 </div> | 1002 </div> |
1003 | 1003 |
1010 <table class=hotspotstable> | 1010 <table class=hotspotstable> |
1011 <tr> | 1011 <tr> |
1012 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1012 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
1013 </tr> | 1013 </tr> |
1014 <tr> | 1014 <tr> |
1015 <td>34.2 bits(17)</td> | 1015 <td>34.1929 bits (17)</td> |
1016 <td>0.0</td> | 1016 <td>9.33411e-06</td> |
1017 <td>17/17(100%)</td> | 1017 <td>17/17 (100%)</td> |
1018 <td>0/17(0%)</td> | 1018 <td>0/17 (0%)</td> |
1019 <td>Plus/Plus</td> | 1019 <td>Plus/Plus</td> |
1020 </tr> | 1020 </tr> |
1021 </table> | 1021 </table> |
1022 | 1022 |
1023 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | 1023 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 |
1112 <div class=legend><div class=graphicrow> | 1112 <div class=legend><div class=graphicrow> |
1113 <div class=graphicitem style="background-color: black"><40</div> | 1113 <div class=graphicitem style="background-color: black"><40</div> |
1114 <div class=graphicitem style="background-color: blue">40–50</div> | 1114 <div class=graphicitem style="background-color: blue">40–50</div> |
1115 <div class=graphicitem style="background-color: green">50–80</div> | 1115 <div class=graphicitem style="background-color: green">50–80</div> |
1116 <div class=graphicitem style="background-color: magenta">80–200</div> | 1116 <div class=graphicitem style="background-color: magenta">80–200</div> |
1117 <div class=graphicitem style="background-color: red">200≤</div> | 1117 <div class=graphicitem style="background-color: red">≥200</div> |
1118 </div></div> | 1118 </div></div> |
1119 <div style="clear: left"></div> | 1119 <div style="clear: left"></div> |
1120 | 1120 |
1121 <div class=tablewrapper> | 1121 <div class=tablewrapper> |
1122 | 1122 |
1215 <td>36.2</td> | 1215 <td>36.2</td> |
1216 <td>36.2</td> | 1216 <td>36.2</td> |
1217 <td>88%</td> | 1217 <td>88%</td> |
1218 <td>3.148e-06</td> | 1218 <td>3.148e-06</td> |
1219 <td>95%</td> | 1219 <td>95%</td> |
1220 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">7</a></td> | 1220 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">7</a></td> |
1221 </tr> | 1221 </tr> |
1222 <tr> | 1222 <tr> |
1223 <td><div><a href="#hit6-2" | 1223 <td><div><a href="#hit6-2" |
1224 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | 1224 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
1225 id="description6-2"> | 1225 id="description6-2"> |
1228 <td>36.2</td> | 1228 <td>36.2</td> |
1229 <td>36.2</td> | 1229 <td>36.2</td> |
1230 <td>88%</td> | 1230 <td>88%</td> |
1231 <td>3.148e-06</td> | 1231 <td>3.148e-06</td> |
1232 <td>95%</td> | 1232 <td>95%</td> |
1233 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">6</a></td> | 1233 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">6</a></td> |
1234 </tr> | 1234 </tr> |
1235 </table> | 1235 </table> |
1236 | 1236 |
1237 </div></div> | 1237 </div></div> |
1238 </section> | 1238 </section> |
1245 <div class=grey><div class=white> | 1245 <div class=grey><div class=white> |
1246 <div class=alignment id=hit6-1> | 1246 <div class=alignment id=hit6-1> |
1247 | 1247 |
1248 <div class=linkheader> | 1248 <div class=linkheader> |
1249 <div class=right><a href="#description6-1">Descriptions</a></div> | 1249 <div class=right><a href="#description6-1">Descriptions</a></div> |
1250 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">Gene Bank</a> | 1250 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">Gene Bank</a> |
1251 </div> | 1251 </div> |
1252 | 1252 |
1253 <div class=title> | 1253 <div class=title> |
1254 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | 1254 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> |
1255 <p class=titleinfo> | 1255 <p class=titleinfo> |
1256 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|7</a> | 1256 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|7</a> |
1257 <span class=b>Length:</span> 4983 | 1257 <span class=b>Length:</span> 4983 |
1258 <span class=b>Number of Matches:</span> 1 | 1258 <span class=b>Number of Matches:</span> 1 |
1259 </p> | 1259 </p> |
1260 </div> | 1260 </div> |
1261 | 1261 |
1268 <table class=hotspotstable> | 1268 <table class=hotspotstable> |
1269 <tr> | 1269 <tr> |
1270 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1270 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
1271 </tr> | 1271 </tr> |
1272 <tr> | 1272 <tr> |
1273 <td>36.2 bits(18)</td> | 1273 <td>36.1753 bits (18)</td> |
1274 <td>0.0</td> | 1274 <td>3.14801e-06</td> |
1275 <td>21/22(95%)</td> | 1275 <td>21/22 (95%)</td> |
1276 <td>0/22(0%)</td> | 1276 <td>0/22 (0%)</td> |
1277 <td>Plus/Plus</td> | 1277 <td>Plus/Plus</td> |
1278 </tr> | 1278 </tr> |
1279 </table> | 1279 </table> |
1280 | 1280 |
1281 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | 1281 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 |
1287 | 1287 |
1288 <div class=alignment id=hit6-2> | 1288 <div class=alignment id=hit6-2> |
1289 | 1289 |
1290 <div class=linkheader> | 1290 <div class=linkheader> |
1291 <div class=right><a href="#description6-2">Descriptions</a></div> | 1291 <div class=right><a href="#description6-2">Descriptions</a></div> |
1292 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">Gene Bank</a> | 1292 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">Gene Bank</a> |
1293 </div> | 1293 </div> |
1294 | 1294 |
1295 <div class=title> | 1295 <div class=title> |
1296 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | 1296 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> |
1297 <p class=titleinfo> | 1297 <p class=titleinfo> |
1298 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|6</a> | 1298 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|6</a> |
1299 <span class=b>Length:</span> 4180 | 1299 <span class=b>Length:</span> 4180 |
1300 <span class=b>Number of Matches:</span> 1 | 1300 <span class=b>Number of Matches:</span> 1 |
1301 </p> | 1301 </p> |
1302 </div> | 1302 </div> |
1303 | 1303 |
1310 <table class=hotspotstable> | 1310 <table class=hotspotstable> |
1311 <tr> | 1311 <tr> |
1312 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1312 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
1313 </tr> | 1313 </tr> |
1314 <tr> | 1314 <tr> |
1315 <td>36.2 bits(18)</td> | 1315 <td>36.1753 bits (18)</td> |
1316 <td>0.0</td> | 1316 <td>3.14801e-06</td> |
1317 <td>21/22(95%)</td> | 1317 <td>21/22 (95%)</td> |
1318 <td>0/22(0%)</td> | 1318 <td>0/22 (0%)</td> |
1319 <td>Plus/Plus</td> | 1319 <td>Plus/Plus</td> |
1320 </tr> | 1320 </tr> |
1321 </table> | 1321 </table> |
1322 | 1322 |
1323 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | 1323 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 |
1362 <div class=legend><div class=graphicrow> | 1362 <div class=legend><div class=graphicrow> |
1363 <div class=graphicitem style="background-color: black"><40</div> | 1363 <div class=graphicitem style="background-color: black"><40</div> |
1364 <div class=graphicitem style="background-color: blue">40–50</div> | 1364 <div class=graphicitem style="background-color: blue">40–50</div> |
1365 <div class=graphicitem style="background-color: green">50–80</div> | 1365 <div class=graphicitem style="background-color: green">50–80</div> |
1366 <div class=graphicitem style="background-color: magenta">80–200</div> | 1366 <div class=graphicitem style="background-color: magenta">80–200</div> |
1367 <div class=graphicitem style="background-color: red">200≤</div> | 1367 <div class=graphicitem style="background-color: red">≥200</div> |
1368 </div></div> | 1368 </div></div> |
1369 <div style="clear: left"></div> | 1369 <div style="clear: left"></div> |
1370 | 1370 |
1371 <div class=tablewrapper> | 1371 <div class=tablewrapper> |
1372 | 1372 |
1465 <td>67.9</td> | 1465 <td>67.9</td> |
1466 <td>67.9</td> | 1466 <td>67.9</td> |
1467 <td>100%</td> | 1467 <td>100%</td> |
1468 <td>3.564e-15</td> | 1468 <td>3.564e-15</td> |
1469 <td>86%</td> | 1469 <td>86%</td> |
1470 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">7</a></td> | 1470 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">7</a></td> |
1471 </tr> | 1471 </tr> |
1472 <tr> | 1472 <tr> |
1473 <td><div><a href="#hit7-2" | 1473 <td><div><a href="#hit7-2" |
1474 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | 1474 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" |
1475 id="description7-2"> | 1475 id="description7-2"> |
1478 <td>67.9</td> | 1478 <td>67.9</td> |
1479 <td>67.9</td> | 1479 <td>67.9</td> |
1480 <td>100%</td> | 1480 <td>100%</td> |
1481 <td>3.564e-15</td> | 1481 <td>3.564e-15</td> |
1482 <td>86%</td> | 1482 <td>86%</td> |
1483 <td><a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">6</a></td> | 1483 <td><a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">6</a></td> |
1484 </tr> | 1484 </tr> |
1485 </table> | 1485 </table> |
1486 | 1486 |
1487 </div></div> | 1487 </div></div> |
1488 </section> | 1488 </section> |
1495 <div class=grey><div class=white> | 1495 <div class=grey><div class=white> |
1496 <div class=alignment id=hit7-1> | 1496 <div class=alignment id=hit7-1> |
1497 | 1497 |
1498 <div class=linkheader> | 1498 <div class=linkheader> |
1499 <div class=right><a href="#description7-1">Descriptions</a></div> | 1499 <div class=right><a href="#description7-1">Descriptions</a></div> |
1500 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">Gene Bank</a> | 1500 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">Gene Bank</a> |
1501 </div> | 1501 </div> |
1502 | 1502 |
1503 <div class=title> | 1503 <div class=title> |
1504 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | 1504 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> |
1505 <p class=titleinfo> | 1505 <p class=titleinfo> |
1506 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|7</a> | 1506 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/7?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|7</a> |
1507 <span class=b>Length:</span> 4983 | 1507 <span class=b>Length:</span> 4983 |
1508 <span class=b>Number of Matches:</span> 1 | 1508 <span class=b>Number of Matches:</span> 1 |
1509 </p> | 1509 </p> |
1510 </div> | 1510 </div> |
1511 | 1511 |
1518 <table class=hotspotstable> | 1518 <table class=hotspotstable> |
1519 <tr> | 1519 <tr> |
1520 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1520 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
1521 </tr> | 1521 </tr> |
1522 <tr> | 1522 <tr> |
1523 <td>67.9 bits(34)</td> | 1523 <td>67.8929 bits (34)</td> |
1524 <td>0.0</td> | 1524 <td>3.56369e-15</td> |
1525 <td>64/74(86%)</td> | 1525 <td>64/74 (86%)</td> |
1526 <td>0/74(0%)</td> | 1526 <td>0/74 (0%)</td> |
1527 <td>Plus/Plus</td> | 1527 <td>Plus/Plus</td> |
1528 </tr> | 1528 </tr> |
1529 </table> | 1529 </table> |
1530 | 1530 |
1531 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | 1531 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |
1540 | 1540 |
1541 <div class=alignment id=hit7-2> | 1541 <div class=alignment id=hit7-2> |
1542 | 1542 |
1543 <div class=linkheader> | 1543 <div class=linkheader> |
1544 <div class=right><a href="#description7-2">Descriptions</a></div> | 1544 <div class=right><a href="#description7-2">Descriptions</a></div> |
1545 <a class="linkheader" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">Gene Bank</a> | 1545 <a class="linkheader" target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">Gene Bank</a> |
1546 </div> | 1546 </div> |
1547 | 1547 |
1548 <div class=title> | 1548 <div class=title> |
1549 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | 1549 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> |
1550 <p class=titleinfo> | 1550 <p class=titleinfo> |
1551 <span class=b>Sequence ID:</span> <a href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|6</a> | 1551 <span class=b>Sequence ID:</span> <a target="_top" href="http://www.ncbi.nlm.nih.gov/nucleotide/6?report=genbank&log$=nuclalign">gnl|BL_ORD_ID|6</a> |
1552 <span class=b>Length:</span> 4180 | 1552 <span class=b>Length:</span> 4180 |
1553 <span class=b>Number of Matches:</span> 1 | 1553 <span class=b>Number of Matches:</span> 1 |
1554 </p> | 1554 </p> |
1555 </div> | 1555 </div> |
1556 | 1556 |
1563 <table class=hotspotstable> | 1563 <table class=hotspotstable> |
1564 <tr> | 1564 <tr> |
1565 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | 1565 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> |
1566 </tr> | 1566 </tr> |
1567 <tr> | 1567 <tr> |
1568 <td>67.9 bits(34)</td> | 1568 <td>67.8929 bits (34)</td> |
1569 <td>0.0</td> | 1569 <td>3.56369e-15</td> |
1570 <td>64/74(86%)</td> | 1570 <td>64/74 (86%)</td> |
1571 <td>0/74(0%)</td> | 1571 <td>0/74 (0%)</td> |
1572 <td>Plus/Minus</td> | 1572 <td>Plus/Minus</td> |
1573 </tr> | 1573 </tr> |
1574 </table> | 1574 </table> |
1575 | 1575 |
1576 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | 1576 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 |